Site-Specific PEGylation of Bone Morphogenetic Protein-2 Cysteine

1762

Bioconjugate Chem. 2010, 21, 1762–1772

Site-Specific PEGylation of Bone Morphogenetic Protein-2 Cysteine Analogues Junli Hu,* Viswanadham Duppatla, Stefan Harth, Werner Schmitz, and Walter Sebald Physiological Chemistry II, Biocenter, University of Wu¨rzburg, Am Hubland, 97074 Wu¨rzburg, Germany. Received December 21, 2009; Revised Manuscript Received September 4, 2010

Three cysteine analogues of bone morphogenetic protein (BMP)-2, BMP2A2C, BMP2N56C, and BMP2E96C, were generated in order to enable the attachment of SH-reactive poly(ethylene glycol) (PEG) at specific sites. Three different approaches (Ap) were used for SH-specific PEGylation: (Ap1) reaction of glutathione activated proteins with thiol PEG; (Ap2) reaction of DTT reduced proteins with orthopyridyl disulfide PEG; (Ap3) reaction of DTT reduced proteins with maleimide PEG. Non-, mono-, and di-PEGylated BMP-2 analogues could be separated by RP-HPLC. Trypsin digestion of PEGylated proteins and Trypsin and GluC double-digestion of N-ethylmaleimide-labeled proteins confirmed that the modifications were site-specific. Surface plasmon resonance analysis of type I and type II receptor binding of the PEGylated BMP-2 analogues revealed that all three PEGylation approaches were equivalent. PEGylation at positions 2 and 96 caused a similar decrease in receptor affinity. PEGylation at position 56 resulted in a larger decrease in affinity for both types of receptors. Mono-PEGylated BMP-2 analogues exhibited intermediate affinities in comparison with unmodified and di-PEGylated proteins. However, the biological activity of the PEGylated BMP-2 analogues as measured in alkaline phosphatase assay was higher than BMP-2 wild-type for the PEGylated BMP2A2C, slightly reduced for the BMP2N56C, and strongly reduced for the BMP2E96C. These results taken together indicate that specific attachment of PEG at engineered sites of BMP-2 is possible and that the attachment site is critical for biological activity. Furthermore, the biological activity of PEGylated BMP-2 analogues in cell culture seems to be determined not only by receptor affinity, but also by other factors such as protein solubility and stability. It is also discussed that the attached PEG interferes with the binding of BMP-2 to modulator proteins, co-receptors, or heparinic sites of proteoglycans in the extracellular matrix.

INTRODUCTION Bone morphogenetic protein-2 (BMP-2 or BMP2WT), as a member of the large transforming growth factor-β (TGF-β) superfamily of multifunctional cytokines, can induce ectopic bone and cartilage formation in adult vertebrates (1, 2) and plays important roles in early embryonal development in animals (3). It has received intense interest during the past decade due to its therapeutic use in regenerative medicine. BMP-2 is applied together with a carrier during surgery (4). Its poor solubility under physiological conditions, the presence of a heparin-binding site, and a short circulation half-life promote a desirable localized action of BMP-2 for indications in spinal fusion, repair of nonunion fractures, and sinus lift augmentation (5, 6). In the organism, the biological activity and solubility of several BMPs1seem to be modulated by post-translational * Correspondence to Junli Hu. Current address: School of Dentistry, University of California, Los Angeles, Advanced Prosthodontics, 10833 Le Conte Avenue, Room 23-032 CHS, Los Angeles, CA 90095-166815. Tel: 1-323-470-0638, E-mail: [email protected]. 1 Abbreviations: BMP, bone morphogenetic protein; BMP2A2C, bone morphogenetic protein-2 analogue with mutation from Ala to Cys at position 2; BMP2N56C, bone morphogenetic protein-2 analogue with mutation from Asn to Cys at position 56; BMP2E96C, bone morphogenetic protein-2 analogue with mutation from Glu to Cys at position 96; PEG, poly(ethylene glycol); Ap, approach; DTT, dithiothreitol; PEGylation, conjugation with poly(ethylene glycol); ALP, alkaline phosphatase; TGF, transforming growth factor; PEG-SH, thiol poly(ethylene glycol); PEG-MA, maleimide poly(ethylene glycol); PEGOPSS, orthopyridyl disulfide poly(ethylene glycol); PMSF, phenylmethylsulfonyl fluoride; HAc, acetic acid; Tris, tris(hydroxymethyl) aminomethane; HCl, hydrogen chloride; NaCl, sodium chloride; PBS, phosphate buffered saline; NEM: N-ethylmaleimide; cam: acetamidation by iodoacetamide; Rmax: maximal binding to receptor.

modifications. In BMP-2, BMP-6, BMP-7, and several other BMPs, an invariant asparagine side chain corresponding to Asn 56 of mature BMP-2 becomes N-glycosylated (7-9). BMP-6 and BMP-7 contain two additional N-glycosylation sites near the N-terminus. It was therefore challenging to explore in a proof-of-principle study with BMP-2 whether BMP proteins can be chemically modified at specific sites and how far a chemical modification influences the solubility and the biological activity of the BMP protein. Poly(ethylene glycol) (PEG) is biocompatible and readily soluble in water. PEGs are available with low polymer dispersity index (less than 1.02) and as derivatives carrying functional groups for chemical modification at different reactive sites. Protein PEGylation has been a very successful approach to slow down ultrafiltration in the kidney, to alter tissue distribution, and to reduce phagocytosis, proteolysis, and immunogenicity (10, 11). During the past two decades, several PEGylated protein products like Adagen, Oncaspar, PEG-Intron, Pegasys, Neulasta, and Somavert have been approved for human use. Many others are undergoing clinical evaluation (10). Most chemical strategies of PEGylation were based on the nucleophilic or electrophilic reaction between PEG derivatives and the reactive groups of amino acid residues, e.g., amino group from lysine and N-terminus, thiol group from cysteine, or hydroxyl group from serine (12). Due to the polyfunctional nature of proteins, such nonselective strategies often lead to a mixture of chemically different entities, which may complicate the prediction of the pharmaceutical behavior of the protein. Therefore, site-specific PEGylation is highly desirable. Different routes were developed for this purpose. Kinstler et al. described a method that specifically PEGylates N-terminal amino group relying on the difference in pKa of R-amino group of N-terminus and the ε-amino group of lysine residues (13). Mutagenesis has

10.1021/bc9005706  2010 American Chemical Society Published on Web 10/01/2010

Site-Specific PEGylation of BMP-2 Proteins

been used to make single-site attachment possible (14). PEGylation at the thiol group of cysteines not involved in disulfide bridges is one of the most specific methods because cysteines are rarely present in proteins or normally form disulfide bridges, and mutagenesis technique provides a convenient way to generate single cysteine for PEGylation. Interferon-R2 (15), cyanovirin-N (16), and granulocyte colony-stimulating factor (17) were site-specifically PEGylated either as wild-type protein or as cysteine analogue. The wild type of BMP-2 forms a disulfide-bonded homodimer in its native state. Each of the BMP-2 monomers has seven cysteines. Six of them form three intramolecular disulfides (Cys 43/Cys 111, Cys 47/Cys 113, and Cys 14/Cys 79), constituting a cysteine knot, which is a common feature of all members of the TGF-β superfamily (18). The cysteine knot is crucial for the conformation and thus for the activity of the BMP-2. One cysteine (Cys 78) forms an intermolecular disulfide with the other monomer, constituting the dimer (19). It contains no free cysteine side chains. There are a few examples of PEGylation at amino groups of BMP-2 and the related TGF-β1 and TGFβ2 for their applications in tissue engineering. PEGylation was employed to immobilize the protein on scaffolds and thus to improve local bone regeneration (20), to lengthen local fibroblastic response (21), or to increase muscle matrix production (22). The large number of amino groups (7-9 lysines and one N-terminus in each monomer) made the PEGylation heterogenic. Unfortunately, no detailed biochemical data on the PEGylated proteins were reported. BMP-2 homodimer formed by two hand-like monomers contains two wrist epitopes for type I receptor binding and two knuckle epitopes for type II receptor binding (23). The crystal structure of ternary complexes consisting of BMP-2 and the ectodomains of type I and type II receptors has been reported (24). During the present study, BMP-2 cysteine analogues were generated by site-directed mutagenesis at amino acid positions Ala 2, Asn 56, and Glu 96 differing in their distances to the binding epitopes for the receptors. Three approaches for SHspecific PEGylation were compared with respect to sitespecificity, as well as yield and solubility of the modified analogues. The biological activities of the PEGylated BMP-2 cysteine analogues were analyzed and compared in detail applying receptor interaction and cell-based assays.

EXPERIMENTAL PROCEDURES Chemicals. Thiol PEG (PEG-SH, Mn ) 4503 Da, Sunbright ME-050SH) and maleimide PEG (PEG-MA, Mn ) 5426 Da, Sunbright ME-050MA) were purchased from NOF Inc. (Kyoto, Japan). Functional PEG was dissolved in analytical-grade dimethylsulfoxide (DMSO, Sigma, St. Louis, MO, USA) and stored at -20 °C. 2,2′-dithio dipyridine and p-nitrophenyl phosphate were purchased from Sigma (St. Louis, MO, USA). Dithiothreitol (DTT), buffer chemicals, and SDS-polyacrylamide gel electrophoresis (SDS-PAGE) chemicals were purchased from Carl Roth (Karlsruhe, Germany). Phenylmethylsulfonyl fluoride (PMSF) and Trypsin (sequencing grade) were purchased from Merck (Darmstadt, Germany). N-Ethylmaleimide (NEM) was purchased from Thermo Scientific (Dreieich, Germany). RapiGest was supplied by Waters (Massachusetts, USA); Endoproteinase GluC was purchased from New England Biolabs (Frankfurt am Main, Germany). Cloning DNA Sequences Encoding BMP-2 Cysteine Analogues. DNAs encoding BMP-2 cysteine analogues at the position of Ala 2, Asn 56, or Glu 96 (BMP2A2C, BMP2N56C, BMP2E96C) were amplified by means of the polymerase chain reaction (PCR) method using primers BMP2A2C5′(CCATGGCTCAATGCAAACACAAACAG) and BMP2A2C3′ (CTGTTTGTGTTTGCATTGAGCCATGG) for BMP2A2C, BMP2-

Bioconjugate Chem., Vol. 21, No. 10, 2010 1763

N56C5′ (GCTGATCATCTGTGCTCCACTAATCAT) and BMP2N56C3′ (ATGATTAGTGGAGCACAGATGATCAGC) for BMP2N56C and BMP2E96C5′ (GTACCTTGACGAGAATTGCAAGGTTG) and BMP2E96C3′ (CAACCTTGCAATTCTCGTCAAGGTAC) for BMP2E96C. Plasmid vector QKA BMP-2, which has a BMP-2 cDNA insert corresponding to residues 283-396 of the mature protein plus an N-terminal MetAla extension, was used as a template. The PCR products were digested with NcoI and BamHI and cloned into digested plasmid vector, creating plasmids QKA BMP2A2C, QKA BMP2N56C, and QKA BMP2E96C. The plasmids encoding the cysteine analogues were transformed into the E. coli host MM294. Correct DNA sequences of all cysteine analogues were confirmed by DNA sequence analysis. Expression and Purification of BMP-2 Cysteine Analogues. The wild type of recombinant human BMP-2 (BMP2WT) was expressed and purified as described previously (25). Heparin sepharose chromatography was applied as an additional final purification step (26). During refolding of the proteins, 2 mM oxidized and 1 mM reduced glutathione were added. The plasmids encoding the BMP-2 cysteine analogues were transformed to BLR(DE)3 E. coli host strains, and expressed and purified by the same procedure as those for BMP2WT. Electrospray Ionization Mass Spectrometry Analysis (ESIMS). ESI-MS was performed using an APEX-II FT-ICR (Bruker Daltonic GmbH, Bremen) equipped with a 7.4 T magnet and an Apollo ESI ion source in positive mode. Desalted proteins were dissolved in methanol/H2O/HAc (49.5/49.5/1) at the concentration range 1-5 µM. Sample was injected using a Hamilton syringe at a speed of 2 µL/min with a capillary voltage of 100 mV. Detection range was typically set to 300-3000 m/z in preliminary measurements. The detection range was optimized to the signal-containing area afterward. 256 scans were added at a resolution of 256 K. DTT Reduction of Glutathione Oxidized BMP-2 Cysteine Analogues. Glutathione oxidized BMP-2 cysteine analogues (noted as BMP2A2C/N56C/E96Cox) were incubated at 1 mg/ mL in 0.1 mM DTT, 4 M urea, 50 mM Tris, pH 8 for 2 h at room temperature and then submitted to reversed-phase HPLC (RP-HPLC) to remove DTT and buffer salts. The reduced proteins were designated as BMP2A2C/N56C/E96Cre in the following text. Preparation of Orthopyridyl Disulfide PEG (PEG-OPSS). PEG-OPSS was prepared according to Woghiren et al. (27) with minor modifications. Briefly, 284 mg PEG-SH and 245 mg 2,2′dithio dipyridine were dissolved in 1.5 mL methanol, and then 0.17 mL 0.4 M Tris, 1.2 M NaCl, pH 10, was added. The mixture was then shaken at 1400 rpm and 50 °C for 1 h. Methanol was evaporated under a stream of nitrogen. The activated PEG was extracted twice with 1 mL 100 mM HAc. The combined supernatants containing the activated PEG were loaded on a size exclusion chromatography column (Bio-Gel P6j DG Desalting Gel, Bio-Rad, Hercules, CA, USA) and eluted with 100 mM HAc. The pooled peak fractions were freeze-dried and stored at -80 °C. PEGylation at Analytical Scale. BMP-2 cysteine analogues (1 mg/mL) and different amount of activated PEG (molar ratio of PEG to protein between 1:1 and 100:1) were incubated in 0.1 mL of 4 M urea, 50 mM Tris, pH 8, containing 10% (v/v) DMSO. The PEGylation mixtures were shaken at room temperature at 700 rpm for 2-48 h. PEGylation at Preparative Scale. Three different approaches (Ap1-3) were used to PEGylate protein at a preparative scale as listed in Table 1. BMP-2 cysteine analogues (1 mg/mL) and 30-fold excess PEG-SH (Ap1) or 3-fold excess PEG-OPSS (Ap2) or PEGMA (Ap3) reacted in 4 M urea, 50 mM Tris, pH 8, containing

1764 Bioconjugate Chem., Vol. 21, No. 10, 2010

Hu et al.

Table 1. Three Approaches Used for PEGylation of BMP-2 Cysteine Analogues approach

protein

PEG

product

Ap1 Ap2 Ap3

BMP2A2C/N56C/E96Cox BMP2A2C/N56C/E96Cre BMP2A2C/N56C/E96Cre

PEG-SH PEG-OPSS PEG-MA

mono/diPEG-SS-BMP2A2C/N56C/E96Cox mono/diPEG-SS-BMP2A2C/N56C/E96Cre mono/diPEG-SMA-BMP2A2C/N56C/E96Cre

10% (v/v) DMSO. The PEGylation mixtures were shaken at room temperature at 700 rpm for 48 h (Ap1) or 2 h (Ap2 and 3). The PEGylation mixtures were then submitted to RP-HPLC for separation. SDS-Polyacrylamide Gel Electrophoresis (SDS-PAGE). SDSPAGE was performed using a 12% polyacrylamide gel as described previously (28). Protein solutions were diluted 2- to 5-fold with nonreducing sample buffer. The gels were stained with Coomassie Blue. Trypsin Digestion. PEGylated BMP-2 cysteine analogues (0.1 mg) dissolved in 70 µL 1 mM HCl were mixed with 10 µL 0.1 mg/mL Trypsin solution in 1 mM HCl. A 20 µL solution of 2.5 M Tris and 250 mM NaCl, pH 8.5, was then added, and the whole mixtures were kept at 37 °C for 4 h. PMSF of 1 mM was added to stop the reaction before sample preparations for SDS-PAGE. Reduction and NEM-Labeling of BMP-2 Cysteine Analogues. Proteins were reduced with DTT as described above. For the E96C analogues, however, the DTT concentration was increased from 0.1 mM to 0.3 mM. MS analysis established that all proteins were devoid of glutathione and contained the expected seven disulfide bridges. After RP-HPLC, the proteins were freeze-dried and stored at -20 °C. The reduced protein was dissolved in 4 M urea, 50 mM Tris, pH 8, at 1 mg/mL and incubated with a 3-fold molar excess of NEM for 2 h at room temperature. The mixture was submitted to RP-HPLC (see below). The protein was eluted as a main peak with a small shoulder. Protein fractions were combined, freeze-dried, dissolved in water, and stored at -20 °C. Double-Digestion of NEM-Labeled BMP-2 Proteins with Trypsin and GluC. The NEM-labeled BMP-2 protein (3.5 µg in 10 µL H2O) was mixed with RapiGest, reduced with DTT, reacted with an excess of iodoacetamide, and finally digested with Trypsin and Endoproteinase GluC as specified by the suppliers. The complete solution was then taken to dryness. The residue dissolved in 30 µL of 1% trifluoroacetic acid was applied to a C18-ZipTip (Millipore, Germany), and peptides were eluted in 50 µL methanol/H2O/HAc (49.5/49.5/1 v/v/v). The whole eluted peptide fraction was subjected to mass spectrometry. RP-HPLC. RP-HPLCs on a Grace Vydac 214TP54 C4 column (250 × 4.6 mm) were performed on a liquid chromatography system equipped with a Merck Hitachi L-6200A intelligent pump, a Merck Hitachi L-4000 UV detector, and a Gilson FC203B fraction collector. DTT reduced BMP-2 cysteine analogues were eluted with a linear gradient of 0.1% trifluoroacetic acid (Buffer A) and acetonitrile (Buffer B). (0% to 100% buffer B in 50 min). PEGylation mixtures of BMP-2 cysteine analogues were separated by applying the following protocol: 0% to 30% buffer B in 10 min, 30% to 50% B in 40 min, and 50% to 100% B in 10 min. Solubility Analysis in Phosphate Buffered Saline (PBS). The UV spectra of PEGylated BMP-2 in PBS (150 mM NaCl, 10 mM sodium phosphate salt, pH 7.4) were recorded with a UV-vis spectrophotometer (Cary 50 BIO, Varian). Unmodified BMP-2 was used as the control. Stock aqueous solutions containing 4 µM of free and PEGylated BMP-2 cysteine analogues were diluted with the same volume of double concentrated PBS, mixed thoroughly, and kept at room temperature for 2 h. The spectra of the solution were recorded between 250 and 320 nm.

Biosensor Interaction Analysis. Biosensor experiments were carried out on a BIAcore 2000 system (Pharmacia Biosensor) at 25 °C at a flow rate of 10 µL/min in running buffer (10 mM 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid, pH 7.4, 500 mM NaCl, 3.4 mM ethylenediaminetetraacetic acid, 0.005% surfactant polyoxyethylene sorbitan P20) with a data collection rate of 2.5/s. A CM5 biosensor chip was first coated with streptavidin in all four flow cells, and subsequently the biotinylated ectodomains of BMP receptor IA (BMPR-IA) or Activin receptor IIB (ActR-IIB) was immobilized on the streptavidin matrix in flow cells 2 and 3 (29). C2C12 Alkaline Phosphatase Assay. Alkaline phosphatase (ALP) activity was determined in serum-starved mouse C2C12 cells. The promyoblast C2C12 cells (ATCC-CRL1772) in Eagle’s minimal essential medium containing 10% fetal calf serum were incubated at 1 × 105 cells/mL in 100 µL aliquots in a 96-well plate for 24 h at 37 °C and 5% carbon dioxide. Afterward, the medium was substituted with 100 µL fresh medium containing 2% fetal calf serum containing various concentrations of the BMP proteins. After a further cultivation for three days, cells were lysed in 100 µL lysis buffer (0.1 M glycine, 1% nonyl phenoxylpolyethoxylethanol, 1 mM magnesium chloride, 1 mM zinc chloride, pH 9.6) and alkaline phosphatase activity was determined in 100 µL aliquots of the cleared lysate using 100 µL 0.3 mM p-nitrophenylphosphate in the color buffer (0.1 M glycine, 1% nonyl phenoxylpolyethoxylethanol, 1 mM magnesium chloride, 1 mM zinc chloride, pH 9.6) as substrate. Absorbance at 405 nm was recorded after incubation of 50 min.

RESULTS AND DISCUSSION BMP-2 Cysteine Analogues. All three analogues could be prepared, but with lower yields (6.8, 5.2, 3.5 mg/L culture medium for BMP2A2C, BMP2N56C, BMP2E96C, respectively) than BMP2WT (46 mg/L). Mass spectrometry of the purified BMP-2 analogues reveals that BMP2A2Cox and BMP2E96Cox have molecular weights 610 Da larger than those expected for the cysteine proteins (Figure 1A-C). This increase in size corresponds to two glutathione groups minus four hydrogen atoms. Two species of BMP2N56Cox were identified by mass spectrometry, whose molecular weights were in accordance with a mono- and diglutathione derivative. The glutathione becomes attached most likely by a disulfide bond during the refolding step of the recombinant BMP proteins. As redox couple, oxidized glutathione and reduced glutathione were present in the refolding reaction to provide the appropriate redox potential that allows formation and reshuffling of disulfides bonds (see Experimental Procedures). The attached glutathione might have served as a protecting group during protein purification. On the other hand, the attached glutathione could be used as activating group allowing the reaction with SH-activated PEG for PEGylation. The attached glutathione could be removed by treatment of BMP2A2C and BMP2N56C with DTT of very low concentration (0.1 mM) when the dimer is still stable but the attached glutathione will be removed. Figure 1D-F shows the mass spectra of the proteins after DTT treatment. For BMP2A2C and BMP2N56C, both glutathione groups in dimer were removed successfully by DTT treatment, but for BMP2E96C, DTT treatment could remove the glutathione only partially. This resulted in a mixture of fully glutathione-oxidized, half oxidized,



Figure 1. Mass spectra of BMP-2 cysteine analogues before (A, B, C) and after (D, E, F) DTT reduction. A, D: BMP2A2C. B, E: BMP2N56C. C, F: BMP2E96C. The analysis of these proteins by SDS-PAGEs is shown in Figure 2.

Figure 2. SDS-PAGE analysis of PEGylation mixtures obtained by Ap1, Ap2, and Ap3 listed in Table 1. Lane 1 always corresponds to BMP-2 cysteine analogues before PEGylation; lanes 2-6 correspond to PEGylation products obtained at a molar PEG excess of 1, 3, 10, 30, and 100, respectively. The conditions marked by dashed rectangles were used for PEGylations at preparative scale. Bands I, II, and III correspond to free, mono-, and di-PEGylated proteins, respectively.

and fully reduced BMP2E96C at the ratio of about 2:2:1. The only partial reduction observed in several experiments is difficult to explain, since Cys 96 of each monomer is supposed to be exposed on the protein surface (24). At 0.3 mM DTT, however, the attached glutathione groups also of BMP2E96C were completely removed (see below). Optimizing the Conditions for PEGylation of BMP-2 Cysteine Analogues. Figure 2 presents SDS-PAGE analysis of whole PEGylation products obtained at different PEG/protein molar ratios by three different approaches (Table 1): Ap1, PEGSH reacted with the glutathione oxidized proteins; Ap2, PEGOPSS reacted with the reduced proteins; Ap3, PEG-MA also reacted with the reduced proteins. Methods Ap1 and Ap2 generate disulfide bonds between protein and PEG. Method Ap3 involving a reaction between maleimide and thiol group results in a nonreducible single bond connecting protein and PEG.

In order to obtain high PEGylation levels of the glutathioneoxidized proteins with Ap1, 30- to 100-fold molar excess of PEG-SH and a 48 h reaction time had to be applied. The major products were mono- or di-PEGylated proteins, migrating as the first and second upper bands (bands II and III in Figure 2, respectively). A few proteins with higher molecular weights were observed which might represent multimers or multiPEGylated proteins. When lower molar excess of PEG-SH was applied, the amount of mono- and di-PEGylated protein always increased with the reaction time. At higher PEG-SH input (30to 100-fold excess), the yield of di-PEGylated protein increased with the reaction time, while the yield of mono-PEGylated proteins decreased at later time points (18 to 48 h), probably due to the conversion of the mono- to the di-PEGylated form. In contrast, the DTT reduced proteins were more reactive than the oxidized proteins, but also less stable. For BMP2A2Cre and BMP2N56Cre, already a 3-fold molar excess of PEG-OPSS or PEG-MA yielded the di-PEGylated proteins as major products. This suggests that both SH groups of the dimer exhibited the same reactivity. For BMP2E96Cre, the monoPEGylated form dominated, probably because only one of the SH groups was free in most protein dimers (see above). Several proteins of higher molecular weight appeared in the SDS-PAGE. These are most pronounced with Ap2 and somewhat less so with Ap3. At least some of them likely represent multimers generated by oxidative disulfide formation between two or more BMP-2 proteins, since bands with the same mobility are seen after SDS-PAGE of the non-PEGylated protein or of the protein incubated at low molar excess of the activated PEG. Remarkably, multimers are least abundant with the analogue A2C. This is possibly related to the observation that the N-terminal cysteines can form an intramolecular disulfide bond (data not shown). The strong multimer formation with Ap2 possibly results from a disulfide exchange with PEG-OPSS especially at low molar excess of this disulfide activated PEG. It has also to be considered that the rate of PEGylation might differ among the three analogues and that disulfide formation as a side reaction can therefore proceed for different time periods. One of the additional bands obtained with Ap3 might correspond to a tri-PEGylated BMP-2 protein most likely


Figure 3. Representative RP-HPLC chromatogram for the separation of PEGylated BMP2A2C after labeling by Ap1. Peaks 1-3 correspond to free BMP2A2Cox, mono-, and di-PEGylated BMP2A2Cox, respectively. Peak 4 corresponds to multi-PEGylated BMP2A2Cox or multimers of the BMP2A2C.

Figure 4. SDS-PAGE analysis of PEGylated BMP-2 cysteine analogues conjugated with maleimide PEG (Ap3) (lanes 2-7) and their Trypsin digests (lanes 9-14). Lane 2, monoPEG-SMA-BMP2A2Cre; 3, diPEGSMA-BMP2A2Cre; 4, monoPEG-SMA-BMP2N56Cre; 5, diPEG-SMABMP2N56Cre; 6, monoPEG-SMA-BMP2E96Cre; 7, diPEG-SMABMP2E96Cre. Lanes 9-14 correspond to the Trypsin digests of 2-7, respectively. BMP2WT (lane 1) and its Trypsin digests (lane 8) were served as references. Band I corresponds to the large BMP-2 fragment with cleaved-off N-terminal part. Bands II and III correspond to the large fragment containing one and two PEG chains, respectively.

Hu et al.

generated by unspecific MA-PEGylation at amino groups (see the fifth section). Preparative PEGylation and RP-HPLC. For preparative PEGylation of glutathione oxidized proteins, we chose a PEG/ protein molar ratio of 30 and a reaction time of 48 h. These conditions are marked as the left dashed rectangle in Figure 2. For preparative PEGylation of DTT reduced proteins, we chose a PEG/protein molar ratio of 3 (see middle and right dashed rectangles in Figure 2). Figure 3 shows a representative RPHPLC chromatograph for the separation of free, mono-, and di-PEGylated BMP-2 cysteine analogues. Lanes 2-7 in Figure 4 show the SDS-PAGEs of PEGylated proteins (Ap3 only) after RP-HPLC purification. All the isolated PEGylated proteins exhibit a purity of more than 90%. Trypsin Digestion of PEGylated Proteins. BMP2WT can be cleaved by Trypsin between Lys 8, Arg 9, and Lys 11 at the N-terminal part (Figure 4, lanes 8-14, Figure 5). The cleavage sites are inferred from the mass of the three larger cleavage products which are 23231.735, 23471.860, and 23627.891 Da, respectively. Therefore, band I in Figure 4 corresponds to the BMP-2 fragment missing the N-terminal part. The mono- and di-PEGylated BMP2A2C from all preparations were digested to a protein migrating as the digested BMP2WT, clearly indicating that PEG was attached at the cleaved N-terminal end; this means at Cys 2, suggesting that PEGylations at Cys 2 were site-specific. Incontrast,mono-anddi-PEGylatedBMP2N56CorBMP2E96C from all preparations retained the attached PEG in the large BMP fragment after Trypsin cleavage. This is indicated by the migration of the fragments with one or two additional PEGs in bands II and III, respectively. Limited trypsin digestion of PEGmodified BMP-2 cysteine mutants and subsequent SDS-PAGE analysis showed that PEGylation occurred with the A2C protein in the N-terminal peptide whereas with N56C and E96C in the cystine-knot domain (Figure 4). There exists only one single cysteine in the N-terminal peptide of the A2C analogue which can be responsible for the cysteine-specific PEGylation detected in this peptide. The cysteine knot domain, however, contains the introduced cysteine residues and, in addition, the seven

Figure 5. Mass spectra of (A) the large Trypsin fragments of BMP2WT, in comparison with (B) undigested BMP2WT. (C) Proposed N-terminal sequences of the fragments that have been aligned with mature BMP2WT sequence. The clustered basic amino acids in the N-terminal segment represent a heparin-binding epitope (25).



Figure 6. Mass spectra of peptides generated by double-digestion of NEM-labeled BMP2N56C and BMP2E96C with Trypsin/GluC. The deconvoluted spectra represent different mass regions of the same record for each of the analogues. The designation of the peptides and their molecular weights, intensities, and assignments are listed in Supporting Information Tables S-2A and S-2B. (A) Peptides a/A, b, c, and d/D represent BMP-2 sequences from amino acid 77 to 97 as indicated by the boxed position ranges. (B) Peptides e/E, f/F, and g represent BMP-2 sequences from amino acids 16 to 76 as indicated by the boxed position ranges. Peptides labeled with NEM are assigned by capital letters A, D (E96C NEM), and E, F (N56C NEM). Multiple forms of a peptide can be generated by partial elimination of methylmercaptan (MeSH) from Met containing peptides (32), and/or from acetamidation of mercapto- and/or amino-groups by iodoacetamide (cam) (31). Peptides formed after elimination of MeSH are designated by “-”. The number of acetamide modified residues of a peptide is designated as a suffix to the characterizing letter of the peptide. All peptides containing intramolecular SS-bridges prior to reduction become labeled with two cams after reduction and iodacetamide treatment (b2, c2, d2, D2, e2, E2, f2, F2, and g2).

cysteines of BMP-2 which represent potential PEGylation sites in the case of protein misfolding and/or partial reduction. The specificity of PEGylation at N56C and E96C thus cannot be confirmed only by these results. However, the nonlabeling of

the A2C analogue in the cysteine knot domain strongly suggests that in the di-PEGylated analogues N56C and E96C the label has been attached to the introduced cysteine residues as analyzed in detail in the following section.


NEM-Labeling of BMP-2 Cysteine Analogues Is Specific for the Introduced Cysteine Residue. In order to define the specificity of labeling in more detail, the N56C and E96C analogues were further analyzed by mass spectrometry. Initial trials with maleimide-di-PEGylated proteins showed that positive identification of PEGylated peptides by mass spectrometry was not possible, since the MA-PEG contained multiple species differing by one ethoxy group. This heterogeneity is not apparent at the lower resolution of SDS-PAGE analysis. Therefore, labeling was performed with NEM (see Experimental Procedures) representing only the reactive Nethylmaleimide group without the PEG side chain. NEM is a classical SH-reagent. Side reactions with amino groups have been observed, however, in particular, if the reaction is performed at pH values higher than 7.5 (30). MS analysis identified the di-NEM derivatives as major reaction product of all cysteine analogues (see Supporting Information Figure S-1, Table S-1). Smaller amounts of tri-NEM- and spurious amounts of tetra-NEM-derivatives could be also observed. The whole reaction products were submitted to a doubledigestion with Trypsin and GluC. The expected diagnostic peptides after complete or partial digestion were identified by MS covering sequence positions 16 to 76 (annotated “e, f, and g” in Figure 6B), including Cys 56 in the N56C analogue, as well as sequence positions 77 to 97 (annotated “a, b, c, and d” in Figure 6A), including the Cys 96 of the E96C analogue. NEM labeling was detected only in peptides F (16-73) and E (17-73) of BMP2N56C (Figure 6A) and in peptides A (84-97) and D (77-97) of BMP2E96C (Figure 6B). Virtually no NEM labeling could be identified either in the corresponding non-mutated peptides from both analogues (Figure 6; compare peptides labeled with capital letters or with small letters) or in the corresponding non-mutated peptides from the BMP2A2C analogue (data not shown). These results show that NEM labeling is found as expected only in peptides containing the introduced cysteine residues of N56C and E96C analogues. They furthermore strongly suggest that unspecific labeling has not occurred at positions of the native cysteine residues forming the cysteine knot and the covalent homodimer of BMP-2. Because the reactivities of NEM and MA-PEG are comparable, we conclude that in the PEGylated analogues SH-specific labeling also occurs only at the positions of the introduced cysteine residues. Remarkably, the occurrence of tri-NEM labeled proteins (Supporting Information Figure S-1) is not reflected by detectable amounts of additional NEM-labeled peptides. Possibly, this NEM label is unspecifically attached to amino groups (see above) and distributed randomly over several side chains. This labeling might be therefore below the detection limit. Most peptides had been modified by cam during sample preparation as expected by the presence of cysteines in the native BMP-2 proteins. In addition, a small amount of unspecific, i.e., nonSH labeling, by cam, was observed as described previously (31). Some triple-cam peptides from the N56C protein indicate that the NEM-labeling was not complete. Actually, a small amount of free N56C protein was seen after MS analysis of the complete protein (Supporting Information Figure S-1). It was not attempted in the present experiments to separate the different NEM-labeled BMP-2 proteins. However, the diMA-PEGylated species described above (Figure 4) were separated from non-, mono-, and multi-PEGylated proteins (Figure 3). This will further ensure the selectivity of labeling at the introduced cysteine residues. Solubility. BMP2WT is poorly soluble under physiological conditions. Its solubility limit in PBS is around 200 nM. In the organism, this might prevent systemic activity of BMP-2. In order to see whether PEGylation improves solubility in PBS, the spectral properties of 2 µM BMP2WT, analogues, and their

Hu et al.

Figure 7. Spectra of 2 µM solutions of free BMP-2 analogues (A) and mono- (B), as well as di- (C), PEGylated BMP-2 analogues in PBS.

PEGylated derivatives were determined, as shown in Figure 7. The spectra of BMP2WT and its cysteine analogues (glutathione oxidized proteins) (Figure 7A) showed a continuous increase of absorption from 320 to 250 nm, which is typically observed due to the light scattering when protein aggregates are present (33). In contrast, the spectra of PEGylated BMP-2 cysteine analogues (Figure 7B,C), no matter whether for mono-PEGylated or di-PEGylated ones, showed low extinction at 320 nm and low intercept at 250 nm, signifying a more molecularly dispersed BMP-2 protein solution. This indicates that indeed the attached PEG enhances the solubility of BMP-2 under physiological pH and ionic strength at least up to 2 µM concentrations. Biosensor Interaction Analysis. The mono- and di-PEGylated BMP-2 analogues were analyzed for receptor binding by surface plasmon resonance. Immobilized ectodomains of receptors ActR-IIB and BMPR-IA were perfused with BMP-2 proteins at concentrations from 20 to 100 nM. Figure 8 shows representative sensorgrams recorded for the binding of 60 nM PEGylated proteins in comparison with 60 nM unmodified wildtype BMP-2. A semiquantitative evaluation is presented in Figure 9. A calculation of the exact kinetic and equilibrium constants was not attempted in the present study, since BMP-2 is a dimeric protein and neither the association nor the dissociation phase could be fitted on the basis of a 1:1 interaction model. Depending on the concentration of the ligand and on the occupancy of the immobilized receptor protein, both 1:1 and 2:1 interactions can occur (34, 35). For the un-PEGylated BMP-2 analogues in oxidized form, approximate dissociation constants and rate constants are


Figure 8. Representative sensorgrams for the binding of 60 nM PEGylated BMP-2 analogues in comparison with 60 nM unmodified BMP2WT (top curve of each figure). The sensorgrams during the first 300 s represent association with the receptor, and those after 300 s represent dissociation. Steep curves indicate fast association or dissociation rate.

compiled in Supporting Information Table S-3. Together with the sensorgrams in Supporting Information Figure S-2, these data show that the A2C and E96C analogues interact with the receptor proteins similar to BMP-2 wild-type. The affinity of BMP2N56C, however, is reduced about 5-fold with BMPR-IA and less than 2-fold with ActR-IIB. The crystal structure of the ternary complex consisting of BMP-2 and the ectodomains of BMPR-IA and ActR-IIB (36) indicate that the side chains at all three position are freely accessible. However, Asn 56 in BMP-2 is very close to the interface with BMPR-IA and ActRIIB, so that the glutathione attached to the oxidized protein might somewhat interfere with receptor binding. The three different PEGylation approaches yielded modified BMP-2 analogues with similar receptor binding properties as shown for the di-PEGylated BMP2A2C proteins at 60 nM concentrations in Figure 8A,B. Equilibrium binding to ActR-


IIB was reduced to the same extent (Figure 9). During the interaction with the BMPR-IA receptor, all three PEGylation approaches yielded modified BMP-2 analogues with a strongly reduced association rate and a small reduction in the dissociation rate. This indicates that the highly specific chemistry based on SH/SS exchange (Ap1, Ap2) yields similar results as the NEMbased modification (Ap3). The mono-PEGylated BMP-2 analogues exhibited intermediate affinities compared to unmodified and di-PEGylated proteins for both receptors throughout (Figure 8E,F and Figure 9). The intermediate affinity likely results from the parallel receptor interaction of the un-PEGylated and the modified monomer in the dimeric BMP-2 analogues. A comparison of the effect of PEGylation at positions 2, 56, and 96 is presented in Figure 8C and D. Only PEGylation by the maleimide PEG is shown. Di-PEGylation of BMP2A2C caused the smallest effect for the interaction with both receptors. The di-PEGylated BMP2E96C bound as the modified BMP2A2C protein to ActR-IIB and with somewhat lower affinity to the BMPR-IA receptor. The binding of di-PEGylated BMP2N56C was affected to the largest extent with both receptors compared to the other two analogues. An evaluation of the apparent rate and equilibrium constants is presented in Supporting Information Table S-3. The differences in the results of the biosensor interaction analysis observed with the three BMP-2 analogues PEGylated at the positions 2, 56, and 96 could indicate that PEGylation specificity varies among the three analogues. However, such differences in PEGylation specificity if existing at all should be small, since NEM modification yielded similar results with all three analogues (Supporting Information Figure S-1, Table S-1). As discussed at the end of the second section, differences in multimer formation after PEGylation of the three analogues (Ap2) can be explained by an intramolecular disulfide formation in A2C and an intermolecular disulfide formation in N56C and E96C. We therefore suggest that the differences in receptor interaction likely reflect the location of the side chains at positions 2, 56, and 96 in relation to the receptor binding epitopes. The PEGylation sites at position 56 (green) and 96 (blue) are shown in Figure 10 according to the reported crystal structure data (37). The N-terminal residues 1 to 10 including position 2 (magenta) appear to be flexible, since they are not determined by X-ray analysis. For maleimide PEG (Mn ) 5426 Da) taken as an example, the mean-squared end-to-end distance is calculated to be 6.4 nm (38). The circle area with radius of 6.4 nm around the PEGylation site is therefore regarded as the maximal area reached by PEG (olive, attached to Cys 56). Obviously, an attached PEG coil could move freely on the whole

Figure 9. Comparison of the receptor binding of BMP-2 cysteine analogues after mono- and di-PEGylation by Ap1, Ap2, and Ap3. Sensorgrams of BMP-2 proteins at 60 nM concentrations (see Figure 8) were evaluated for maximal binding (Rmax) to ActR-IIB and for the initial on-rate for the binding to BMPR-IA. Values determined for unmodified BMP2WT were taken as 100.


Hu et al.

Figure 10. Surface model of BMP-2 proteins with the PEGylation sites at position 56 (green) and 96 (blue). The N-terminal residues including position 2 (magenta) are flexible and not determined by X-ray analysis. The binding sites for ActR-IIB (yellow) and BMPR-IA (red) are marked, as well as a calculated maximal area reached by maleimide PEG (Mn ) 5426 Da, olive circle) attached to Cys 56.

BMPR-IA (red) and ActR-IIB (yellow) binding epitopes. However, the statistical probability that it blocks the epitopes might be affected by the distance and orientation between the attachment site and the binding epitopes. The flexible N-terminal ends emanate from the middle of the dimeric BMP-2 protein (colored magenta in Figure 10). Therefore, Cys 2 appears to be far away from all receptor binding epitopes. Remarkably, the receptor binding properties of the PEGylated BMP2E96C proteins are similar to those of PEGylated BMP2A2C, in particular, for interaction with ActRIIB. The association rate for the BMPR-IA receptor seems to be affected to a slightly higher extent with this analogue. Cys 96 is located at the tip of finger 2 of the BMP-2 monomers outside but juxtaposed to the receptor binding epitopes. Cys 56 is located between the binding epitopes for ActR-IIB and BMPR-IA. It is therefore not surprising that the affinities for both receptors are reduced to a larger extent than that of the two other modified analogues. However, despite the close proximity to these epitopes a considerable affinity is still retained in the PEGylated BMP2N56C proteins. Remarkably, when Asn 56 of natural BMP-2 is glycosylated the receptor binding affinity is similar to that in the unglycosylated form. In BMP-6, glycosylation of the corresponding Asn side chain is even required for binding of the receptor ActR-IA, but not of receptors BMPR-IA and IB (9). The PEGylation affects the interaction with BMPR-IA to a higher extent than that with ActR-IIB. In particular, the association rate with BMPR-IA is strongly reduced for modified N56C and somewhat less so for the other two analogues. The initial on rates are reduced to 5-15% compared to the wildtype at 60 nM concentration of the di-PEGylated proteins. The particularly strong effect of BMP-2 PEGylation on the association rate with the BMPR-IA receptor might be caused by a direct association of the PEG with the binding epitope. The crystal structure of BMP-2 (19) and other BMP-like proteins (39) showed a bound low-molecular-weight compound (methylpentanediol, dioxan) in the BMPR-IA binding epitope. Possibly, the PEG also interacts weakly with such a site. Furthermore, the BMP-2 epitope shows a pronounced disorder-to-order transition during complex formation with BMPR-IA (40). The attached PEG might interfere with this transition. Both processes

Figure 11. Biological activity of site-specific PEGylated BMP-2 analogues. Dose-dependent induction of alkaline phosphatase in C2C12 cells was determined for (A) BMP2WT and non-PEGylated cysteine analogues, (B) mono-PEGylated, and (C) di-PEGylated BMP-2 analogues. Maleimide PEG was conjugated with the free SH group of the reduced BMP-2 analogues (Ap3). BMP2WT analyzed in parallel served as a reference.

would lower the availability of the free epitope and thus retard association with the receptor. Bioactivity Evaluated by Alkaline Phosphatase Cell Assay. The effects of PEGylation on the biological activity of the BMP-2 cysteine analogues were analyzed in C2C12 cells using BMP2WT and the non-PEGylated analogues as a reference. This assay measures the BMP-2 dependent induction of alkaline phosphatase during a 3-day time period. As discussed above, methods Ap1 and 2 yield disulfide-bonded protein-PEG conjugates, while method Ap3 generates a nonreducible bond between protein and PEG. Because the stability of disulfidebound PEG during this long culture time is unknown, only thiolmaleimide-conjugated BMP-2 proteins were employed. Representative dose-response curves are shown in Figure 11. The non-PEGylated BMP-2 cysteine analogues exhibited 2to 3-fold lower activity than BMP2WT. The dose-response curve was similar for the A2C and E96C analogues. The N56C analogue was the least active. This is comparable to the relative


activities found in the receptor interaction SPR assay (Supporting Information Figure S-2). Remarkably, mono- as well as di-PEGylation at Cys 2 yielded BMP-2 proteins with higher biological activity than the wildtype, indicating that the PEGylation at this site improved the bioactivity of proteins. The N-terminal sequence of BMP-2 contains a heparin binding site, which reduces the specific activity of BMP-2 in cellular assays probably by interacting with heparinic sites in the extracellular matrix (25). It is tempting to speculate that the attached PEG shields the heparin binding site. This would prevent a competitive interaction with the extracellular matrix and thus improve the bioactivity of the PEGylated A2C analogues. Mono-PEGylation at Cys 56 increased and di-PEGylation at Cys 56 decreased the activity compared to the non-PEGylated analogue, suggesting that PEGylation at this site can inhibit and/ or enhance bioactivity. The increased solubility of the PEGylated analogue might enhance activity, but the attached PEG could also interact with the receptor binding site and thereby partially inhibit activity as discussed in the seventh section. It was unexpected that the Cys 96 analogue exhibited reduced activity after mono-PEGylation and a strongly reduced activity after di-PEGylation when compared with the non-PEGylated analogue. This differs clearly from the results of the receptor interaction SPR assay where the PEGylated E96C analogue showed affinities for type I and type II receptors similar to that of the PEGylated A2C analogue (Figure 9). This strongly suggests that PEGylation at Cys 96 has a special effect differing from the effects on receptor interaction or solubility. It is possible, and this remains to be established, that the interaction with modulator proteins or co-receptors, as repulsive guidance molecule-a or betaglycan (41, 42), are affected differently by PEGylation of BMP2A2C and BMP2E96C.

ACKNOWLEDGMENT We thank Christian So¨der for excellent technical assistance and Dr. Joachim Nickel for helpful discussions and suggestion. Supporting Information Available: Additional data associated with this article. Figure S-1 shows mass spectra of NEMlabeled BMP-2 cysteine analogues. Table S-1 shows evaluation of mass spectra of NEM modified BMP-2 cysteine analogues. Table S-2A and S-2B show peptides identified by mass spectrometry after double-digestion of NEM-labeled BMP2N56C and BMP2E96C with Trypsin and GluC. Figure S-2 shows representative sensorgrams for the interaction of 60 nM BMP-2 cysteine analogues in comparison with 60 nM BMP2WT. Table S-3 shows Apparent Rate Constants kon, koff, KD (koff/ kon), and KDeq, of the binding of BMP-2 proteins and PEGylated proteins by Ap3 to ActR-IIB and BMPR-IA. This material is available free of charge via the Internet at http://pubs.acs.org.

LITERATURE CITED (1) Reddi, A. H. (1997) Bone morphogenetic proteins: an unconventional approach to isolation of first mammalian morphogens. Cytokine Growth Factor ReV. 8, 11–20. (2) Reddi, A. H. (1998) Role of morphogenetic proteins in skeletal tissue engineering and regeneration. Nat. Biotechnol. 16, 247– 151. (3) Hogan, B. L. (1996) Bone morphogenetic proteins in development. Curr. Opin. Genet. DeV. 6, 432–438. (4) Seeherman, H., and Wozney, J. M. (2005) Delivery of bone morphogenetic proteins for orthopedic tissue regeneration. Cytokine Growth Factor ReV. 16, 329–345. (5) Robinson, Y., Heyde, C. E., Tschoke, S. K., Mont, M. A., Seyler, T. M., and Ulrich, S. D. (2008) Evidence supporting the use of bone morphogenetic proteins for spinal fusion surgery. Expert ReV. Med. DeVices 5, 75–84.

Bioconjugate Chem., Vol. 21, No. 10, 2010 1771 (6) Kwong, F. N., and Harris, M. B. (2008) Recent developments in the biology of fracture repair. J. Am. Acad. Orthop. Surg. 16, 619–625. (7) Israel, D. I., Nove, J., Kerns, K. M., Moutsatsos, I. K., and Kaufman, R. J. (1992) Expression and characterization of bone morphogenetic protein-2 in Chinese hamster ovary cells. Growth Factors 7, 139–150. (8) Griffith, D. L., Keck, P. C., Sampath, T. K., Rueger, D. C., and Carlson, W. D. (1996) Three-dimensional structure of recombinant human osteogenic protein 1: structural paradigm for the transforming growth factor beta superfamily. Proc. Natl. Acad. Sci. U.S.A. 93, 878–883. (9) Saremba, S., Nickel, J., Seher, A., Kotzsch, A., Sebald, W., and Mu¨ller, T. D. (2008) Type I receptor binding of bone morphogenetic protein 6 is dependent on N-glycosylation of the ligand. FEBS J. 275, 172–183. (10) Veronese, M. F., and Pasut, G. (2005) PEGylation, a successful approach to drug delivery. Drug DiscoVery Today 10, 1451– 1458. (11) Caliceti, P., and Veronese, M. F. (2003) Pharmacokinetic and biodistribution properties of poly(ethylene glycol)-protein conjugates. AdV. Drug DeliVery ReV. 55, 1261–1277. (12) Roberts, M. J., Bentley, M. D., and Harris, J. M. (2002) Chemistry for peptide and protein PEGylation. AdV. Drug DeliVery ReV. 54, 459–476. (13) Kinstler, O., Molineux, G., Treuheit, M., Ladd, D., and Gegg, C. (2002) Mono-N-terminal poly(ethylene glycol)-protein conjugates. AdV. Drug DeliVery ReV. 54, 477–485. (14) Long, D. L., Doherty, D. H., Eisenberg, S. P., Smith, D. J., Rosendahl, M. S., Christensen, K. R., Edwards, D. P., Chlipala, E. A., and Cox, G. N. (2006) Design of homogeneous, monopegylated erythropoietin analogs with preserved in vitro bioactivity. Exp. Hematol. 34, 697–704. (15) Rosendahl, S. M., Doherty, H. D., Smith, J. D., Carlson, J. S., Chlipala, A. E., and Cox, G. N. (2009) A long-acting, highly potent Interferon R-2 conjugate created using site-specific pegylation. Bioconjugate Chem. 16, 200–207. (16) Zappe, H., Snell, M. E., and Bossard, M. J. (2008) PEGylation of cyanovirin-N, an entry inhibitor of HIV. AdV. Drug DeliVery ReV. 60, 79–87. (17) Veronese, M. F., Mero, A., Caboi, F., Sergi, M., Marongiu, C., and Pasut, G. (2007) Site-specific Pegylation of G-CSF by reversible denaturation. Bioconjugate Chem. 18, 1824–1830. (18) Rider, C. C., and Mulloy, B. (2010) Bone morphogenetic protein and growth differentiation factor cytokine families and their protein antagonists. Biochem. J. 429, 1–12. (19) Scheufler, C., Sebald, W., and Hu¨lsmeyer, M. (1999) Crystal structure of human bone morphogenetic protein-2 at 2.7 Å Resolution. J. Mol. Biol. 287, 103–115. (20) Bentz, H., Schroeder, J. A., and Estridge, T. D. (1998) Improved local delivery of TGF-β2 by binding to injectable fibrillar collagen via difunctional polyethylene glycol. J. Biomed. Mater. Res. 39, 539–548. (21) Liu, H. W., Chen, C. H., Tsai, C. L., Lin, I. H., and Hsiue, G. H. (2007) Heterobifunctional poly(ethylene glycol)-tethered bone morphogenetic protein-2-stimulated bone marrow mesenchymal stromal cell differentiation and osteogenesis. Tissue Eng. 13, 1113–1124. (22) Brebda, K., Mann, R., Schmedlen, H., and West, J. L. (2001) Tethered-TGF-β increases extracellular matrix production of vascular smooth muscle cells. Biomaterials 22, 439–444. (23) Sebald, W., Nickel, J., Zhang, J., and Mu¨ller, T. D. (2004) Molecular recognition in bone morphogenetic protein (BMP)/ receptor interaction. Biol. Chem. 385, 697–710. (24) Allendorph, G. P., Vale, W. W., and Choe, S. (2006) Structure of the ternary signaling complex of a TGF-β superfamily member. Proc. Natl. Acad. Sci. U.S.A. 103, 7643–7648. (25) Ruppert, R., Hoffmann, E., and Sebald, W. (1996) Human bone morphogenetic protein 2 contains a heparin-binding site which modifies its biological activity. Eur. J. Biochem. 237, 295– 302.

1772 Bioconjugate Chem., Vol. 21, No. 10, 2010 (26) Groppe, J., Rumpel, K., Economides, A. N., Stahl, N., Sebald, W., and Affolter, M. (1998) Biochemical and biophysical characterization of refolded Drosophila DPP, a homolog of bone morphogenetic protein 2 and 4. J. Biol. Chem. 273, 29052–29065. (27) Woghiren, C., Sharma, B., and Stein, S. (1993) Protected thiolpolyethylene glycol: A new activated polymer for reversible protein modification. Bioconjugate Chem. 4, 314–318. (28) Laemmli, U. K. (1970) Cleavage of structural proteins during the sssembly of the head of bacteriophage T4. Nature 227, 680– 685. (29) Kirsch, T., Nickel, J., and Sebald, W. (2000) BMP-2 antagonists emerge from alterations in the low-affinity binding epitope for receptor BMPR-II. EMBO J. 19, 3314–3324. (30) Riordan, J. F., and Vallee, B. L. (1972) Reactions with N-ethylmaleimide and p-mercuribenzoate. Methods Enzymol. 25, 449–456. (31) Yang, Z., and Attygalle, A. B. (2007) LC/MS characterization of undesired products formed during iodoacetamide derivatization of sulfhydryl groups of peptides. J. Mass Spectrom. 42, 233– 243. (32) Jones, M. D., Merewether, L. A., Clogston, C. L., and Lu, H. S. (1994) Peptide map analysis of recombinant human granulocyte colony stimulating factor: elimination of methionine modification and nonspecific cleavages. Anal. Biochem. 216, 135–146. (33) Pellaud, J., Schote, U., Arvinte, T., and Seelig, J. (1999) Conformation and self-association of human recombinant transforming growth factor-b3 in aqueous solutions. J. Biol. Chem. 274, 7699–7704. (34) Kubetzko, S., Balic, E., Waibel, R., Zangemeister-Wittke, U., and Plu¨ckthun, A. (2006) PEGylation and multimerization of the anti-p185HER-2 single chain Fv fragment 4D5: effects on tumor targeting. J. Biol. Chem. 281, 35186–35201.

Hu et al. (35) Heinecke, K., Seher, A., Schmitz, W., Mu¨ller, T. D., Sebald, W., and Nickel, J. (2009) Receptor oligomerization and beyond: a case study in bone morphogenetic proteins. BMC Biol. 7, 59. (36) Weber, D., Kotzsch, A., Nickel, J., Harsh, S., Seher, A., Mu¨ller, U., Sebald, W., and Mu¨ller, T. D. (2007) A silent H-bond can be mutationally activated for high-affinity interaction of BMP-2 and activin type IIB receptor. BMC Struct. Biol. 7, 6. (37) Keller, S., Nickel, J., Zhang, J. L., Sebald, W., and Mu¨ller, T. D. (2004) Molecular recognition of BMP-2 and BMP receptor IA. Nat. Struct. Biol. 11, 481–488. (38) Knoll, D., and Hermans, J. (1983) Polymer-protein interactions: comparison of experiment and excluded volume theory. J. Biol. Chem. 258, 5710–5715. (39) Mittl, P. R. E., Priestle, J. P., Cox, D. A., Mcmaster, G., Cerletti, N., and Gru¨tter, M. G. (1996) The crystal structure of TGF-β3 and comparison to TGF-β2: Implications for receptor binding. Protein Sci. 5, 1261–1271. (40) Klages, J., Kotzsch, A., Coles, M., Sebald, W., Nickel, J., Mu¨ller, T., and Kessler, H. (2008) The solution structure of BMPR-IA reveals a local disorder-to-order transition upon BMP-2 binding. Biochemistry 47, 11930–11939. (41) Wiater, E., and Vale, W. (2003) Inhibin is an antagonist of bone morphogenetic protein signaling. J. Biol. Chem. 278, 7934– 7941. (42) Xia, Y., Yu, P. B., Sidis, Y., Beppu, H., Bloch, K. D., Schneyer, A. L., and Lin, H. Y. (2007) Repulsive guidance molecule RGMa alters utilization of bone morphogenetic protein (BMP) type II receptors by BMP2 and BMP4. J. Biol. Chem. 282, 18129–8140.

BC9005706

Site-Specific PEGylation of Bone Morphogenetic Protein-2 Cysteine

Recommend Documents