Site-Specific Covalent Conjugation of Modified mRNA by tRNA

Subscriber access provided by UNIV OF NEWCASTLE

Brief Article

Site-Specific Covalent Conjugation of Modified mRNA by tRNA Guanine Transglycosylase Fabian Ehret, Cun Yu Zhou, Seth C. Alexander, Dongyang Zhang, and Neal K Devaraj Mol. Pharmaceutics, Just Accepted Manuscript • DOI: 10.1021/acs.molpharmaceut.7b00356 • Publication Date (Web): 27 Jul 2017 Downloaded from http://pubs.acs.org on July 29, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Molecular Pharmaceutics is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 7

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Molecular Pharmaceutics

Site-Specific Covalent Conjugation of Modified mRNA by tRNA Guanine Transglycosylase Fabian Ehret‡, Cun Yu Zhou‡, Seth C. Alexander, Dongyang Zhang and Neal K. Devaraj* Department of Chemistry and Biochemistry, University of California, San Diego, 9500 Gilman Dr., La Jolla, USA, 92093. Email: [email protected]

Keywords: modified mRNA, RNA labeling, tetrazine ligation, tRNA guanine transglycosylase, RNA therapeutics

ABSTRACT: Modified messenger RNA (mod-mRNA) has recently been widely studied as the form of RNA useful for therapeutic applications due to its high stability and lowered immune response. Herein we extend the scope of the recently established RNATAG (transglycosylation at guanosine) methodology, a novel approach for genetically encoded site-specific labeling of large mRNA transcripts, by employing mod-mRNA as substrate. As a proof of concept, we covalently attached a fluorescent probe to mCherry encoding mod-mRNA transcripts bearing 5-methylcytidine and/or pseudouridine substitutions with high labeling efficiencies. To provide a versatile labeling methodology with a wide range of possible applications, we employed a two-step strategy for functionalization of the mod-mRNA to highlight the therapeutic potential of this new methodology. We envision that this novel and facile labeling methodology of mod-RNA will have great potential in decorating both coding and noncoding therapeutic RNAs with a variety of diagnostic and functional moieties.

as a genetic information carrier could effectively treat hereditary7,8 and regenerative diseases.9,10

INTRODUCTION Gene therapy has recently emerged as a revolutionary and highly promising strategy aiming to fight diseases directly at their genetic origin. In vivo expression of therapeutic proteins through mRNA provides several advantages compared to delivery or modification of DNA.1,2 For example, mRNA is easier to deliver because it need only enter the cytoplasm, rather than the nucleus, to be functional. It avoids complications from transcription regulation machinery, and it does not permanently alter the genome therefore avoiding permanent and potentially lethal changes.1 In order to overcome the intrinsically unstable and transient nature of natural RNA, the incorporation of modified nucleotides has been recently explored to harness RNA as a therapeutically relevant biological moiety by providing an increase in serum stability, a less active immune response, and an increase in translational capacity.3–5 Modified mRNA (mod-mRNA), as an alternative to natural mRNA gene therapy, was widely studied to treat many different diseases. Modified nucleobases pseudouracil (Ψ) and 5-methylcytosine (5mC), among many other artificial synthetic nucleobases, can be conveniently incorporated into mRNA transcripts by substituting natural bases with the chosen modified base(s) during the enzymatic synthesis of mRNA via RNA polymerase in vitro transcription (IVT).6 Typically, a partial or full replacement of one or multiple types of nucleobases can be utilized and the half-life of the corresponding therapeutic mRNA is greatly expanded, resulting a higher expression level of functional protein products both in vitro and in vivo.6,7 Numerous studies have shown that using mod-RNA

In order to fully exploit the therapeutic potential of mod-mRNAs, the development of novel strategies for the safe and effective decoration of in vitro transcribed RNA with targeting moieties (e.g. folic acid, antibody conjugates, and other desirable bio-conjugates) is highly desirable. Because cellular uptake of large RNAs is strongly impeded by their large size, along with a high anionic charge density, mRNA targeted delivery into the cytoplasm is regarded as the ratelimiting step in transfection-mediated protein expression.11 A variety of transfection vehicles have been investigated recently, ranging from simple mixtures of cationic lipids, such as Lipofectamine reagents, to more sophisticated lipid based nanoparticles of more complex formulations.12–15 A convenient bioconjugation method that is capable of appending targeting molecules to therapeutic RNAs would unlock new modalities of highly specific uptake of RNA through endocytic pathways. Such technology could greatly expand the utility of mod-RNA as a novel therapeutic to treat genetic disorders. For example, smaller siRNAs have taken advantage of receptor-mediated endocytosis in the absence of transfection agents via covalent linkage of an affinity agent.16 A similar delivery approach utilizing a covalently conjugated targeting probe to mod-mRNA would expand the transfection-mediated RNA delivery approach to much longer RNAs such as messenger and long non-coding RNAs In addition to utilizing covalent modifications to enhance RNA uptake, bioconjugation of short RNA aptamers with cytotoxic payloads provides a platform for the design of novel therapeutics for targeted cancer therapy. Engineered RNA aptamers selectively bind with a variety of cell surface

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

receptors,17 enabling the delivery of small molecule drugs to the target cells without adversely affecting the healthy cells.18 Chemically modified nucleotides are often employed as they

Page 2 of 7

tRNA guanine transglycosylases (TGTs) are a class of post-transcriptional tRNA modifying enzymes that exist in archaeal, prokaryotic and eukaryotic organisms. The structures and functions of the TGTs have been extensively stud-

Fig. 1. Schema tic representa tion of the two-step la beling a pproa ch of mod-mRNA with fluorescent pr obe sulfo-cy5 using RNA-TAG. The first step fea tures the enzyma tic la beling of the mRNA with bioor thogona l functiona l group tetra zine using RNA-TAG, a nd the second step fluorophore or ta rgeting a gent could be conjuga ted to the mRNA via tetra zine liga tion.

have demonstrated improved stability against nucleases.17,19 For example, aptamer-drug conjugates P19monomethyl auristatin E (MMAE) consisting of modified nucleotides has already shown early promising therapeutic potential in the treatment of pancreatic cancer.20 However, the aptamer-drug conjugate approach is currently limited to aptamers that are short enough in length to be made synthetically. By being able to post transcriptionally derivatize RNAs with payloads, aptamer-drug conjugates could be made more easily and eliminating the current length limit imposed by synthetic strategies. In order to achieve such a method capable of site-specific covalent modification of longer RNA transcripts, we envisioned decorating mod-RNA constructs utilizing an RNA modifying enzyme. A diverse class of nucleic acid modifying enzymes are responsible for a wide variety of important posttranscriptional modifications.21 More than one hundred RNA post-transcriptional modifications have been reported to date and a large majority of these modifications occur on tRNAs.22 Recently, harnessing of post-transcriptional RNA modification enzymes has emerged as a powerful technique to label functional RNA in vitro and in mammalian cells. Notably, Rentimeister and coworkers have reported the use of the mRNA 5’ cap modifying enzyme GlaTgs223,24 and Ecm123,25 to append a small bioorthogonal functional group such as an alkene or alkyne to the mRNA. Subsequently, affinity tags and fluorescent probes could be covalently attached to the mRNA using a secondary click reaction. Furthermore, a tRNA modifying enzyme, Tias, was also utilized to append a bioorthogonal azide functional group on its tRNA substrate. This modification could occur even when the tRNA motif was genetically engineered within an mRNA transcript of interest.26 In spite of these great approaches to label natural mRNA, none of the methods so far have demonstrated the capability of covalently labeling therapeutically practical mod-RNA.

ied, and the catalytic residues of all three kingdoms were found to be highly conserved.27 Bacterial TGTs recognize a minimal stem loop substructure on the tRNAs that encode for Tyr, His, Asp, and Asn.28 In bacteria, during the transglycosylation reaction, the N-C glycosidic linkage of a key guanine at the wobble position of the anticodon loop is cleaved, and a 7-deazaguanine derivative, preQ1, is substituted in via a ping-pong mechanism.27 The minimal TGT-recognition stem loop and its corresponding enzymatic kinetics have been previously elucidated by Garcia and coworkers.29 The RNA bound TGT crystal structure suggested that there might be enough room to chemically modify the natural preQ1 substrate30 and therefore harness the enzyme to covalently append a larger moiety such as a fluorophore or affinity tag. In our previous study, we genetically engineered a minimal 17nucleotide hairpin sequence into the 3’ UTR of a full mRNA transcript. When treated with bacterial TGT and a modified preQ1 probe, the mRNA transcript can be covalently conjugated with a small molecule of interest.31 In this study, we harness the reactivity of the E. coli TGT enzyme to recognize mod-RNA comprised of chemically modified nucleobases. Using the bacterial TGT enzyme, we report the first example of site-specifical covalent labeling of 5mC, Ψ, and doubly substituted 5mC+Ψ mod-RNA. We anticipate that this facile technology should greatly facilitate the site-specific derivatization of mod-RNA and the use of mod-RNA for a variety of therapeutically relevant applications.

EXPERIMENTAL SECTION General Methods All reagents used for the synthesis were purchased from Sigma-Aldrich (St. Louis, MO) and used without further purification unless otherwise stated. All restriction enzymes, bio-reagents, nucleotide stains, and competent bacterial strains were purchased from New England Biolabs (Ipswitch, MA), Promega (Madison, WI), or Life Technologies (Carls-


Page 3 of 7

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


bad,CA). 1H and 13C NMR spectra were recorded on a Varian VX 500 MHz NMR Spectrometer. High resolution mass spectroscopy was collected on an Agilent Infinity 1260 LC and tandem Agilent 6230 high resolution time of flight (TOF) mass spectrometer managed by the UCSD Department of Chemistry and Biochemistry Molecular Mass Spectroscopy Facility. Reverse-phase HPLC purification and analysis were performed using an Agilent 1260 Infinity HPLC with Agilent 6120 Quadrapole mass spectrometer (Santa Clara, CA). An Agilent Zorbax SB-C18 semi-prep column (ID 9.4 x 250 mm, 5 μm, 80 Å) and an Agilent Zorbax eclipse plus C8 column using a water/methanol gradient containing 0.1% TFA were used for HPLC preparation and analysis. Fluorescence microscopy images were acquired on an Axio Observer D1 inverted microscope (Carl Zeiss Microscopy GmbH, Germany) with a 20x objective and ORCA-ER camera (Hamamatsu, Japan) using the FLUOVIEW software package (Olympus, Japan). Fluorescent probes and proteins were excited with an argon laser at appropriate wavelengths. Images were subsequently analyzed and processed using ImageJ. Preparation of the mCherry plasmid A synthetic gene block containing the sequence for mCherry was designed and ordered from IDT (Coralville, IA). Specifically, the gene was designed with the ECY-A1 hairpin downstream of the mCherry coding region within the 3’ UTR. The geneblock was cloned into the mammalian expression vector pcDNA3 (Thermo Fisher, Waltham, MA) between cut sites BamHI and XhoI. DH5a competent cells (Life Technologies, Carlsbad, CA) were then transformed with the ligation product and screened against ampicillin on agar plates overnight. Colonies were selected and overgrown, and the overgrowth was subjected to DNA extraction with a QIAGEN Plasmid Maxi Kit (Qiagen, Venlo, Limburg Netherlands) and sequencing was performed to verify the inserted gene. Sequence for insert of mCherry construct: TTACTGGCTTATCGAAATTAATACGACTCACTATAGGGAGACC CAAGCTTGGTACCGAGCTCGGATCCACTAGTAACGGCCGCCA GTGTGCTGGAATTCTGCAGATATCGTTGACCTTGCAGAAGGAG ATATAATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCA TCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGT GAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCC GCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCA AGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCA GTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGAC ATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGT GGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACC GTGACCCAGGACTCCTCCCTGCAAGACGGCGAGTTCATCTACA AGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCG TAATGCAGAAGAAGACGATGGGCTGGGAGGCCTCCTCCGAGC GGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAG CAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGA GGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCC CGGCGCCTACAACGTGAACATCAAGTTGGACATCACCTCCCAC AACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAG GGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAA TATCTAACACAGACTCTCGGTACCATCATTTTCATATCCCCGCA GACTGTAAATCTGCACCACCATCATTTAATGAATTCCATCAGGA ATCCCTCACTTCTGCAGACTGGCCGTCGTTTTACACTCGAGCAT GCATCTAGAGGGCCCTATTCTATAGTGTCACCTAAATGCTAGA GCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCAT

CTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGT GCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATC GCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTG GGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAG GCATGCTGGGGATGCGGTGGGCTCTATGG General Procedure for the synthesis of in vitro transcribed mod-mRNA The plasmid DNA encoding for the mCherry RNATAG construct was digested by XhoI in 1x CutSmart buffer in 37 °C warm water bath for 1h. Linearized DNA was then extracted with molecular biology grade phenol / chloroform / isoamyl alcohol (25:24:1) (Sigma-Aldrich, St. Louis, MO), and purified by ethanol precipitation. The DNA pellet was dissolved in RNAase free water. Appropriate IVT reaction mixtures were assembled following a previously published protocol.32 For a representative 5mC substituted mod-mRNA IVT reaction, a mixture of 7.5 mM ATP, 1.875 mM GTP, 7.5 mM UTP and 7.5 mM 5mCTP (Trilink, San Diego, CA), anti-reverse cap analog (ARCA) (2.5 mM) (Trilink, San Diego, CA), 1 unit RNase inhibitor, DNA template (2 μg), 1x MegaScript T7 RNA polymerase master mix, 1x MegaScript T7 RNAP reaction buffer and H2O were assembled to give a total volume of 40 μL. The transcription reaction was run at 37 °C for 5 h. The reaction mixture was treated with 1 μL Turbo DNAse (20 Units) at 37 °C for 15 min. The mixture was then added with 20 μL of 8 M LiCl and cooled to -20 °C for 40 min. The mixture was centrifuged again at 4 °C at max speed for 16 min. The supernatant was discarded, the pellet was washed one time with 70% ethanol and allowed to dry at room temperature for 5 minutes by evaporation. The pellet was subsequently dissolved in 20 μL RNAse free water. Polyadenylation of IVT mod-mRNA In an Eppendorf tube, appropriate volume of RNAse free water, 1x poly(A) polymerase reaction buffer, 1 mM ATP, 1 U/μL RNAsin RNAse inhibitor, 0.25 U/μL E. coli Poly(A) polymerase were mixed and the mixture was incubated at 37 °C for 45 min. The mRNA was purified by LiCl precipitation. TGT labeling of mature mod-mRNA In an Eppendorf tube, appropriate volume of RNAse free water, a final concentration of 1x TGT buffer, 5 mM DTT, 1 μM appropriate mod-mRNA stock, 32 μM preQ1-tetrazine 3, 1 μM TGT and 1 U/μL RNAsin were mixed and the mixture was incubated at 37 °C for 4 h. The resulting mRNA was purified by LiCl precipitation three times and dissolved in appropriate volume of RNAse free water. Conjugation of mod-mRNA with Cy5 via tetrazine ligation In an Eppendorf tube protected from the light, appropriate volume of RNAse free water, 1x ligation reaction buffer, appropriate tetrazine labeled mod-mRNA and 78 uM Cy5-TCO (Broadpharm, San Diego, CA) were mixed and incubated at 37 °C for 4 h. The resulting mRNA was purified by LiCl precipitation three times and dissolved in a minimum amount of RNAse free water for absorbance measurements. Synthesis of preQ 1 -C6-NHBoc 2



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 7

Phase B in Phase A (Phase A: H2O with 0.1% formic acid, Phase B: MeOH with 0.1% formic acid). 1.1 mg of 3 was collected as a pink solid in a 53 % yield. 1H NMR (500 MHz, CD3OD) δ 8.49 (d, J = 8.1 Hz, 2H), 7.53 (d, J = 8.1 Hz, 2H), 6.81 (s, 1H), 4.49 (s, 2H), 4.23 (s, 2H), 3.17 (t, J = 6.8 Hz, 2H), 3.05 (t, J = 7.6 Hz, 2H), 3.03 (s, 3H), 2.33 (t, J = 7.4 Hz, 2H), 2.24 (t, J = 7.5 Hz, 2H), 1.95 (p, J = 7.5 Hz, 2H), 1.73 (p, J = 7.5 Hz, 2H), 1.52 (p, J = 7.2 Hz, 2H), 1.47 – 1.41 (m, 2H), 1.37 (q, J = 8.0 Hz,

Scheme 1. Synthesis of preQ 1 -C6-tetra zi ne 5. To a ccess the tetra zine modified preQ 1 deriva tive 5, preQ 1 wa s fi rst a ppended to a C6 a lkyl l inker 1 with a protected a mi ne to yield preQ 1 -C6-NHboc 2. Upon the deprotecti on of 2, preQ 1 -C6-NH 2 3 wa s obta ined a nd further coupled wi th a n in sit u a cti va ted ester of tetra zi ne 4 to a ccess preQ 1 -C6-tetra zi ne 5. 2H). 13C NMR (126 MHz, cd3od) δ 175.46, 175.32, 168.73, 165.17, 162.61, 154.50, 153.93, 145.07, 132.34, 129.24, 100 mg (0.40 mmol) of preQ1 dihydrochloride was 129.21, 128.98, 128.95, 119.10, 109.84, 99.67, 47.57, 44.80, suspended in DMF. 182 mg (1.2 mmol) of DBU was added to 43.79, 40.03, 36.31, the solution and the solid became fully dissolved. 78 mg (0.40 mmol) of 6-bromohexanoic acid 1 was slowly added to the reaction mixture and the mixture was stirred at room temperature for 2 h. The solvent was removed in vacuo and the residue was purified by silica chromatography (DCM : MeOH : 30% NH4OH = 7:1:0.1). 53 mg of 7 was collected as a pale yellow solid in a 35% yield. 1H NMR (500 MHz, CD3OD) δ 6.84 (s, 1H), 4.25 (s, 2H), 3.03 (dt, J = 11.2, 7.2 Hz, 4H), 1.73 (p, J = 7.5 Hz, 2H), 1.51 – 1.46 (m, 2H), 1.42 (s, 11H), 1.37 – 1.32 (m, 2H). 13C NMR (126 MHz, CD3OD) δ 161.34, 157.23, 153.21, 152.55, 117.89, 108.49, 98.34, 78.54, 46.28, 43.42, 39.72, 29.28, 27.45, 27.45, 27.45, 25.89, 25.82, 25.73. HRMS [M+] m/z calcd. for [C18H30N6O3+] 378.2379, found 378.2376. Synthesis of preQ 1 -C6-NH 2 3 20 mg of 2 was suspended in 1 mL DCM and 100 µL of TFA was slowly added to the reaction mixture. The suspension became clear and the mixture was allowed to stir at room temperature for 1 h. The solvent was removed in vacuo. The residue was basified by the addition of triethylamine. The resulting 3 as a yellow oil was used in the next reaction without purification. Synthesis of preQ 1 -C6-tetrazine 5 In a 4 mL glass vial, 1.2 mg (3.6 μmol, 1 equiv.) tetrazine carboxylic acids 4 33 was dissolved in 200 μL anhydrous DMF and the mixture was cooled to 0 °C. 1.4 mg (3.6 μmol, 1 equiv.) HATU and DIEA were added and the mixture was stirred at 0 °C for 10 min. A solution of 1 mg (3.6 μmol, 1 equiv.) 1 was then added to the stirring mixture. The mixture was stirred for 1 h and reaction was monitored by LC-MS. Upon the completion of the reaction, the solvent was removed in vacuo and the residue was purified by HPLC. HPLC gradient: 0 min – 2 min 50% Phase B in Phase A, 2 min – 18 min 50% Phase B in Phase A to 95% Phase B in Phase A, 18 min – 23 min 95% Phase B in Phase A, 23 min – 25 min 50%

36.20, 30.08, 27.21, 27.21, 26.95, 23.34, 21.03. HRMS [M+] m/z calcd. for [C28H37N11O3+] 576.3154, found 576.3150.

Results and Discussion We anticipated that one of the major challenges to label mod-RNA by transglycosylation is the extent to which TGT recognizes mod-RNA as a substrate. In particular, a commonly utilized modified base Ψ occupies two of the three positions at the key TGT recognition site U-G-U in the anticodon loop.28 Furthermore, the steric bulk of the methyl groups of 5mC, which plays a key role in forming the stem portion of the hairpin, may block proper recognition of the modified stem loop by TGT. These major changes to the natural RNA would possibly influence the TGT binding affinity of the modRNA and therefore hinder the efficiency of the enzymatic reaction. To test these limitations, we first synthesized modmRNAs in high yield using previously established protocols for in vitro transcription.32 Due to prior established labeling, we chose to employ an established DNA template that encodes for fluorescent protein mCherry as a proof-of-concept transcription template.31 To facilitate the synthesis of modRNA, the nucleobases cytidine or uridine were replaced by modified nucleobase 5mC or Ψ, or doubly substituted with both aforementioned bases during the IVT synthesis of the mCherry mRNA transcript. IVT mod-mRNA transcripts with both a partial (25%) and a full replacement of the natural bases with modified bases were synthesized. Anti-reverse cap analog (ARCA) was installed in one pot at the 5’ end. The IVT mod-mRNAs were subsequently polyadenylated to furnish mature mRNAs capable of being translated into mCherry upon transfection into mammalian cells (Fig. S1). To assess if the mod-mRNA is a suitable substrate for the TGT en-


Page 5 of 7

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


zyme, we initially sought to investigate the labeling efficiency of the mod-mRNA transcripts. We chose to conduct degree of labeling experiments with Cy5, a fluorophore with an exceptionally high extinction coefficient,34 as the mod-mRNA conjugates could be conveniently subjected to denaturing PAGE followed by fluorescent gel imaging for a qualitative study, and the ratio of quantified concentrations between the fluorophore and RNA could be measured by UV-Vis spectroscopy for a more quantitative degree of labeling (DOL)

filtration. The tetrazine conjugated mod-RNA was subsequently conjugated to the TCO-functionalized sulfo-Cy5 fluorescent probe via tetrazine ligation by incubating the two species for 4 h at 37 °C followed by purification of the RNA away from free dye in a similar fashion. The purified RNAs were then subjected to 4% polyacrylamide gel electrophoresis and imaged. The imaging results illustrate successful conjugation of sulfo-Cy5 to the mod-mRNA transcripts for all modification types (Fig. 2). The fluorescent RNA bands detected suggest the existence of a stable covalent linkage

Fig. 2. RNA PAGE image of mod-mRNA transcripts with different types of modifications. Top: fluorescent gel image shows that fluorescent probe sulfo-Cy5 was covalently attached to mCherry mod-mRNA transcripts by the TGT enzyme. Bottom. methylene blue stain of the mod-mRNA transcripts on the same gel.

analysis. Although RNA-TAG has been established to efficiently and directly incorporate small molecule moieties, we envisioned a two-step labeling approach of mod-mRNA such that the degree of labeling could be more concretely proven, and a diverse array of targeting molecules, irrespective of size or class, could be easily conjugated and evaluated without the need for multiple syntheses of preQ1 derivatives or the need to quantify each substrate’s efficiency of incorporation. To carry out this two-step approach, we first appended a bioorthogonal tetrazine moiety to mod-mRNA transcripts using the tetrazine modified preQ1 substrate 5. The tetrazine labeled mod-mRNAs could then be further coupled with a TCO-functionalized fluorescent probe or affinity agent using previously established robust tetrazine ligation chemistry.35,36 This facile two-step labeling approach is empowered by fast kinetics and high selectivity of bioorthogonal tetrazine ligation, which allows for the efficient labeling of mod-mRNAs in a substrate independent manner. Tetrazine modified preQ1 derivative 5 can be quickly accessed as described in Scheme 1. 7-Deazaguanine derivative preQ1 was first alkylated at the exocyclic amine by the Boc-protected amine functionalized C6 linker 1. Similar to the design of previous preQ1 probes, this linker provides an extension of any bulky functionalization away from the nucleobase minimizing interactions with the catalytic pocket of the TGT enzyme. The alkylated preQ1 2 was later deprotected with strong acid to restore the amine 3 and coupled with an in-situ activated ester of methyl tetrazine carboxylic acid 4 to yield preQ1-C6-Tetrazine 5. The mCherry mod-mRNAs were treated with the TGT enzyme and 5 at 37 °C for 4 h to access tetrazine labeled mCherry mod-mRNAs. These transcripts were purified from free labeling agent using high molecular-weight-cut-off spin

Fig. 3. The bar graph demonstrates a quantitative degree of labeling of the mod-mRNA. Absorbance of enzymatic labelled modified-mRNA at 650 nm and 260 nm were measured to determine the concentration of Cy5 and mod-mRNA, respectively. The DOL was calculated as the ratio of the two concentrations. All measurements were measured in triplicates. Scale bar denotes the standard deviation of three measurements.

between the fluorescent probe and the mCherry mod-mRNAs. It also demonstrated that mod-mRNA transcripts incorporated with modified nucleobase, such as 5mC, Ψ and 2sU, can also be accepted by TGT as substrates. To obtain more quantitative information for the degree of labeling, the ratio of the calculated Cy5 and mod-RNA concentrations for all mod-mRNA transcript conjugates were determined by absorbance measurements by quantifying at 650 nm and 260 nm, respectively. The DOL was determined to be 95% ± 2% for unmodified transcript, 84% ± 3% for 5mC modified transcript, 66% ± 4% for Ψ modified transcript and 61% ± 3% for both Ψ and 5mC modified transcript (Fig. 3). We hypothesize that the slightly lowered efficiency in labeling of all the 5mC-mod-mRNAs in comparison to unmodified mRNA could be due to variations in the secondary structure of the RNA-TAG hairpin, which may hamper enzyme substrate recognition. More interestingly, the decrease in DOL for the Ψ containing mod-mRNA transcripts most likely arises from disruption of key interactions between the TGT enzyme and flanking uridine residues on either side of the exchanged guanine when substituted for the modified base Ψ.28,30 However, increasing the reaction time for the Ψ containing transcripts did not lead to higher DOL values. The incorporation of Ψ in RNA is known to alter the secondary structure, and therefore may have influenced the TGT substrate recognition,37 rather than catalytic activity. We therefore hypothesize that small changes in the structure of the TGT enzyme, based on enzyme evolution experiments, are likely to improve the DOL for Ψ mod-mRNA considerably.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(12)

CONCLUSION We have developed a facile methodology to covalently label mod-mRNAs with a modular two-step approach that can incorporate small molecules such as imaging agents, affinity handles, targeting agents, and drug conjugates using RNA-TAG. Our approach provides the possibility of diverse decoration of therapeutically relevant modRNAs without the limitation of length due to RNA synthetic strategies. We believe that the RNA-TAG technology could greatly expand the arsenal of therapeutic RNAs by way of conjugation to a variety of functional decorations relevant to further tuning the emerging modality of RNA as a therapeutic class.

ASSOCIATED CONTENT

(13)

(14) (15)

(16)

(17)

Supporting Information. Experimental procedures and detailed characterization data for all new compounds. This material is available free of charge via the Internet at http://pubs.acs.org.

(18) (19) (20)

AUTHOR INFORMATION Corresponding Author

(21)

*[email protected]

(22)

Author Contributions

(23)

‡These authors contributed equally.

(24)

Notes The authors declare no competing financial interest.

(25)

ACKNOWLEDGMENT

(26)

This work was supported by the U. S. Army Research Office through the MURI program under Award no. W911NF-13-10383. C. Y. Z. acknowledges support from San Diego Fellowship.

(27)

REFERENCES (1) (2) (3) (4)

(5) (6) (7)

(8) (9)

(10)

(11)

Sahin, U.; Karikó, K.; Türeci, Ö. Nat. Rev. Drug Discov. 2014, 13 (10), 759–780. Ylä-Herttuala, S.; Aavik, E. Nat. Biotechnol. 2013, 31 (10), 891– 892. Karikó, K.; Muramatsu, H.; Welsh, F. A.; Ludwig, J.; Kato, H.; Akira, S.; Weissman, D. Mol. Ther. 2008, 16 (11), 1833–1840. Hiley, S. L.; Jackman, J.; Babak, T.; Trochesset, M.; Morris, Q. D.; Phizicky, E.; Hughes, T. R. Nucleic Acids Res. 2005, 33 (1), e2– e2. Uchida, S.; Kataoka, K.; Itaka, K. Pharmaceutics 2015, 7 (3), 137–151. Li, B.; Luo, X.; Dong, Y. Bioconjug. Chem. 2016, 27 (3), 849– 853. Kormann, M. S. D.; Hasenpusch, G.; Aneja, M. K.; Nica, G.; Flemmer, A. W.; Herber-Jonat, S.; Huppmann, M.; Mays, L. E.; Illenyi, M.; Schams, A.; Griese, M.; Bittmann, I.; Handgretinger, R.; Hartl, D.; Rosenecker, J.; Rudolph, C. Nat. Biotechnol. 2011, 29 (2), 154–157. Antony, J. S.; Dewerth, A.; Haque, A.; Handgretinger, R.; Kormann, M. S. D. Mol. Cell. Pediatr. 2015, 2 (1), 11. Zangi, L.; Lui, K. O.; von Gise, A.; Ma, Q.; Ebina, W.; Ptaszek, L. M.; Später, D.; Xu, H.; Tabebordbar, M.; Gorbatov, R.; Sena, B.; Nahrendorf, M.; Briscoe, D. M.; Li, R. A.; Wagers, A. J.; Rossi, D. J.; Pu, W. T.; Chien, K. R. Nat. Biotechnol. 2013, 31 (10), 898– 907. Elangovan, S.; Khorsand, B.; Do, A.-V.; Hong, L.; Dewerth, A.; Kormann, M.; Ross, R. D.; Rick Sumner, D.; Allamargot, C.; Salem, A. K. J. Control. Release 2015, 218, 22–28. Matsui, A.; Uchida, S.; Ishii, T.; Itaka, K.; Kataoka, K. Sci. Rep. 2015, 5, 15810.

(28) (29) (30) (31) (32)

(33)

(34) (35) (36) (37)

Page 6 of 7

Kaczmarek, J. C.; Patel, A. K.; Kauffman, K. J.; Fenton, O. S.; Webber, M. J.; Heartlein, M. W.; DeRosa, F.; Anderson, D. G. Angew. Chemie Int. Ed. 2016, 55 (44), 13808–13812. Fenton, O. S.; Kauffman, K. J.; McClellan, R. L.; Appel, E. A.; Dorkin, J. R.; Tibbitt, M. W.; Heartlein, M. W.; DeRosa, F.; Langer, R.; Anderson, D. G. Adv. Mater. 2016, 28 (15), 2939– 2943. Wang, Y.; Su, H.-H.; Yang, Y.; Hu, Y.; Zhang, L.; Blancafort, P.; Huang, L. Mol. Ther. 2013, 21 (2), 358–367. Jarzębińska, A.; Pasewald, T.; Lambrecht, J.; Mykhaylyk, O.; Kümmerling, L.; Beck, P.; Hasenpusch, G.; Rudolph, C.; Plank, C.; Dohmen, C. Angew. Chemie Int. Ed. 2016, 55 (33), 9591– 9595. Alam, M. R.; Dixit, V.; Kang, H.; Li, Z.-B.; Chen, X.; Trejo, J.; Fisher, M.; Juliano, R. L. Nucleic Acids Res. 2008, 36 (8), 2764– 2776. Zhu, G.; Niu, G.; Chen, X. Bioconjug. Chem. 2015, 26 (11), 2186–2197. Dr., Y.-F. H.; Dr., D. S.; Dr., H. L.; Dr., J. A. P.; Dr., X. Z.; Chen, Y.; Dr., W. T. Chembiochem 2009, 10, 862 – 868. Zhou, J.; Rossi, J. J. Mol. Ther. Nucleic Acids 2014, 3 (6), e169. Yoon, S.; Huang, K.-W.; Reebye, V.; Spalding, D.; Przytycka, T. M.; Wang, Y.; Swiderski, P.; Li, L.; Armstrong, B.; Reccia, I.; Zacharoulis, D.; Dimas, K.; Kusano, T.; Shively, J.; Habib, N.; Rossi, J. J. Mol. Ther. - Nucleic Acids 2017, 6, 80–88. El Yacoubi, B.; Bailly, M.; de Crécy-Lagard, V. Annu. Rev. Genet. 2012, 46 (1), 69–95. Jackman, J. E.; Alfonzo, J. D. Wiley Interdiscip. Rev. RNA 2013, 4 (1), 35–48. Holstein, J. M.; Muttach, F.; Schiefelbein, S. H. H.; Rentmeister, A. Chem. - A Eur. J. 2017. Schulz, D.; Holstein, J. M.; Rentmeister, A. Angew. Chem. Int. Ed. Engl. 2013, 52 (30), 7874–7878. Holstein, J. M.; Anhäuser, L.; Rentmeister, A. Angew. Chem. Int. Ed. 2016, 55 (36), 10899–10903. Li, F.; Dong, J.; Hu, X.; Gong, W.; Li, J.; Shen, J.; Tian, H.; Wang, J. Angew. Chem Int. Ed. 2015, 54 (15), 4597–4602. Stengl, B.; Reuter, K.; Klebe, G. ChemBioChem 2005, 6 (11), 1926–1939. Nonekowski, S. T.; Garcia, G. A. RNA 2001, 7 (10), 1432–1441. Curnow, A. W.; Kung, F. L.; Koch, K. A.; Garcia, G. A. Biochemistry 1993, 32 (19), 5239–5246. Xie, W.; Liu, X.; Huang, R. H. Nat. Struct. Biol. 2003, 10 (10), 781–788. Alexander, S. C.; Busby, K. N.; Cole, C. M.; Zhou, C. Y.; Devaraj, N. K. J. Am. Chem. Soc. 2015, 137 (40), 12756–12759. Avci-Adali, M.; Behring, A.; Steinle, H.; Keller, T.; Krajeweski, S.; Schlensak, C.; Wendel, H. P. J. Vis. Exp. 2014, No. 93, e51943– e51943. Evans, H. L.; Nguyen, Q.-D.; Carroll, L. S.; Kaliszczak, M.; Twyman, F. J.; Spivey, A. C.; Aboagye, E. O. Chem. Commun. 2014, 50 (67), 9557. Mujumdar, R. B.; Ernst, L. A.; Mujumdar, S. R.; Lewis, C. J.; Waggoner, A. S. Bioconjug. Chem. 1993, 4 (2), 105–111. Sletten, E. M.; Bertozzi, C. R. Angew. Chem. Int. Ed. Engl. 2009, 48 (38), 6974–6998. Devaraj, N. K.; Weissleder, R.; Hilderbrand, S. A. Bioconjug. Chem. 2008, 19 (12), 2297–2299. Zhao, B. S.; He, C. Cell Res. 2015, 25 (2), 153–154.


Page 7 of 7

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Insert Table of Contents artwork here


7

Site-Specific Covalent Conjugation of Modified mRNA by tRNA

Recommend Documents