Sodium Channel Point Mutations Associated with Pyrethroid

Chapter 20

Downloaded by UNIV OF GUELPH LIBRARY on September 7, 2012 | http://pubs.acs.org Publication Date: March 8, 2005 | doi: 10.1021/bk-2005-0899.ch020

Sodium Channel Point Mutations Associated with Pyrethroid Resistance in the Head Louse, Pediculus humanus capitis 1

2

3

Takashi Tomita , Noboru Yaguchi , Minoru Mihara , Noriaki Agui , and Shinji Kasai 1

1

1

Department of Medical Entomology, National Institute of Infectious Diseases, Toyama 1-23-1, Shinjuku-ku, Tokyo 1628640, Japan Toshima City Ikebukuro Health Center, Higashi-Ikebukuro 1-20-9, Toshima-ku, Tokyo 170-0013, Japan Japan Environmental Sanitation Center, Yotsuya-Kamimachi 10-6, Kawasaki, Kanagawa 210-0828, Japan 2

3

The problem of pyrethroid-resistance in the head lice is growing worldwide and an insensitive sodium channel is suspected as the major mechanism of this resistance. We established an acute toxicity test with a limited number of louse sample to discriminate pyrethroid resistance and analyzed an ORF encoding for thepara-orthologoussodium channel from an insecticide-susceptible strain of the body louse. Phenothrin-susceptible and -resistant head louse colonies from Japan were individually analyzed for point mutations of the sodium channel cDNA; The resistant head lice shared 23 base substitutions homozygously, in which four resulted in amino acid substitutions: D11E in the N-terminal inner-membrane segment; M850T in the outer-membrane loop between DII S4 and S5; T952I and L955F in DII S5.

234

© 2005 American Chemical Society In Environmental Fate and Safety Management of Agrochemicals; Clark, J., et al.; ACS Symposium Series; American Chemical Society: Washington, DC, 2005.


235 Head louse infestations in school children are a difficult public health problem in many countries, irrespective of the socioeconomic status of those infested (1). Disease transmission by head lice has not been reported, however, the putative conspecific body louse, Pediculus humanus humanus> transmits typhus, trench fever, and relapsing fever infested (1) and the potential vectorial role of head lice should be considered. Pediculicides used worldwide have changed from DDT and lindane, to carbaryl and malathion, and subsequently to the pyrethroids, in the interests of human safety and increased efficacy. In the last two decades pyrethroids such as permethrin and phenothrin were the most popular pediculicides where available (1). However, control failures with pyrethroids due to resistance is a concern in many developed and developing countries (2, 3, 4, 5, 6, 7). The voltage-sensitive Na channels contain integral membrane proteins responsible for the generation of action potentials in excitable cells and it is the neuronal target of DDT and pyrethroid insecticides (8). +

C810>R 0. melanogaster

M933 > 1 Housefly Hornfly +

Figure 1. Resistance-associated structural changes of pam-orthologous Na channel in insects. +

Resistance showing reduced sensitivity of the Na channel was first described as knockdown-resistance (kdr) in the house fly, Musca domestica (9). Kdr is a major mechanism of DDT- and pyrethroid-resistance in a number of insects with medical and agricultural importance (10, 11). A point mutation in para-orthologous voltage-sensitive Na channel α-subunit gene is the mechanism of kdr. Typical kdr mutations are kdr (L1014F) occurring at the trans-membrane segment 6 of domain II (DU S6) and super-kdr (M918T) appearing at DU S4-5 intracellular loop in the house fly (12, 13). The Wr-type (and -subtype) mutations were found in resistant strains of another 7 species (13, +

In Environmental Fate and Safety Management of Agrochemicals; Clark, J., et al.; ACS Symposium Series; American Chemical Society: Washington, DC, 2005.


236 14, 15, 16, 17, 18, 19) and seem to be ubiquitous among pyrethroid-resistant insects, while the super-kdr-type mutation was identified in a resistant strain of the horn fly, Haematobia irritans (18). However, phenotypically kdrAike (that is atypical) mutations which are also specifically associated with pyrethroidresistance but non-homologous to either kdr or super-kdr site have been identified. Those mutations were, for example, found at four sites in Drosophila melanogaster (20, 21), at two homologous sites each in two Heliothine lepidopterans (22), and at two sites in the German cockroach, Blattella germanica (23). The roles of those mutations for sensitivity-reducers have not been experimentally confirmed. Another kdr-like mutation, V421M (numbering in D. melanogaster para) occurring at DI S6, from the tobacco budworm, Heliothis virescens (19), was functionally expressed by in vitro mutagenesis and heterologous expression and its contribution to nerve insensitivity was electrophysiologically exemplified (24). Resistance-associated sodium channel structural changes in insects are shown in Figure 1.

Year

Figure 2. Fluctuation of head lice infestations reported by the Ministry of Health and Welfare. +

Reduced Na channel sensitivity in pyrethroid-resistant head lice was first suggested by Hemmingway et al. (25). In pyrethroid-resistant head louse colonies from the US and the UK, resistance-specific two concomitant amino acid substitutions were commonly identified as kdr-like mutations at DU S5 of para Na channel (26). Their analysis was based on a partial cDNA sequence of as many as 132 amino acid residues including DU S5 and S6. Analysis of the whole coding sequence is a prerequisite for the development of molecular diagnosis or the study of the genetic origins of kdrAike mutations in head lice. DDT was successfully used for controlling head lice in Japan after WWII and pediculosis greatly decreased in the 1950s. The incidence increased dramatically in the 1970s, and government surveillance initiated in 1981 recorded 24,000 cases in 1982 (27). With phenothrin as the sole registered +


237


pediculicide since 1981, cases declined to ca. 2,000 annually in the late 1980s. However, there was an increase to 10,000 cases in 1999 when surveillance ended (Figure 2). The official incidence estimates seem to have underestimated the actual levels, thought to be 10-fold higher, in light of the amount of phenothrin powder and shampoo shipped in 1999 (520,000 units; Sumitomo Pharmaceuticals Co., Ltd., personal communications). The efficacy of phenothrin pediculicides has not been re-evaluated and the cause of the recent increases in pediculosis in Japan is still not known. We started to evaluate the susceptibility of head lice to phenothrin in Japan in 2001 and first identified the presence of the resistant head louse colonies in Japan.

Susceptibility to Phenothrin In order to establish a simplified bioassay method with head lice, knockdown ratios in response to phenothrin concentrations was analyzed, in changing treatment hours by the method of continuous contact of lice with insecticide-impregnated filter paper (28). We used the long-established insecticide-susceptible strain of body louse, NIID, as a reference. Figure 3A shows that phenothrin effectively knocked down adult body lice after 3 hours treatment. Similar result was obtained from 1st instar nymphs, though knock down speed was relatively low (Figure 3B).

Phenothrin concentration (mg/m filter paper) 2

Phenothrin concentration (mg/m filter paper) 2

Figure 3. Knockdown rates in response to phenothrin concentrations using adult (A) and 1st instar (Β) body lice. Using the rapid toxicity of phenothrin to adult body lice, we established a short-time bioassay method for head lice. Since KG» of the susceptible body lice (after 3 hours treatment) was 54 mg/m (Table 1), we set a diagnostic phenothrin concentration at 100 mg/m filterpaper. When a louse is alive at 100 mg/m , the louse is evaluated as a resistant. Since the KC of the susceptible body lice was 20 mg/m , a resistance-ratio (RR) of the louse alive at 100 mg/m 2

2

2

X

2


2

238 can be estimated at least as 5-fold as compared to the susceptible strain. This simplified method enabled us to estimate minimum resistance-ratios with small numbers of head lice.

Table 1. Susceptibility of insecticide-susceptible body lice to phenothrin

Stage of lice

Treatment

Regression line

KC value (95% CL) in mg/m KC, = 27 (22-31) = 52 (48-55) £(7,, = 97 (86-117) KC, = 22 (18-24) KC = 34 (32-26) £ C = 53 (47-64) KC = 20 (17-22) K C = 33 (32-35) KC„ = 54 (48-66) * C , = 22 (19-23) * C = 31 (30-32) KG» = 44 (40-51) 2


1st instar nymphs

3 hrs

/*=β.43ΑΜ4.4

24hrs

Λ=12.0Α-18.3

X

99

3 hrs

Adults

Ρ=10.8*-16.5

X

50

24 hrs

Ρ=\5ΛΧ-22.5

S 0

a

b

#C, knockdown concentration, a theoretical concentration at a knockdown percentage. Λ probit. X, logarithm of phenothrin concentration in mg/m C

2

We investigated the phenothrin-susceptibility of the head lice collected in Japan, by the simplified bioassay method. Head lice were obtained from dermatologists in Tokyo metropolitan area (Tokyo, Saitama and Kanagawa prefectures) and used for bioassay. Diagnostic phenothrin concentrations were set as 100,400, 800, 1,600 and 3,200 mg/m . Three out often colonies survived at these diagnostic concentrations (>= 100 mg/m ) so that they are judged as resistant colonies (Figure 4). The two of three resistant colonies (Rl and R2) were collectedfromschoolchildren living in the same city. These two colonies may be originated from same ancestor. Another resistant colony (R3) was collected from a 88 years old British female. She noticed the head lice infestation just after 1-month trip from UK suggesting high possibility of resistant head lice transported from outside of the country. Since 7/10 colonies showed high susceptibility to phenothrin, it seems that recent increasing of head lice infestations is not only due to development of insecticide resistance. 2

2


239 Head louse colonies •

Alive

(= Resistant) •9 •1 x1

#1


W1

"3 4-1

·1 x1

•!

• 1

*1 +1

1M

41

Knockdown

Sep 25,2001: #R1

* Oct 12,2001: «S1 1

#S2 #R2 #R3 #S3

• • •

Oct24.20oi: Dee 12,2001: Dec 20, 2001: Feb 04,2002:

χ

Feb 07,2002: #S4

* ν

Feb 20,2002: #S5 Mar 06,2002: #S6

+ Mar 15.2002: #S7

Figures above and below the scale that shows phenothrin concentration indicate the numbers of lice tested at respective concentrations

Figure 4. Phenothrin susceptibilities of head louse colonies.

Resistance-Associated Mutations To determine the lice sodium channel cDNA sequence, we conducted two rounds of primer walking using the long established body louse strain, NIID. The primary round was based on RT-PCR using mainly degenerate primers and some previously reported GSPs and then RACEs. As a result, 6,521 bases of cDNA (GenBank #AB090951) including an ORF encoding 2,086 amino acids werefirstdetermined by Tomita et al. (29). Adultsfromthe NIID body louse strain and the five head louse colonies (SI, S2, Rl-3; see Figure 4) were individually analyzed for the sodium channel cDNA. The analysis covered the base# 100-6401 segment including the complete coding sequence, except for R3 lice that mainly covered the domain II. All the lice tested were deduced to be homozygous for the sodium channel gene from the results of direct sequencing. Totally 24 base substitutions were identified among the NIID body lice and the head louse colonies tested (Figure 5). There were two base substitutions (0.016%) between SI (or S2) and NIID lice, and 23 base substitutions (0.36%) between Rl (or R2) and NIID lice, in the 6302 bases analyzed. Only allelic levels of differences were present between the two sibling louse species. The partially analyzed cDNA sequences from phenothrin-resistant R3 lice completely coincided with those from R l and R2 lice, as they were classified by phenothrin-susceptibility. 20 out of 24 bases were synonymous substitutions. The other four resulted in amino acid substitutions and they all associated with the resistant head lice. No amino acid substitution was detected in susceptible SI and S2 head lice.



240 The four amino acid substitutions associated with phenothrin-resistant R l head lice were (i) D l IE in the N-terminal inner-membrane segment, (ii) M850T in the outer-membrane loop between the trans-membrane segments 4 and 5 of domain II, and (iii) T952I and (iv) L955F in the trans-membrane segment 5 of domain II (Figure 1). The former two substitutions were first identified. The latter two substitutions were the same as those commonly discovered from pyrethroid-resistant head lice in the US and UK (25). Interestingly, the resistant head louse colony, R3, was collected in Japan from a British woman who was long stayed in Japan. She retimed her homeland to spend for a month, and soon after she came back to Japan she realized head irritation. This colony completely shared 9 base substitutions (and as a consequent also M850I, T952I, and L955F) with R l , within currently available cDNA sequence (base# 17803451). The genetic origin descended to R l and R3 should be further studied. Colony «

RR

A«P 11 Glu

val 143

Ala 235

Lau 328

Aap 363

Ala 442

Arg 461

Arg 481

Sar 489

Sar 518

Arg 596

Arg 697

GAT

GTA

GCC

CTG

GAT

GCC

AGA

AGA

TCA

TCT

CGC

AGG

NIID 51 52 Rl R2 R3

» X20 >• X80 » X160

. .A

Colony «

RR

Thr 766

Val 805

Nat 850 lie

Tar 952 Urn

Lau Sar 955 1012 Phm

Lau 1046

Oly 1120

Gly 1231

Pha 1275

Ala 1376

Pha 1749

ACA

GTT

ΑΤβ

ACA

CTT

TCT

TTO

GOT

GGA

CCG

GCC

TTT

MID 51 52 R1 R2 R3

-

>= X20 >= X80 >= X160

c.. +

Figure 5. Base substitutions in louse Na channel cDNA. The resistance-associated four amino acid substitutions of the louse sodium channel are located to some extent in evolutionarily conserved regions among insect species. D U E may have the least significance for pyrethroid-insensitivity, because of the common acidic nature and evolutionary vulnerability between Asp and Glu. It is difficult to evaluate the significance of M850T, which is the first report for a resistant-associated substitution put in outer-membrane loop among the insect species studied, even though the M850 position is conserved at least in 7 susceptible insects. The T952I and L955F positions are located in the highly conserved DIIS5 trans-membrane segment. As for L955F, an analogous contribution to insensitivity is speculated by Lee et al (25) due to its close proximity to the DIIS6 Leu position in which the kdr-type Leu to Phe substitution occurring in many pyrethroid-resistant pests. The T952I substitution


241 was shared by pyrethroid-resistant diamondback moth (15) and thus the substitution may be potentially involved in pyrethroid-insensitivity of head lice sodium channel. We designed TaqMan probes in order to preliminary demonstrate molecular diagnosis of pyrethroid-resistance associated Na channel gene of head lice (Figure 6). The results successfully discriminated possible three genotypes for T952I. +

0.9 I

y

M/M CM

Wild-typ* Probe

0.8

Mutant Probe

(br Ail


H

(-575

f

il i

FAM-ATGTTAAATTACCCAAAGCTCCAA TiutRtd-ATATTAAATTACCCAAAGCTCCAA

mer

ATTTCAATTATGGGTCGAACT

ner

GCAAATATGAATATGATAATGCAA

0.7

0.6

W+M

\

0.3

•:yv/yvg Normalized RRJ for Allele 1 FAM-490

Figure 6. Discrimination ofNa* channel genotypes.

Perspective The present study was dependent on the evaluation of insecticidesusceptibility with live lice and the subsequent individual-genotyping of the Na+ channel gene. Such work is costly and time-consuming because live lice have to be bioassayed on the day of collection due to low viability after removal from the host, limited availability of human volunteers, and the lack of effective alternative blood feeding systems. Cumulative information on resistanceassociated representative Na channel gene haplotypes by such a basic study and experimental confirmations of insensitive-responsible mutations are prerequisite to make molecular diagnosis of pyrethroid-resistance possible from dead lice. PCR-based high throughput systems for single nucleotide polymorphisms (SNP)typing would facilitate further studies on the origins or migrations of the lice resistant Na+ channel genes worldwide as well as on thefrequencydistribution of presumed recessive resistant genes. Such works should also be a remedy for resistant infested dermatology patients against overuse of inefficacious pediculicides when the resistant diagnostic system is timely linked to a medical examination. Recent reports of pyrethroid-resistant in lice demonstrate the need for the development of novel pediculicides. 4


242

Conclusion Pyrethroid-resistance of head lice was discriminated with phenothrin at 100 mg/m by the method of continuous contact of insecticide-impregnated filter paper for 3 hours. We first identified pyrethroid-resistant head lice colonies in Japan. Pyrethroid pediculicides seemed to be out of use for the resistant colonies, however, the resistance has not been an overwhelming majority in Tokyo metropolitan area. The complete coding sequence of para-orthologous Na channel was determined in the head louse and resistance-associated four amino acid substitutions were commonly identified in the Na channel from the three resistant colonies tested. 2


+

+

Acknowledgements We thank Tsuchiya, T., Mizushima, J., and a number of dermatologists for providing live lice, Ishii, N., for coordinating lice-sampling from medical facilities, and Sumitomo Chemical Co., Ltd. for providing pediculicide-shipping information and phenothrin.

References 1. Gratz, N. G.: WHOPES, CTD, WHO, Geneva, Switzerland, 1997. 2. Coz, J.; Combescot-Lang, C.; Verdier, V: Bull. Soc. Fra. Parasitol. 1993, 11, 245-252 (in French). 3. Mumcuoglu, Κ. Y.; Hemingway, J.; Miller, J.; Ioffe-Uspensky, I.; Klaus, S.; Ben-Ishai, F.; Glaun, R: Med. Vet. Entomol. 1995, 9, 427-432. 4. Burgess, I. F.; Brown, C. M.; Peock, S.; Kaufman, J.: Brit. Med. J. 1995 311, 752. 5. Rupes, V.; Moravec, J.; Chmela, J.; Ledvinka, J.; Zelenkova, J.: Centr. Eur. J. Pub. Health 1995, 3, 30. 6. Picollo, M . I.; Vassena, C. V.; Casadio, Α. Α.; Massimo, J.: J. Med. Entomol. 1998, 35, 814-817. 7. Pollack, R. J.; Kiszewski, Α.; Armstrong, P.; Hahn C.; Wolfe, N.; Rahman, Η. Α.; Laserson, K.; Telford III, S. R.; Spielman, A: Arch. Pediatr. Adlesc. Med. 1999, 153, 969-973.


243


8.

Gordon, D.; Moskowitz, H.; Zlotkin, E.: Arch. Insect. Biochem. Physiol. 1993, 22, 41-53. 9. Farnham, A. W.: Pestic. Sci. 1977, 8, 631-636. 10. Oppenoorth, F. J.: Biochemistry and genetics of insecticide resistance, pp. 731-773. In G.A. Kerkut and L.I. Gilbert [eds], Comprehensive insect physiology. Pergamon, Oxford, 1985. 11. Soderlund, D. M.: pp 21-56. In Sjut V. [ed], Molecular mechanisms of resistance to agrochemicals. Springer Verlag, Berlin, 1997. 12. Williamson, M. S.; Martinez-Torres, D.; Hick, C. Α.; Devonshir, A. L.: Mol. Gen. Genet. 1996, 252, 51-60. 13. Miyazaki, M.; Ohyama, K.; Dunlap, D. Y.; Matsumura, F.: Mol. Gen. Genet. 1996, 252, 61-68. 14. Lee, S. H.; Dunn, J. B.; Clark, J. M.; Soderlund, D. M.: Pestic. Biochem. Physiol. 1999, 63, 63-75. 15. Martinez-Torres, D.;, Devonshire, A. L.; Williamson, M . S.: Pestic. Sci. 1997, 51, 265-270. 16. Martinez-Torres, D.; Chandre, F.; Williamson, M . S.; Darriet, F.; Berge, J. B.; Devonshire, A. L.; Guillet P.; Pasteur, N.; Pauron, D.: Insect Mol. Biol. 1998, 7, 179-184. 17. Martinez-Torres, D.; Foster, S. P.; Field, L. M.; Devonshire, A. L.; Williamson, M. S.: Insect Mol. Biol. 1999, 8, 339-346. 18. Guerrero F. D.; Jamroz, R. C.; Kammlah, D.; Kunz, S. E.: Insect. Biochem. Mol. Biol. 1997, 27, 745-55. 19. Park, Y.; Taylor M. F.: Insect Biochem. Mol. Biol. 1997, 27, 9-13. 20. Pittendrigh, B.; Reeman, R.; ffrench-Constant, R. H.; Ganetzky, B.: Mol. Gen. Genet. 1997, 256, 602-610. 21. Martin, R. L.; Pittendrigh, B.; Liu, J.; Reenan R.; ffrench-Constant, R.; Hanck, D. Α.: Insect Biochem. Mol. Biol. 2000, 30, 1051-1059. 22. Head, D. J.; McCaffery, A. R.; Callaghan, Α.: Insect Mol. Biol. 1998, 7, 191-196. 23. Liu, Z.; Valls, S. M.; Dong, K.: Insect. Mol. Biol. 2000, 30, 991-997. 24. Lee, S. H.; Soderlund, D. M.: Insect Biochem. Mol. Biol. 2001, 31, 19-29. 25. Hemmingway, J.; Miller, J.; Mumcuoglu, Κ. Y.: Med. Vet. Entomol. 1999, 13, 89-96. 26. Lee, S. H.; Yoon, K.-S.; Williamson, M. S.; Goodson, S. J.; Takano-Lee, M.; Edman, J. D.; Devonshir, A. L.; Clark, J. M.: Pestic. Biochem. Physiol. 2000, 66, 130-143. 27. Agui, N.: Seikatsu To Kankyo, 1999, 44, 18-22. (in Japanese) 28. Kasai, S.; Mihara, M.; Takahashi, M.; Agui, N.; Tomita, T.: Med. Entomol. Zool. 2003, 54, 31-36. 29. Tomita, T.; Yaguchi N.; Mihara M.; Takahashi M.; Agui, N.; Kasai, S.: J. Med. Entomol. 2003, 40, 468-474.


Sodium Channel Point Mutations Associated with Pyrethroid

Recommend Documents