siRNA Delivery with Stem Cell Membrane-Coated Magnetic

Subscriber access provided by University of Sunderland

Controlled Release and Delivery Systems

siRNA delivery with stem cell membrane-coated magnetic nanoparticles for imaging-guided photothermal therapy and gene therapy Xupeng Mu, Jing Li, Shaohua Yan, Hongmei Zhang, Wenjing Zhang, Fuqiang Zhang, and Jinlan Jiang ACS Biomater. Sci. Eng., Just Accepted Manuscript • DOI: 10.1021/acsbiomaterials.8b00858 • Publication Date (Web): 20 Sep 2018 Downloaded from http://pubs.acs.org on September 22, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Biomaterials Science & Engineering

siRNA Delivery with Stem Cell Membrane-Coated Magnetic Nanoparticles for Imaging-Guided Photothermal Therapy and Gene Therapy Xupeng Mu,†,§ Jing Li,†,§ Shaohua Yan,‡ Hongmei Zhang,† Wenjing Zhang,† Fuqiang Zhang,*,† and Jinlan Jiang *,† †

Department of Central Laboratory, China-Japan Union Hospital, Jilin University,

126 Xiantai Street, Changchun, 130033, P. R. China. ‡

Department of Biological Engineering, College of Pharmacy, Jilin University, 1163

Xinmin Street, Changchun, 130021, P. R. China. §

These authors contributed equally to this work.

*Correspondence should be addressed to Prof. Jinlan Jiang ([email protected]) and Dr. Fuqiang Zhang ([email protected]).

ABSTRACT: Biomimetic cell membrane coated nanoparticles (NPs) with desirable features have been extensively applied for various personalized biomedicine. However, by now, there have not relative explorations by employing the membrane nanocomplexes for small interfering RNA (siRNA) delivery. Herein, Fe3O4@PDA NPs with better photothermal capability were applied for efficient siRNA loading and delivery, which were then coated by mesenchymal stem cells (MSCs) membrane. The data

showed

that

MSCs

membrane

coated

Fe3O4@PDA-siRNA

NPs

(Fe3O4@PDA-siRNA@MSCs) maintained the photothermal functionality and the capability of MR imaging inherited from Fe3O4@PDA. The synthesized nanocomplexes exhibited the excellent abilities in the delivery of siRNA into DU145 cells. Furthermore, Fe3O4@PDA-siRNA@MSCs NPs delivering siRNA against Plk1 gene could inhibit the expression of endogenous Plk1 gene and cause obvious apoptosis in DU145 cells. The synergistic combination of photothermal treatment and gene silencing showed obvious antitumor efficacy in a DU145 xenograft mice model. Based on preliminary in vitro and in vivo studies, Fe3O4@PDA-siRNA@MSCs NPs hold the considerable promise as a carrier for gene and photothermal therapy. KEYWORDS: stem cell membrane, photothermal therapy, gene therapy, magnetic resonance imaging

1

ACS Paragon Plus Environment

ACS Biomaterials Science & Engineering 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 30

INTRODUCTION Small interfering RNA (siRNA) has been reported as a potential therapeutic agent for gene therapy due to its gene targeting (knockout) function.1-3 However, due to its polyanionic and instability character, siRNA is difficult to enter cells by passive diffusion.4 To date, many efficient materials including liposomes, polymer, and peptide conjugates systems have been commonly used for delivery of siRNA.5-9 Among these formulations, liposome-based vectors have the advantages of good stability, high transfection efficiency, and have been widely applied for siRNA delivery. However, toxicity and degradation of siRNA were the major challenges for cationic liposomes in vivo applications.10,11 Recently, as the natural analog of liposomes, cell membrane derived vesicles begin to be used in drug delivery. The membrane vesicles have the composition of the source cell membranes, which thus make them inherently biocompatible and lowly immunogenic in vivo. Studies have reported that plasma-derived exosomes could deliver siRNA to monocytes and lymphocytes.12 Aside from exosomes, another natural vesicles were those prepared from cell membranes including erythrocytes,13-15 leukocytes,16,17 stem cells,18 and platelets.19,20 As a natural biomimetic delivery platform, stem cell membrane-derived vesicles by cloaking nanoparticles possessed remarkably long circulation and high tumor targeting property.21 Iron oxide (Fe3O4) NPs have been intensively studied in clinical applications due to their high biocompatibility, low toxicity, and their direct magnetic resonance (MR) imaging capability.22,23 Very recently, polydopamine (PDA)-coated hydrophobic Fe3O4 NPs have been employed as a photothermal (PTT) therapeutic agent for in vivo cancer photothermal therapy owing to its excellent near-infrared (NIR) optical performance and high photothermal conversion efficiency.24,25 Furthermore, PDA has numerous surface functional groups (i.e., amine and catechol), which could bind various biomolecules such as single-stranded DNA.26 Inspired by novel cell membrane coating strategy, in this work, we developed the mesenchymal

stem

cells

membrane-coated

Fe3O4@PDA

(Fe3O4@PDA-

siRNA@MSCs) NPs as an imaging-guided photothermal and siRNA delivery platform. Fe3O4@PDA-siRNA@MSCs NPs displayed the excellent MSCs-mimicking cancer targeting capacity and photothermal conversion efficiency in vitro. Furthermore, the prepared Fe3O4@PDA particles could adsorb siRNA for gene therapy.

Then,

we

further

detected

the

siRNA

2


delivery

efficiency

of

Page 3 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fe3O4@PDA-siRNA@MSCs NPs and gene silencing efficiency against Plk1 in vitro. The synergetic antitumor effect of Fe3O4@PDA-siRNA@MSCs NPs combined with MR imaging in vivo was also studied. MATERIALS AND METHODS Materials and Reagents. Fetal bovine serum (FBS), Dulbecco’s modified Eagle medium (DMEM) with high glucose, penicillin-streptomycin, DMEM-F12, and hydrophobic

1,1’-dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine

perchlorate

(DiD) were obtained from ThermoFisher (USA). Cell counting kit-8 (CCK-8), Annexin V-FITC apoptosis detection kit, 4’, 6-diamidino-2-phenylindole (DAPI), SDS sample buffer, BCA protein assay kit, and Calcein-AM were obtained from Beyotime (China). All the other reagents used in this study were obtained from Solarbio (China) and Aladdin-Reagent (China). SiRNA targeting Plk1 (sense: 5’-UGAAGAAGAUCACCCUCCUUA-3’; antisense:

5’-UAAGGAGGGUGAUC

UUCUUCA-3’. Named as siPlk1), and fluorescein (FAM)-labeled siRNA (sense: 5’-UUCUCCGAACGUG UCACGUTT-3’. Named as FAM-siRNA) were ordered from GenePharma (China). The primers were ordered from Sangon (China). Anti-Plk1, and anti-β-actin were purchased from Santa Cruz (CA, USA). IRDye®680 goat anti-mouse IgG was obtained from Li-COR Biosciences Inc (NE, USA). DU145 prostate cancer cells were purchased from American Type Culture Collection (ATCC). Human umbilical cord-derived mesenchymal stem cells (MSCs) were prepared by our laboratory. All cells were cultured according to the instructions. BALB/c nude mice (4-5 weeks) were obtained from Vital River Laboratory Animal Center (China). Mice were treated according to the ethical guidelines obtained from the Animal Care and Use Committee of Jilin University. All of the experiments were performed in accordance with the guidelines of the Institutional Animal Care. Preparation of Fe3O4@PDA NPs. Fe3O4@PDA NPs were prepared according to the method we have reported.24,25 Firstly, the as-prepared Fe3O4 NPs were added into Tris-buffer solution (10 mM) and adjusted to pH 8.5. The mixture was then added into dopamine (DA) solution (0.1 mg mL-1). After stirring for 3 h at room temperature, with the color of the solution turning to dark brown, the dopamine (DA) molecules would be oxidized and self-polymerized on the surface of Fe3O4 NPs. Finally, the Fe3O4@PDA NPs were collected by centrifugation and washed with deionized water. Preparation of MSCs Membrane-Derived Vesicles. The mesenchymal stem cell 3



Page 4 of 30

(MSC) membrane-derived vesicles were prepared according to the reported method with slight modifications.13 When MSCs almost covered the entire culture flasks, the cells were digested by trypsin, centrifuged, and lysed in a hypotonic buffer (1mM NaHCO3, 1mM PMSF, and 0.2 mM EDTA) at 4 ℃ overnight. Then, the stem cell membrane was collected by centrifuging at 3000 rpm for 20 min at 4 ℃ and washed by PBS. To prepare MSC membrane-derived vesicles, the obtained solution was sonicated by using a bath sonicator on ice for 5 min, which was then extruded using a mini extruder (Avanti Polar Lipids, USA) through 400 nm and 200 nm porous polycarbonate membranes for 20 times, respectively. The resultant MSC membrane-derived vesicles were stored in PBS at 4 ℃before use. Loading siRNA onto Fe3O4@PDA NPs. 50 nM FAM-siRNA was added to aqueous solution with varying Fe3O4@PDA concentrations (0, 0.01, 0.02, 0.03, and 0.04 mg mL-1). After stiring for 5 min, the prepared Fe3O4@PDA-siRNA nanocomplexes were centrifuged at 15,000 rpm for 10 min, and then the supernatant of all samples were measured the fluorescence spectra with a Hitachi F-4600 fluorescence

spectrophotometer

(Hitachi,

Japan).

Finally,

the

prepared

Fe3O4@PDA-siRNA nanocomplexes were stored at 4 ℃. Synthesis and Characterization of Fe3O4@PDA-siRNA@MSCs NPs. To synthesize Fe3O4@PDA-siRNA@MSCs NPs, an extrusion approach with slight modification was used.13 The prepared Fe3O4@PDA-siRNA NPs were co-extruded with MSC membrane-derived vesicles through a 200 nm polycarbonate porous membrane for 10 times. Transmission electron microscopy (TEM) images of prepared NPs were examined with a Hitachi H-800 microscope (Hitachi, Japan) at 80 kV. Zeta potential analysis and particle size of the resulting NPs were performed using dynamic light scattering (DLS) (Malvern Zetasizer Nano Instrument, UK). To evaluate the long-term stability of obtained Fe3O4@PDA-siRNA@MSCs NPs, Fe3O4@PDA-siRNA@MSCs NPs (Fe3O4@PDA, 1 mg mL-1) was added into PBS or FBS solution. The potential changes in particle size were monitored on a Nano ZS at different time points for two weeks. SDS-PAGE Protein Analysis. To analyze the protein components of the prepared MSC membrane-derived vesicles, all samples were prepared in SDS buffer as measured by BCA protein assay. The samples were analyzed using 10% SDS-PAGE 4


Page 5 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


at 100 V for 3 h, and then the protein was stained with Commassie blue for 1 h, destained in water overnight, and then visualized with the Gel Doc XR+ System (Bio-Rad, USA). Photothermal and MR Imaging Properties of Fe3O4@PDA-siRNA@MSCs in Vitro. The photothermal capability of prepared Fe3O4@PDA-siRNA@MSCs NPs was monitored by recording the temperature variation of Fe3O4@PDA-siRNA@MSCs aqueous solution (1 mL) in a 12-well plate which was exposed for 6 min with a NIR laser (LE-LS-808-10000TFCA, Shenzhen LEO Photoelectric, China) (808 nm, 0.6 W cm-2 ). The temperature was measured every 1 min using a digital thermometer with a temperature probe. The MR imaging capability of Fe3O4@PDA-siRNA@MSCs or Fe3O4@PDA NPs at a series of Fe concentrations was determined using a 3.0 T MR imaging system (General Electric, WI). T2-weighted images of Fe3O4@PDA-siRNA@MSCs or Fe3O4@PDA NPs were acquired for T2 relaxation rate (r2) assessment. Cell Viability Assay. The in vitro cytotoxicity and photothermal effect of Fe3O4@PDA-siRNA@MSCs NPs were evaluated by Cell Counting Kit-8 (CCK-8) assays. 2×104 293t cells were first seeded in 96-well plate and incubated overnight. Then, the media were replaced by fresh media containing different concentrations of Fe3O4@PDA, or Fe3O4@PDA-siRNA@MSCs (0, 25, 50, 100, 200, 300 and 400 µg mL-1) and were then incubated for 24 h. Finally, CCK-8 (10 µL ) was added to each well for another 3 h, the absorbance value at 450 nm was read by using a Microplate Reader (ELx-800, BioTek Instruments, USA). The cell viability (%) was calculated by the formula: Cell viability (%) = ODTest sample/ODControl×100%. The photothermal effect of Fe3O4@PDA or Fe3O4@PDA-siRNA@MSCs NPs on DU145 cells was evaluated by the same method as described above. Briefly, 2×104 DU145 cells were seeded in 96-well plates and cultured overnight. Then, the medium was removed, and 100 µg mL-1 Fe3O4@PDA or Fe3O4@PDA-siRNA@MSCs (containing the same concentration of Fe3O4@PDA) in fresh DMEM was added into each well. The cells were further incubated for 3 h and washed with PBS. Subsequently, the cells incubated with Fe3O4@PDA or Fe3O4@PDA-siRNA@MSCs were irradiated by a NIR laser (808 nm, 0.6 W cm-2) for 5 min. After laser irradiation, the cells were incubated for another 12 h and the cell viabilities were measured. To visualize Fe3O4@PDA-siRNA@MSCs ability of killing cancer cells through

5



Page 6 of 30

photothermal effect, DU145 cells was irradiated by a NIR laser (808 nm, 0.6 W cm-2) for 5 min, and then were co-stained with 1 µg mL-1 Propidium iodide (PI) and Calcein-AM. Photos of cells were observed by using a fluorescence microscope (IX5-RFACA, Olympus, Japan). Colocalization Study of Fe3O4@PDA-siRNA@MSCs NPs. To verify the integrity of the core-shell particle structure, FAM-labeled siRNA and DiD were loaded onto the Fe3O4@PDA core and the MSCs-membrane-derived vesicles, respectively, before fusing the vesicle-particle. The prepared dual-labeled Fe3O4@PDA-siRNA@MSCs NPs were incubated with DU145 cells for 4 h. The cells were then washed with PBS, fixed with paraformaldehyde (PFA), followed by stained with DAPI. Finally, the cells were imaged by using a confocal laser scanning microscope (FluoView 500, Olympus, Japan). Digital images of green, blue and red fluorescence were acquired under FAM, DAPI and DiD channel, respectively. Cellular Uptake and Internalization of Fe3O4@PDA-siRNA@MSCs NPs. The cellular uptake of Fe3O4@PDA-siRNA@MSCs NPs was investigated using both fluorescence microscopy and flow cytometry. For fluorescence microscopy, the DU145 cells achieving about 50% confluency in 12-well plates were incubated with Fe3O4@PDA-siRNA or Fe3O4@PDA-siRNA@MSCs NPs in complete DMEM medium for 6 h, respectively. Thereafter, the cells were washed with PBS, fixed with paraformaldehyde and imaged under a fluorescence microscope (IX5-RFACA, Olympus, Japan). For flow cytometry, DU145 cells were seeded in 6-well plates and incubated with free-siRNA, Fe3O4@PDA-siRNA, or Fe3O4@PDA-siRNA@MSCs NPs as described above. After 6 h incubation, cells were harvested, resuspended in PBS and analyzed on the FACS Calibur flow cytometer (BD Biosciences, USA). For each group, the fluorescence (Ex/Em: 480/520 nm) of FAM-siRNA per 1×105 cells was analyzed. The untreated cells were used as the control. Gene Silencing Efficiency of Plk1 siRNA via Fe3O4@PDA-siRNA@MSCs NPs. Quantitative real-time PCR (qRT-PCR) and western blot analysis were used to assess the silencing efficiency of Fe3O4@PDA-siPlk1@MSCs NPs in vitro. For qRT-PCR analysis, DU145 cells were seeded in 6-well plates (2×105 cells/well) and then incubated

with

naked

siPlk1,

Fe3O4@PDA-siRNA@MSCs

NPs,

or

Fe3O4@PDA-siPlk1@MSCs NPs (siPlk1 concentration of 10 nM) for 24 h.

6


Page 7 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Lipofectamine 2000 (Lipo2K) carrying 10 nM of siPlk1 was used as the positive control. Total RNA was collected from the transfected cells and extracted using RNeasy mini kit (Qiagen, CA) according to the manufacturer’ protocol. 2 µg RNA were transcribed into cDNA using the PrimeScript First Strand cDNA Synthesis Kit (Takara, Japan). Thereafter, qRT-PCR was conducted using SYBR Green PCR master mix on an ABI 9700 PCR System (Applied Biosystems, USA). The PCR parameters were: 95 ℃, 10 min; 94 ℃, 30 sec; 60 ℃, 30 sec; 72 ℃, 45 sec; 40 cycles. The primer sequences for Plk1 and β-actin mRNA were as follows: Plk1 forward, AGCCTGAGGCCCGATACTACCTAC, Plk1 reverse, ATTAGGAGTCCCACACA GGGTCTTC; and β-actin forward, GAAATCGTGCGTGACATCAAAG, β-actin reverse, TGTAGTTTCATGGATGCCACAG. All of the gene expressions were normalized to the levels of β-actin and calculated by the ∆∆Ct method. DU145 cells were treated as described above for qRT-PCR analysis and were harvested at 72 h after incubation with various formulations. For western blot analysis, proteins were extracted using the lysis buffer (pH 7.4, containing 50 mM Tris-HCl, 1% SDS, 1 mM PMSF,1 mM EDTA, 1% Triton X-100), and protein concentrations were determined by using the BCA protein kit (Beyotime, China). Subsequently, 100 µg proteins were separated on 10% SDS-PAGE and transferred to nitrocellulose membranes (Millipore, MA, USA). After blocking with 5% dry milk for 1 h, the membranes were incubated overnight at 4 ℃ with the primary anti-Plk1, or anti-β-actin antibodies (1:1000). The immunoblots were further probed with IRDye®680 goat anti-mouse secondary antibody (1:10,000) for 2 h at room temperature and visualized using an Odyssey infrared imaging system (LI-COR Biosciences, NE, USA). Cell Apoptosis Analysis of Fe3O4@PDA-siPlk1@MSCs NPs in Vitro. DU145 cells were treated in the same manner as in the qRT-PCR analysis. After incubation with the above-mentioned formulations for 48 h, the cells were detected by using the Annexin V-FITC apoptosis detection kit (Proteintech, China) on a flow cytometer (BD Biosciences, NJ, USA). The results were finally analyzed using the Cell Quest software. In Vivo MR Imaging and Distribution Study. DU145 cells (100 µL, 1×107/mL) suspended in PBS were subcutaneously injected into the back of each mouse. Then, tumor-bearing nude mice received an intravenous (i.v.) injection of 100 µL PBS or 7



PBS containing Fe3O4@PDA or Fe3O4@PDA-siRNA@MSCs (100 µg Fe3O4@PDA). All mice were anesthetized and MR imaging were performed before and 24 h after the injection. T2-weighted images were obtained by a 3.0 T MR imaging system (General Electric, Milwaukee, WI) under the following parameters: TR = 3980.0 ms, TE = 99.0 ms, field of view (FOV) = 40.0 cm, and slice thickness = 6.0 mm. To determine the biodistribution of as-prepared materials, all tumor-bearing mice were euthanized at 48 h post intravenous injection. Then, major tissues (heart, liver, spleen, kidney, lung, and tumor) from mice were gathered, weighted, and dissolved in chloroazotic acid. Fe content in each yielding sample was finally quantitatively analyzed with ICP-AES (Iris Intrepid II XSP, Thermo Elemental, USA). In Vivo PTT and Antitumor Studies. When DU145 xenograft tumor reached approximately 5-6 mm in diameter, mice were divided into 4 groups (n=5), and were intravenously injected with PBS, 100 µg Fe3O4@PDA, Fe3O4@PDA-siRNA@MSCs or Fe3O4@PDA-siPlk1@MSCs (containing 100 µg Fe3O4@PDA), respectively. Mice were anesthetized by intraperitoneal injection of 5% chloral hydrate and the tumor areas were irradiated using a NIR laser (808 nm, 0.6 W cm-2) for 6 min after 24 h injection. After the PTT treatment, tumor volumes were monitored every other day and were calculated by the formula: Tumor volume (V)=(tumor length)×(tumor width)2/2. The relative tumor growth ratio was calculated as V/V0 (V and V0 were the tumor volume on day 14 and on day 0, respectively). After 15 days, all mice were euthanized. Tumors and other organs were collected, weighed and fixed in 4% paraformaldehyde overnight. The frozen tissues were sliced into 4.0 um sections, further stained with H&E, and terminal deoxynucleotidyl TUNEL. Finally, the results were imaged by using an optical microscope (BX51, Olympus, Japan). Statistical Analysis. All the data were expressed as the means ± standard deviations (SD) from three independent experiments and analyzed by using Student’s t-test.

A value of p < 0.05 was considered to be statistically significant.

RESULTS AND DISCUSSION Preparation and Characterization of Fe3O4@PDA-siRNA@MSCs NPs. The fabrication strategy for Fe3O4@PDA-siRNA@MSCs was schematically demonstrated in Figure 1, which was mainly divided into the following four steps: synthesizing Fe3O4@PDA NPs, loading siRNA into Fe3O4@PDA NPs, preparing MSC membrane-derived vesicles, and then coating Fe3O4@PDA-siRNA NPs with 8


Page 8 of 30

Page 9 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


MSCs-vesicles. Fe3O4@PDA NPs were firstly synthesized through spontaneous in-situ polymerization of PDA onto the surface of the Fe3O4 NPs.24,25 As shown in TEM image (Figure 2A), the as-prepared Fe3O4@PDA NPs had an average diameter of approximately 60 nm and great dispersibility in water with no aggregation (Figure S1). Given that PDA contains numerous surface functional groups,26 the siRNA could bind onto the surface of Fe3O4@PDA NPs probably because of π-π stacking interactions between aromatic groups of the PDA and the nucleobases of siRNA. To evaluate the adsorption efficiency of prepared Fe3O4@PDA NPs, the fluorescence intensity of FAM-labeled siRNA were measured while mixing the FAM-siRNA with different concentration of the prepared Fe3O4@PDA NPs. The fluorescence of the FAM-siRNA was almost entirely quenched when the concentration of Fe3O4@PDA NPs was 0.04 mg mL-1 (Figure 2B), indicated that most of siRNA was combined onto the Fe3O4@PDA NPs at this concentration and PDA displayed the high fluorescence quenching efficiency. Stem cell membrane-derived vesicles were prepared following a previously described protocol with slight modifications.13 Briefly, stem cells were treated with a hypotonic buffer followed by disruption and centrifugation to yield the MSC ghosts (Figure S2). Subsequently, the MSC ghosts were sonicated and physically extruded through the 400 nm and 200 nm porous polycarbonate membranes to produce MSC membrane-derived vesicles. Finally, fresh membrane vesicles were mixed with the as-synthesized Fe3O4@PDA-siRNA NPs and co-extruded through the 200 nm porous membrane, repeatedly. The resulting Fe3O4@PDA-siRNA@MSCs NPs was obtained by centrifugation and further characterized. The TEM image clearly showed that Fe3O4@PDA-siRNA@MSCs NPs have a core-shell structure, with the Fe3O4@PDA core of approximately 60 nm in diameter and an outer membrane shell thickness of about 10 nm (Figure 2A). In consistency, the DLS data showed that the average hydrodynamic diameter of Fe3O4@PDA-siRNA@MSCs NPs increased from originally around 91 nm for Fe3O4@PDA to about 109 nm after coating the MSC membranes (Figure 2C). It should be pointed out that about 10 nm thickness of outer membrane shell detected by the TEM are consistent with the thickness of lipid bilayer, further indicating the successful MSC membrane coating.27 The surface zeta potential changed to -30.28±1.32 mV after coating the MSC membranes, which was close to

9



Page 10 of 30

that of natural stem cells vesicles (-33.64 mV; Figure 2D), also suggesting the successful MSC membrane coating. To verify the prepared Fe3O4@PDA-siRNA@MSCs NPs have the antigens of MSC membrane, SDS-PAGE was used to examine the protein contents of the NPs (Figure 2E). The natural stem cell membranes and Fe3O4@PDA NPs were used as controls. The results showed that the protein profiles of Fe3O4@PDA-siRNA@MSCs NPs were very close to the MSC-membrane vesicles, indicating that the membrane proteins was mostly retained during the preparation process and Fe3O4@PDA-siRNA NPs were successfully coated by the MSC-membrane vesicles. Furthermore, the resulting Fe3O4@PDA-siRNA@MSCs NPs were investigated the physiological stability

by

monitoring

the

potential

change

of

particle

size.

Firstly,

Fe3O4@PDA-siRNA@MSCs NPs were prepared with Fe3O4@PDA-siRNA (0.1 mg Fe3O4@PDA, 1 mL) and different amount of MSC-membrane vesicles. Samples were stored in 1×PBS for 7 d. The size of Fe3O4@PDA-siRNA@MSCs NPs was measured over time in PBS (Figure S3). As shown in Figure 2F, the results showed that the prepared Fe3O4@PDA-siRNA@MSCs NPs (Fe3O4@PDA, 1 mg mL-1) coming from 0.1 mg Fe3O4@PDA and 5×106 MSCs membrane-derived vesicles exhibited good physiological stability with minimal size changes for at least 2 weeks in both solutions. To verify the integrity of the core-shell structure of Fe3O4@PDA-siRNA@MSCs NPs, MSC-membrane vesicles were fluorescently labeled with DiD (red), and FAM labeled siRNA (green) was loaded onto Fe3O4@PDA NPs, respectively. The prepared dual-labeled Fe3O4@PDA-siRNA@MSCs NPs were incubated with DU145 cells, and visualized using CLSM. As shown in Figure 2G, the green fluorescence (FAM) and red

fluorescence

(DiD)

highly

overlapped

each

other,

suggesting

that

Fe3O4@PDA-siRNA@MSCs NPs retained their structure integrity well after internalization by cells. Photothermal and MR Imaging Properties of Fe3O4@PDA-siRNA@MSCs NPs in Vitro. After confirming the successful coating of MSC membranes onto Fe3O4@PDA-siRNA NPs, biomimetic Fe3O4@PDA-siRNA@MSCs NPs were used to investigate its photothermal and MR imaging capabilities in vitro. The photothermal

effect

was

performed

by

irradiating

Fe3O4@PDA

or

Fe3O4@PDA-siRNA@MSCs aqueous solution with a NIR laser (808 nm, 0.6 W cm-2)

10


Page 11 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


to test if Fe3O4@PDA-siRNA@MSCs NPs still retained the photothermal conversion ability. The data showed that both Fe3O4@PDA and Fe3O4@PDA-siRNA@MSCs could strikingly raise the temperature of aqueous solution under laser irradiation, which followed a time-and concentration-dependent manner (Figure 3A). The photothermal transduction efficiency (η) of Fe3O4@PDA NPs was calculated according to the previous method.25 The η of Fe3O4@PDA NPs was about 56.7% (Figure S4 and Calculation S1). Meanwhile, the slight difference in temperature rise between Fe3O4@PDA-siRNA@MSCs and Fe3O4@PDA was probably due to MSC membrane coating when the Fe3O4@PDA-siRNA@MSCs contained the same concentration of Fe3O4@PDA. After coated by MSC membrane, lipid bilayers on Fe3O4@PDA surface could absorb a small amount of heat and prevent the heat diffusion from the core to the surrounding medium. The photothermal stability of Fe3O4@PDA-siRNA@MSCs NPs was evaluated by a NIR laser irradiation (808 nm, 0.6 W cm-2) for 6 min and naturally cool at room temperature. After four cycles, for Fe3O4@PDA-siRNA@MSCs NPs, there was not obvious temperature attenuation (Figure

S5).

Taken

together,

the

results

indicated

that

the

synthesized

Fe3O4@PDA-siRNA@MSCs NPs had the similar photothermal effect as the Fe3O4@PDA and could be used as an excellent candidate for photothermal ablation. The Fe3O4@PDA-siRNA@MSCs NPs should have the capability as MR imaging contrast

agents

because

of

its

magnetic Fe3O4.

Fe3O4@PDA

or

Fe3O4@PDA-siRNA@MSCs with different concentrations of Fe were imaged by using a 3.0 T MR imaging system. As shown in Figure 3B, the T2-weighted MR contrast presented increasingly darkening effect with the increment of Fe concentrations.

Moreover,

the

T2-weighted

relaxation

rate

value

(r2)

of

-1 -1

Fe3O4@PDA-siRNA@MSCs NPs (209.3 mM s ) was close to that of Fe3O4@PDA (227.4 mM-1 s-1) and was about 2 times larger than the Fe3O4 NPs (90.2 mM-1 s-1), suggesting that Fe3O4@PDA-siRNA@MSCs NPs still have the MR imaging functionality after coating the MSC membranes. And the T2-weighted relaxation rate value (r2) of Fe3O4@PDA was far larger than the Fe3O4 NPs due to the aggregation of magnetic

Fe3O4

particles.

The

results

suggested

that

the

prepared

Fe3O4@PDA-siRNA@MSCs NPs could be used as an effective probe for MR imaging applications. In Vitro Cytotoxicity and Photothermal Ablation Capability. To explore the applications of Fe3O4@PDA-siRNA@MSCs NPs in biomedicine, the cytotoxicity to 11



normal 293t cells in vitro was investigated. The results showed that both Fe3O4@PDA and Fe3O4@PDA-siRNA@MSCs had no detectable cytotoxicity towards 293t cells at the concentrations from 25 to 200 µg mL-1. However, compared with Fe3O4@PDA, MSC-derived membrane coating rendered Fe3O4@PDA-siRNA@MSCs with higher biocompatibility and less cytotoxicity even though the concentration of Fe3O4@PDA was beyond 200 µg mL-1 (Figure S6). Following cytotoxicity studies, we further examined the NIR laser-induced photothermal ablation capability on human prostate cancer cells in vitro. DU145 cells were incubated with 100 µg mL-1 Fe3O4@PDA or Fe3O4@PDA-siRNA@MSCs (containing the same concentration of Fe3O4@PDA) for 3 h and then irradiated by the NIR laser (808 nm, 0.6 W cm-2) for 5 min. After 12 h, the cell viability was measured by CCK-8 assay. As shown in Figure 4A, NIR laser alone without nanoparticles induced very few cells death after 5 minutes. As a contrast, the cell viability was dramatically decreased when DU145 cells were incubated with Fe3O4@PDA or Fe3O4@PDA-siRNA@MSCs NPs under laser irradiation for 5 min (with cell viability only 10%). The results suggested that Fe3O4@PDA-siRNA@MSCs NPs could effectively cause cytotoxicity under laser irradiation. We then evaluated the blood biocompatibility of Fe3O4@PDA-siRNA@MSCs using the hemolysis test. The nanoparticles with poor hemocompatibility were able to lyse red blood cells which would release hemoglobin and then cause the red supernatant. The amount of hemoglobin in the supernatant was measured at 570 nm after incubation for 3 h. No visible hemolysis was observed at the concentrations from 10 to 400 µg mL-1, indicating that Fe3O4@PDA-siRNA@MSCs had good hemocompatibility (Figure S7). The photothermal ablation capability of Fe3O4@PDA-siRNA@MSCs NPs in vitro was further confirmed by fluorescent cell staining. DU145 cells were treated as described above. Subsequently, Calcein-AM and PI were used to stain live and apoptotic cells, respectively. As shown in Figure 4B, after laser treatment, cells incubated with Fe3O4@PDA-siRNA@MSCs NPs and Fe3O4@PDA NPs inside the irradiation zone showed significantly high amount of red fluorescence, suggesting that photothermal treatment could induce severe cell apoptosis. In contrast, cells incubated with Fe3O4@PDA-siRNA@MSCs NPs without laser irradiation and cells incubated without any nanoparticles with laser irradiation only emitted green fluorescence implying that most cells survived under these conditions (Figure 4B). Taken together, 12


Page 12 of 30

Page 13 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


these results indicated that MSC-derived membrane coating rendered the Fe3O4@PDA-siRNA@MSCs NPs with better cell compatibility and retained the photothermal ablation capability coming from the Fe3O4@PDA cores. Cellular Uptake

of Fe3O4@PDA-siRNA@MSCs NPs. Due to having

tumor-specific targeting components on the cell surface, MSCs could actively target susceptible tumors and were then chosen to coat the NPs.28,29 To assess the targeting capability of prepared Fe3O4@PDA-siRNA@MSCs NPs, equivalent amounts of Fe3O4@PDA-siRNA NPs and Fe3O4@PDA-siRNA@MSCs NPs were incubated with DU145 cells, respectively, for 6 h. As shown in Figure 5A, compared to Fe3O4@PDA-siRNA NPs, a higher number of Fe3O4@PDA-siRNA@MSCs NPs were uptaked by DU145 cells due to MSC membrane-derived vesicles and the fluorescent intensity enhanced obviously. Meanwhile, flow cytometry analysis was employed to quantitatively investigate the cellular uptake of two NPs. For Fe3O4@PDA-siRNA@MSCs NPs, the cellular uptake efficiency was up to 84.2% which was higher than Fe3O4@PDA-siRNA NPs (69.2%) (Figure 5B). Upon flow cytometry analysis, MSC-derived membrane coating could enhance the cancer-cell targeting capability and cellular uptake efficiency of Fe3O4@PDA-siRNA@MSCs FNPs. Gene Silencing and Induction of Cell Apoptosis. According to reports, as a proto-oncogene, the expression of Plk1 was elevated in tumor cells, whose low-expression could induce apoptotic pathways and inhibit tumor cells growth.30,31 So we examined the expression of the Plk1 gene in DU145 cells following the delivery of siPlk1 through Fe3O4@PDA-siPlk1@MSCs NPs. The expression level of Plk1 mRNA in DU145 cells treated with Fe3O4@PDA-siPlk1@MSCs NPs was analyzed by qRT-PCR 24 h after transfection. As shown in Figure 6A, significantly decreased expression of Plk1 mRNA was observed in cells treated with Fe3O4@PDA-siPlk1@MSCs NPs or Lipo2K/siPlk1 compared with naked siPlk1 or control Fe3O4@PDA-siRNA@MSCs NPs. Notably, Fe3O4@PDA-siPlk1@MSCs NPs lowered the Plk1 mRNA expression approximately up to 50% from its control group. Meanwhile,

western

blot

analysis

showed

that

treatment

with

Fe3O4@PDA-siPlk1@MSCs but not with Fe3O4@PDA-siRNA@MSCs, led to markedly decreased Plk1 protein expression in DU145 cells, the knockdown efficiency was very close to the mRNA expression data (Figure 6B). The loss of Plk1 expression has been thought to cause apoptosis in cancer cells.32 13



Page 14 of 30

After transfection with different formulations, DU145 cells were stained with Annexin V-FITC and PI, and then were investigated using flow cytometry. As shown in Figure 6C, Fe3O4@PDA-siPlk1@MSCs NPs led to 22.9% cell apoptosis (including early

and

late

apoptotic

cells),

which

was

higher

than

that

of

the

Fe3O4@PDA-siRNA@MSCs NPs (1.1%) after a 72 h treatment. The results showed that Fe3O4@PDA-siPlk1@MSCs NPs could induce apoptosis of DU145 cells by Plk1 gene silencing. In Vivo Tumors Diagnosis. BALB/c nude mice bearing DU145 xenograft tumors were intravenously injected equal amounts of various nanoparticles. As shown in Figure 7A, obvious tumor darkening effects in T2-weighted MR images were observed in the mice treated with Fe3O4@PDA-siRNA@MSCs NPs at 24 h after the injection. However, for other control groups, the tumor areas were no obvious change after the treatment. These experiments suggested that Fe3O4@PDA-siRNA@MSCs NPs could be used as an MR imaging probe and had the tumor-targeting activity in vivo due to the MSC membrane-derived vesicles. At 48 h after the injection, all mice major organs and tumors were harvested and quantitatively analyzed with ICP-AES. Fe3O4@PDA-siRNA@MSCs showed much higher accumulation in the tumor sites than Fe3O4@PDA (Figure 7B), further indicating higher tumor-targeting capability of Fe3O4@PDA-siRNA@MSCs. In Vivo Antitumor Effect of Fe3O4@PDA-siPlk1@MSCs NPs. Furthermore, we evaluated the antitumor effect of Fe3O4@PDA-siPlk1@MSCs NPs plus laser irradiation in the tumor-bearing mice. Firstly, no obvious weight loss was occurred in nanocomplexes treated groups and PBS groups after treatment, indicating that MSC membrane-derived vesicles and Fe3O4@PDA-siRNA@MSCs NPs had no overall side effects in vivo (Figure S8). Meanwhile, compared to mice treated with PBS plus laser irradiation, mice treated with Fe3O4@PDA-siRNA plus laser irradiation could suppress

tumor

growth

to

some

extent.

However,

mice

treated

with

Fe3O4@PDA-siRNA@MSCs NPs plus laser irradiation could reduce tumor volume by 40%. In glaring contrast, after the 15 d therapy, the combination of Fe3O4@PDA-siPlk1@MSCs NPs and laser irradiation exhibited dramatic tumor regression in vivo, the tumor growth inhibition efficacy could achieve about 60% (Figure 8A). After the 15 d therapy, all tumors were harvested and weighed. As expected, the average tumor weight in the Fe3O4@PDA-siPlk1@MSCs and laser irradiation groups was significantly lower than that in the other control groups, 14


Page 15 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


indicating the best inhibitive effect (Figure 8B). We then performed histological analysis to further investigate the toxicity of Fe3O4@PDA-siRNA@MSCs NPs in vivo. Major organs were harvested for HE staining to observe histological changes 15 days after the injection of different nanoformulations. Compared to PBS treated mice, there was no obvious inflammation, apoptotic

or

necrotic

cells

in

the

tissues

of

mice

treated

with

Fe3O4@PDA-siPlk1@MSCs NPs, further implying that Fe3O4@PDA-siPlk1@MSCs NPs had no obvious side effects in vivo (Figure S9). The HE results revealed that the structure

of

tumor

tissue

was

destructed

after

treatments

with

Fe3O4@PDA-siPlk1@MSCs plus laser and the tumor cells were contracted which remained in intact in the control groups. Furthermore, TUNEL assay results indicated that

many

tumor

cells

have

undergo

apoptosis

in

mice

treated

with

Fe3O4@PDA-siPlk1@MSCs NPs (Figure 8C). These results indicated that Fe3O4@PDA-siPlk1@MSCs NPs effectively enhanced tumor targeting capability due to mesenchymal stem cell coating, had low toxicity and could be as a highly biocompatible nanocarrier for cancer therapy. CONCLUSIONS In summary, we developed a novel gene delivery platform by coating MSC membranes onto Fe3O4@PDA-siRNA NPs for MR imaging-guided photothermal therapy and gene therapy. The yielded Fe3O4@PDA-siRNA@MSCs NPs shared the biological functions of natural stem cell membrane, which not only showed good biocompatibility and stability but also displayed the tumor-targeting functionality. The results in vitro showed that Fe3O4@PDA-siRNA@MSCs NPs had excellent photothermal capability for tumor cell ablation, and MR imaging functionality. We further confirmed that the Fe3O4@PDA-siPlk1@MSCs NPs could significantly inhibit tumor growth due to tumor-targeting capability, gene transport capacity and good photothermal conversion capability in vivo. Moreover, we also demonstrated that Fe3O4@PDA-siRNA@MSCs NPs could be used as a MR imaging probe for tumor diagnosis. Thus, our work suggested that the MSC membrane functionalized Fe3O4@PDA-siRNA NPs could serve as alternatives to polymer-encapsulated siRNA and hold promises for imaging-guided photothermal therapy and gene therapy. ASSOCIATED CONTENT Supporting Information 15



Page 16 of 30

Phase contrast microscopy images of MSCs before and after hemolytic treatment, the particles sizes were recoded to optimize the formulation, 293t cell viabilities after incubation with Fe3O4@PDA-siRNA@MSCs, hemolysis study, the body weight of mice after various treatments, and HE staining assay of various treatment groups. AUTHOR INFORMATION *Corresponding Authors Prof.

Jinlan

Jiang

([email protected])

and

Dr.

Fuqiang

Zhang

([email protected]) Department of Central Laboratory, China-Japan Union Hospital, Jilin University, Changchun, 130033, China. Author Contributions §

These authors contributed equally to this work.

Notes There are no conflicts of interest to declare. ACKNOWLEDGMENTS This work was financially supported by the Science and Technology Planning Project of Jilin Province (20160520166JH, 20180520023JH, 18YJ011, and 20180520138JH), Health Technology Innovation Project of Jilin Province (2016J070), and National Natural Science Foundation of China (51703077). REFERENCES (1) Reynolds, A.; Leake, D.; Boese, Q.; Scaringe, S.; Marshall, W.S.; Khvorova, A. Rational siRNA Design for RNA Interference. Nat. Biotechnol. 2004, 22, 326-330. DOI: 10.1038/nbt936. (2) Davis, M. E.; Zuckerman, J. E.; Choi, C. H.; Seligson, D.; Tolcher, A.; Alabi, C. A.; Yen, Y.; Heidel, J. D.; Ribas, A. Evidence of RNAi in Humans from Systemically Administered siRNA via Targeted Nanoparticles. Nature 2010,464, 1067-1070. DOI: 10.1038/nature08956. (3) Alvarez-Erviti, L.; Seow, Y.; Yin, H.; Betts, C.; Lakhal, S.; Wood, M. J. Delivery of siRNA to the Mouse Brain by Systemic Injection of Targeted Exosomes. Nat. Biotechnol. 2011, 29, 341-345. DOI:10.1038/nbt.1807. (4) Oh, Y. K.; Park, T. G. siRNA Delivery Systems for Cancer Treatment. Adv. Drug Deliv. Rev. 2009, 61, 850-862. DOI:10.1016/j.addr.2009.04.018.

16


Page 17 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(5) Hu, S.; Heidel, J. D.; Bartlett, D. W.; Davis, M. E.; Triche, T. J. Sequence-Specific Knockdown of EWS-FLI1 by Targeted, Nonviral Delivery of Small Interfering RNA Inhibits Tumor Growth in a Murine Model of Metastatic Ewing's Sarcoma. Cancer Res. 2005, 65, 8984-8992. DOI:10.1158/0008-5472.CAN-05-0565. (6) Song, E. W.; Zhu, P. C.; Lee, S. K.; Chowdhury, D.; Kussman, S.; Dykxhoorn, D.M.; Feng, Y.; Palliser, D.; Weiner, D. B.; Shankar, P.; Marasco, W. A.; Lieberman, J. Antibody Mediated in Vivo Delivery of Small Interfering RNAs via Cell-Surface Receptors. Nat. Biotechnol. 2005, 23, 709-717. DOI:10.1038/nbt1101. (7) Yano, J.; Hirabayashi, K.; Nakagawa, S.; Yamaguchi, T.; Nogawa, M.; Kashimori, I.; Naito, H.; Kitagawa, H.; Ishiyama, K.; Ohgi, T.; Irimuar, I. Antitumor Activity of Small Interfering RNA/Cationic Liposome Complex in Mouse Models of Cancer. Clin. Cancer Res. 2004, 10, 7721-7726. DOI:10.1158/1078-0432. CCR-04-1049. (8) Muratovska, A.; Eccles, M. R. Conjugate for Efficient Delivery of Short Interfering RNA (siRNA) into Mammalian Cells. FEBS Lett. 2004, 558, 63-68. DOI:10.1016/S0014-5793(03)01505-9. (9) McNamara, J. O.; Andrechek, E. R.; Wang, Y.;

Viles, K. D.; Rempel, R. E.;

Gilboa, E.; Sullenger, B. A.; Giangrade, P. H. Cell Type-Specific Delivery of siRNAs with Aptamer-siRNA Chimeras. Nat. Biotechnol. 2006, 24, 1005-1015. DOI: 10.1038/nbt1223. (10) Lu, J.J.; Langer, R.; Chen, J. A Novel Mechanism is Involved in Cationic Lipid-mediated Functional siRNA Delivery. Mol Pharm. 2009, 6, 763-771. DOI: 10.1021/mp900023v. (11) Knudsen, K. B.; Northeved, H.; Kumar, P. E.; Permin, A.; Gjetting, T.; Andresen, T. L.; Larsen, S.; Wegener, K. M.; Lykkesfeldt, J.; Jantzen, K.; Loft, S.; Moller, P.; Roursgaard, M. In Vivo Toxicity of Cationic Micelles and Liposomes. Nanomedicine 2015, 11,467-477. DOI:10.1016/j.nano.2014.08.004. (12) Wahlgren, J.; De, T.; Karlson, L.; Brisslert, M.; Vaziri Sani, F.; Telemo, E.; Sunnerhagen, P.; Valadi, H. Plasma Exosomes can Deliver Exogenous Short Interfering RNA to Monocytes and Lymphocytes. Nucleic Acids Res. 2012, 40, e130. DOI:10.1093/nar/gks463. (13) Hu, C.M.; Zhang, L.; Aryal, S.; Cheung, C.; Fang, R.H.; Zhang, L. Erythrocyte Membrane-Camouflaged Polymeric Nanoparticles as a Biomimetic Delivery Platform. Proc. Natl. Acad. Sci. 2011, 108, 10980-10985. DOI:10.1073/pnas.1106634108.

17



Page 18 of 30

(14) Rao, L.; Bu, L. L.; Xu, J. H.; Cai, B.; Yu, G. T.; Yu, X.; He, Z.; Huang, Q.; Li, A.; Guo, S. S.; Zhang, W. F.; Liu, W.; Sun, Z. J.; Wang, H.; Wang, T. H.; Zhao, X. Z. Red Blood Cell Membrane as a Biomimetic Nanocoating for Prolonged Circulation Time and Reduced Accelerated Blood Clearance. Small 2015, 11, 6225-6236. DOI:10.1002/smll.201502388. (15) Piao, J.G.; Wang, L.; Gao, F.; You, Y.Z.; Xiong, Y.; Yang, L. Erythrocyte Membrane is an Alternative Coating to Polyethylene Glycol for Prolonging the Circulation Lifetime of Gold Nanocages for Photothermal Therapy. ACS Nano 2014, 8, 10414-10425. DOI: 10.1021/nn503779d. (16) Xuan, M.; Shao, J.; Dai, L.; He, Q.; Li, J. Macrophage Cell Membrane Camouflaged Mesoporous Silica Nanocapsules for in Vivo Cancer Therapy. Adv. Healthcare Mater. 2015, 4, 1645-1652. DOI:10.1002/adhm.201500129. (17) Gao, C.; Wu, Z.; Lin, Z.; Lin, X.; He, Q. Polymeric Capsule-Cushioned Leukocyte Cell Membrane Vesicles as a Biomimetic Delivery Platform. Nanoscale 2016, 8, 3548-3554. DOI:10.1039/c5nr08407e. (18) Toledano Furman, N. E.; Lupu-Haber, Y.; Bronshtein, T.; Kaneti, L.; Letko, N.; Weinstein, E.; Baruch, L.; Machluf, M. Reconstructed Stem Cell Nanoghosts: a Natural Tumor Targeting Platform. Nano Lett. 2013, 13, 3248-3255. DOI: 10.1021/nl401376w. (19) Idris, N. M.; Jayakumar, M. K.; Bansal, A.; Zhang, Y. Upconversion Nanoparticles as Versatile Light Nanotransducers for Photoactivation Applications. Chem. Soc. Rev. 2015, 44, 1449-1478. DOI:10.1039/c4cs00158c. (20) Dong, H.; Du, S.; Zheng, X. Y.; Lyu, G. M.; Sun, L. D.; Li, L. D.; Zhang, P. Z.; Zhang, C.; Yan, C. H. Lanthanide Nanoparticles: From Design toward Bioimaging and Therapy. Chem. Rev. 2015, 115, 10725-10815. DOI:10.1021/acs.chemrev. 5b00091. (21) Gao, C.; Lin, Z.; Jurado-Sanchez, B.; Lin, X.; Wu, Z.; He, Q. Stem Cell Membrane-Coated Nanogels for Highly Efficient in Vivo Tumor Targeted Drug Delivery. Small 2016, 12, 4056-4062. DOI:10.1002/smll.201600624. (22) Colombo, M.; Carregal-Romero, S.; Casula, M. F.; Gutierrez, L.; Morales, M. P.; Bohm, I. B.; Heverhagen, J. T.; Prosperi, D.; Parak, W. J. Biological Applications of Magnetic

Nanoparticles.

Chem.

Soc.

Rev.

2012,

10.1039/c2cs15337h.

18


41,

4306-4334.

DOI:

Page 19 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(23) Sharifi, S.; Seyednejad, H.; Laurent, S.; Atyabi, F.; Saei, A. A.; Mahmoudi, M. Superparamagnetic Iron Oxide Nanoparticles for in Vivo Molecular and Cellular Imaging. Contrast Media Mol. Imaging 2015,10, 329-355. DOI:10.1002/cmmi.1638. (24) Mu, X.; Zhang, F.; Kong, C.; Zhang, H.; Zhang, W.; Ge, R.; Liu, Y.; Jiang, J. EGFR-Targeted Delivery of DOX-Loaded Fe3O4@Polydopamine Multifunctional Nanocomposites for MRI and Antitumor Chemo-Photothermal Therapy. Int J Nanomedicine 2017,10,2899-2911. DOI:10.2147/IJN.S131418. (25) Ge, R.; Li, X.; Lin, M.; Wang, D.; Li, S.; Liu, S.; Tang, Q.; Liu, Y.; Sun, H.; Zhang, H.; Yang, B. Fe3O4@Polydopamine Composite Theranostic Superparticles Employing Preassembled Fe3O4 Nanoparticles as the Core. ACS Appl Mater Interfaces 2016, 8, 22942-22952. DOI:10.1021/acsami.6b07997. (26) Lin, L. S.; Cong, Z. X.; Cao, J. B.; Ke, K. M.; Peng, Q. L.; Gao, J.; Yang, H. H.; Liu, G.; Chen. X. Multifunctional Fe3O4@Polydopamine Core-Shell Nanocomposites for Intracellular mRNA Detection and Imaging-Guided Photothermal Therapy. ACS Nano 2014, 8, 3876-3883. DOI:10.1021/nn500722y. (27) Gao, C.; Lin, Z.; Wu, Z.; Lin, X.; He, Q. Stem-Cell-Membrane Camouflaging on Near-Infrared Photoactivated Upconversion Nanoarchitectures for in Vivo Remote Controlled Photodynamic Therapy. ACS Appl. Mater. Interfaces 2016, 8, 34252-34260. DOI:10.1021/acsami.6b12865. (28) Toledano Furman, N. E.; Lupu-Haber, Y.; Bronshtein, T.; Kaneti, L.; Letko, N.; Weinstein, E.; Baruch, L.; Machluf, M. Reconstructed Stem Cell Nanoghosts: a Natural Tumor Targeting Platform. Nano Lett. 2013, 13, 3248-3255. DOI: 10.1021/nl401376w. (29) Kidd, S.; Spaeth, E.; Dembinski, J. L.; Dietrich, M.; Watson, K.; Klopp, A.; Battlla, V. L.; Weil, M.; Andreeff, M.; Marini, F. C. Direct Evidence of Mesenchymal Stem Cell Tropism for Tumor and Wounding Microenvironments Using in Vivo Bioluminescent Imaging. Stem Cells 2009, 27, 2614-2623. DOI:10.1002/stem.187. (30) Liu, X. Q.; Erikson, R. L. Polo-Like Kinase (Plk) 1 Depletion Induces Apoptosis in

Cancer

Cells.

Proc.

Natl.

Acad.

Sci.

2003,

100,

5789-5794.DOI:

10.1073/pnas.1031523100. (31) Strebhardt, K.; Ullrich, A. Targeting Polo-Like Kinase 1 for Cancer Therapy. Nat. Rev. Cancer 2006, 6, 321-330. DOI:10.1038/nrc1841. (32) Judge, A. D.; Robbins, M.; Tavakoli, I.; Levi, J.; Hu, L.; Fronda, A.; Ambegia, E.; McClintock, K.; MacLachlan, I. Confirming the RNAi-Mediated Mechanism of 19



Action of siRNA-Based Cancer Therapeutics in Mice. J. Clin. Invest. 2009,119, 661-673. DOI:10.1172/JCI37515.

20


Page 20 of 30

Page 21 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure

1.

Schematic

of

the

preparation

of

MSC

membrane-coated

Fe3O4@PDA-siRNA NPs (Fe3O4@PDA-siRNA@MSCs) and the tumor-target siRNA delivery in vivo.

21



22


Page 22 of 30

Page 23 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. Characterization of Fe3O4@PDA-siRNA@MSCs. (A) TEM images of synthesized Fe3O4@PDA (left) and Fe3O4@PDA-siRNA@MSCs (right). Scale bar = 100 nm. The insets showed TEM images of single Fe3O4@PDA (left) and Fe3O4@PDA-siRNA@MSCs (right). Scale bar = 50 nm. (B) Fluorescence quenching of 50 nM FAM-siRNA in the presence of Fe3O4@PDA NPs with a series of concentrations (0, 0.01, 0.02, 0.03, 0.04 mg mL-1). (C) Size and (D) surface zeta potential of Fe3O4@PDA, MSC-membrane vesicles, and Fe3O4@PDA-siRNA@MSCs. (E) SDS-PAGE protein analysis of MSC-membrane vesicles,

Fe3O4@PDA,

and

Fe3O4@PDA-siRNA@MSCs.

(F)

Stability

of

Fe3O4@PDA-siRNA@MSCs in PBS and FBS by measuring the particle size. (G) CLSM images of Fe3O4@PDA-siRNA@MSCs illustrating colocalization of Fe3O4@PDA-siRNA (FITC channel) and MSC membranes (DiD channel) after being internalized by DU145 cells. Scale bar = 20 µm.

23



Figure

3.

(A)

Photothermal

heating

curves

of

Page 24 of 30

Fe3O4@PDA

and

Fe3O4@PDA-siRNA@MSCs in aqueous medium at different concentrations irradiated with an 808 nm laser (0.6 W cm-2, 5 min). (B) T2 relaxation rates (r2) of Fe3O4@PDA and Fe3O4@PDA-siRNA@MSCs solutions at different concentrations. The inset showed T2-weighted MR images at different Fe concentrations.

24


Page 25 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. (A) Cell viabilities of DU145 cells treated with Fe3O4@PDA, Fe3O4@PDA-siRNA@MSCs, or Fe3O4@PDA-siPlk1@MSCs after an 808 nm laser irradiation (0.6 W cm-2, 5 min). (B) CLSM images of Calcein-AM (green, live cells) and propidium iodide (PI) (red, apoptotic cells) co-stained cells after an 808 nm laser irradiation (0.6 W cm-2, 5 min). Scale bar = 100 µm.

25



Figure 5. Enhanced in vitro cancer-cell accumulation of Fe3O4@PDA-siRNA@MSCs. (A) CLSM images demonstrating the tumor cell binding of Fe3O4@PDA-siRNA and Fe3O4@PDA-siRNA@MSCs. After incubation with DU145 cells, the excess particles were washed with PBS, and the cells were subsequently fixed for CLSM imaging. Scale bar = 100 µm. (B) The cell uptake efficiency of FAM-labeled Fe3O4@PDA-siRNA@MSCs in DU145 cells measured by flow cytometric analysis.

26


Page 26 of 30

Page 27 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6.

In vitro gene silencing efficiency on DU145 cells. Relative Plk1 mRNA

(A), Plk1 protein (B) expression of DU145 cells treated with PBS, naked siPlk1, Fe3O4@PDA-siRNA@MSCs, Lipo2K/siPlk1, or Fe3O4@PDA-siPlk1@MSCs, which were determined by qRT-PCR and western blot analysis. (C) The apoptosis of DU145 cells treated by Fe3O4@PDA-siRNA@MSCs or Fe3O4@PDA-siPlk1@MSCs was detected by using flow cytometry. 27



Figure 7.

(A) Representative in vivo T2-weighted MR images of DU145 xenograft

bearing mice before and after intravenously injection of PBS, Fe3O4@PDA, or Fe3O4@PDA-siRNA@MSCs. Red arrows indicated the sites of tumors. The same mouse was used for imaging through all the time points. (B) Biodistribution of various nanoparticles in mice at 48 h after the injection. *, and ** indicated no statistical difference, P < 0.05, and P < 0.01, respectively.

28


Page 28 of 30

Page 29 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 8.

In vivo tumor therapy with Fe3O4@PDA-siPlk1@MSCs. (A) Tumor

volumes of different treatment groups at different times. (B) Average tumor weight of each group after 15 days. (C) HE and TUNEL-stained tumor slice images of various treatment groups. Scale bar = 100 µm. 29



For Table of Contents Use Only

siRNA Delivery with Stem Cell Membrane-Coated Magnetic Nanoparticles for Imaging-Guided Photothermal Therapy and Gene Therapy Xupeng Mu,†,§ Jing Li,†,§ Shaohua Yan,‡ Hongmei Zhang,† Wenjing Zhang,† Fuqiang Zhang,*,† and Jinlan Jiang *,† †

Department of Central Laboratory, China-Japan Union Hospital, Jilin University,

126 Xiantai Street, Changchun, 130033, P. R. China. ‡

Department of Biological Engineering, College of Pharmacy, Jilin University, 1163

Xinmin Street, Changchun, 130021, P. R. China.

30


Page 30 of 30

siRNA Delivery with Stem Cell Membrane-Coated Magnetic

Recommend Documents