Solid-Phase NASBA and Length-Scale Effects during RNA

Subscriber access provided by University of Chicago Library

Solid-Phase NASBA and Length-Scale Effects during RNA Amplification. Youlong Ma, Feiyue Teng, and Matthew R Libera Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.8b00058 • Publication Date (Web): 13 Apr 2018 Downloaded from http://pubs.acs.org on April 14, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 10 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Solid-Phase NASBA and Length-Scale Effects during RNA Amplification. Youlong Ma,† Feiyue Teng, and Matthew Libera* Department of Chemical Engineering and Materials Science, Stevens Institute of Technology, Hoboken, New Jersey 07030 ABSTRACT: Solid-phase oligonucleotide amplification is of interest because of possible applications to next-generation sequencing, multiplexed microarray-based detection, and cell-free synthetic biology. Its efficiency is, however, less than that of traditional liquid-phase amplification involving unconstrained primers and enzymes, and understanding how to optimize the solidphase amplification process remains challenging. Here we demonstrate the concept of solid-phase nucleic acid sequence based amplification (SP-NASBA) and use it to study the effect of tethering density on amplification efficiency. SP-NASBA involves two enzymes - avian myeloblastosis virus reverse transcriptase (AMV-RT) and RNase H - to convert tethered forward and reverse primers into tethered double-stranded (ds) DNA bridges from which RNA- amplicons can be generated by a third enzyme, T7 RNA polymerase. We create microgels on silicon surfaces using electron-beam patterning of thin-film blends of hydroxyl-terminated and biotin-terminated poly(ethylene glycol) [PEG-OH, PEG-B]. The tethering density is linearly related to the PEG-B concentration, and biotinylated primers and molecular-beacon detection probes are tethered to streptavidin-activated microgels. While SP-NASBA is very efficient at low tethering densities, the efficiency decreases dramatically with increasing tethering density due to three effects: (a) a reduced hybridization efficiency of tethered molecular-beacon detection probes; (b) a decrease in T7 RNA polymerase efficiency; and (c) inhibition of T7 RNA polymerase activity by AMV-RT.

Not long after the development of solution-based DNA amplification – the polymerization chain reaction (PCR) – this process was integrated with solid surfaces.1-3 So-called solidphase PCR (SP-PCR) binds either or both of the two PCR primers to a solid support. Ultimately, the process can lead to primer extension, to unbound amplicons able to freely diffuse into the surrounding medium, or to both. The solid-phase approach in various forms continues to be of interest for nextgeneration sequencing 4,5 and for detection.6-10 Significantly, localizing primers to surfaces largely eliminates possibilities for primer-dimer formation, and SP-amplification thus continues to garner interest in areas related to increasing the multiplexing of advanced diagnostic assays.6 Despite its attractiveness, SP-PCR is relatively inefficient.11 Oligonucleotides, both probes and primers, can interact nonspecifically with surfaces. Such interactions can affect their hybridization.12,13 In addition, PCR heating cycles can cause tethering instabilities, which are absent in solution-based PCR amplification, and can lead to a loss of primer from a surface.1 Surface-tethered primers must furthermore interact under constraints not present in a fully solution-based amplification process.14 For example, inhibited enzyme action can occur when one or more oligonucleotide targets or amplification enzymes have radii of gyration comparable to the spacing between tethered primers.3 Similarly, masking can occur when the length and conformation of an extended primer is such that it encroaches on the space above adjacent as-tethered primers and consequently inhibits necessary primer-enzyme and primer-primer interactions.11 Such close proximity also enables partial hybridization of amplicons to both as-tethered and extended primers, a process that

effectively removes both primers from the reaction.11,15 Notably, amplification converts single-stranded (ss) DNA into ds-DNA, and this process is accompanied by a significant increase in persistence length. Requiring the ds-DNA to be rigidly tethered at each end imposes substantial elastic and entropic constraints on the ss-to-ds conversion process.3 More generally, surface tethering introduces length-scale effects absent from solution-based amplification processes. These are often referred to as crowding, confinement, or proximity phenomena. They have been studied in the context of oligonucleotide hybridization in microarrays and solidphase detection platforms.16-19 More recent work has addressed the additional complications introduced by solidphase amplification. Kim et al.,14 for example, used coneshaped dendron molecules to define specific distances, varying from about 1 nm to 6 nm, between tethering sites on a surface and showed that the elongation of separated primers was more efficient than that on a fully saturated surface. They attributed the difference to polymerase access to the various surfaces. Chudinov et al.20 used carbodiimide chemistry to bind primers to agarose beads as part of a bridge-amplification assay where the surface density of tethered primers was controlled by varying the concentration of primers in the loading solution. They showed that the ability to detect mutations within cancer-associated genes decreased as the tethering density increased. Similarly, Chin et al.6 spotted primer arrays using different primer concentrations in the spotting solution followed by UV crosslinking. They reported an optimum tethering density of 149,000/µm2, above which the signal-tonoise ratio decreased. They attributed this effect to crowdinginduced failure to elongate a fraction of the tethered primers.

ACS Paragon Plus Environment

Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

We have used an alternate method with which to control the density of oligonucleotide tethering sites. We create poly(ethylene glycol) [PEG] microgels produced by electronbeam crosslinking PEG thin films cast on solid substrates.21,22 Microgels made from PEG with biotin endgroups can be activated with streptavidin, and biotinylated oligonucleotides can then be tethered to the highly hydrated outermost portions of the microgels. The tethering density can be controlled using precursor thin films comprising miscible homopolymer blends of biotin-terminated PEG (PEG-B) and hydroxylterminated PEG (PEG-OH).23 Precursor films made from pure PEG-OH present no tethering sites and resist nonspecific protein adsorption.21,22 There is a linear increase in tethering density as PEG-B is blended into PEG-OH reaching a maximum density of just under 50,000/µm2 for pure PEG-B (5 kDa Mw precursor).24 The liquid-like environment of the microgel surface enables tethered molecular beacon (MB) detection probes to function very effectively,24 but their hybridization efficiency decreases at high tethering densities.25 Here we extend the microgel tethering concept to include not only MB detection probes but also amplification primers. More specifically, we demonstrate the concept of solid-phase (SP) NASBA (nucleic acid sequence-based amplification26) by

Page 2 of 10

tethering the forward (P1) and reverse (P2) amplification primers (Figure 1) while leaving the three NASBA enzymes AMV-RT, RNase H, and T7 RNA polymerase - free in solution. During the SP-NASBA initiation phase, target RNA+ hybridizes to tethered P1. The hybridized primer is extended by AMV-RT, and the RNA+ is then removed by RNase H activity. The free end of the extended P1 hybridizes to an adjacent tethered P2, and P2 is extended by AMV-RT to form a ds-DNA (double-stranded DNA) bridge tethered at each end to the microgel. T7 RNA polymerase then produces RNA- amplicons from the bridge. These amplicons can bind to adjacent MB detection probes. They can also bind to tethered P2 and thus enter the cyclic portion of the SPNASBA reaction (Figure S1), which again produces tethered ds-DNA bridges that in turn generate more RNA- amplicons. Our approach to SP-NASBA tethers both primers and is thus differentiated from that of Morris and Harris27 who tether only P1. After establishing the tethered-primer SP-NASBA process, we use microgels with varying tethering-site densities to explore how length-scale effects influence this solid-phase amplification process. We vary the tethering density across length scales that include ones comparable to the sizes of the oligonucleotide probes, primers, amplicons, and enzymes. Using a simplex assay for gram-positive bacterial RNA,25,28 we demonstrate a working model of SP-NASBA and show that its efficiency decreases as the tethering density increases. By isolating particular portions of the SP-NASBA process using preformed ds-DNA bridges or preformed primer-DNA partial bridges, we isolate the effects of individual enzymes and enzyme-enzyme interactions.

EXPERIMENTAL SECTION

Figure 1. SP-NASBA. (A) Biotinylated forward (P1) and reverse (P2) primers and Molecular Beacon (MB) detection probes are tethered to the highly hydrated outer portions of a streptavidin-activated microgel. (B) Target RNA+ binds to tethered P1. (C) The SP-NASBA process produces a dsDNA bridge tethered at each end from which RNA- amplicons are generated.

Surface-patterned microgels were prepared using established methods.21,22,24 Single-crystal Si substrates were cleaned in fresh piranha solution (3:1 mixture of concentrated sulfuric acid and 30% hydrogen peroxide; this solution is extremely reactive and potentially explosive. Great care and personal protection should be used.) for 20 min, rinsed 3 times using type 1 deionized (DI) water, and sonicated in DI water (10 min). The substrates were dried with flowing N2 and exposed to an oxygen plasma for 6 min. Thin polymer films were spin cast onto these substrates using a 2 wt% precursor solution of PEG dissolved in tetrahydrofuran (THF). We used mixtures of PEG homopolymer with either biotin endgroups (PEG-B, 5 kDa, CreativePEGworks) or hydroxyl endgroups (PEG-OH, 6 kDa, Sigma Aldrich). Thin films were cast from solutions ranging from 0 - 100 wt% PEG-B by dropping 50 µl of precursor solution onto a spinning (3250 rpm) Si substrate. After solvent evaporation the resulting films were typically 70-80 nm thick. E-beam patterning used a Zeiss Auriga fieldemission gun (FEG) scanning electron microscope (SEM) with an electrostatic beam-blanking system and a Nanometer Pattern Generation System (NPGS, Nabity). The NPGS enabled control of inter-pixel spacing and electron dose. The patterning here used a focused beam of 2 keV electrons with an inter-pixel spacing of 3 µm and a point dose of 10 fC. Prior to oligonucleotide tethering, the biotinylated microgels were activated with streptavidin (SA; Thermo Scientific; 200 µg/mL) in phosphate buffered saline (PBS; 100 mM sodium phosphate, 150 mM sodium chloride, pH 7.2) for 2 h at room


Page 3 of 10 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


temperature. Excess SA was removed by washing in PBS with 0.02% Tween 20 (v/v), twice in Tween-free PBS (5 min), and finally in DI water. The substrates were dried using flowing N2. We have shown previously that the density of SA sites - the tethering-site density - on a 100 wt% PEG-B microgel is 46,900/µm2.24 This corresponds to one tethering site in an area of ~ 21 nm2. Diluting the PEG-B concentration with PEG-OH linearly decreases the tethering-site density.23 We estimate, for example, that the tethering-site density in a 10 wt% PEG-B microgel is 4690/µm2 with one tethering site on average in an area of about 213 nm2.

Oligonucleotide tethering was performed by depositing 20 µL of a 1 µM oligonucleotide solution in 0.1xPBS onto an SAactivated substrate for 1 h at room temperature under saturated humidity. All of the present experiments used oligonucleotide solutions with molecular beacons and primers in a MB:P1:P2 molar ratio of 50:25:25. Table 1 summarizes the structure of the two primers and the molecular beacon. These were designed to amplify and detect gram-positive bacteria.25,28 After the tethering process, the functionalized microgel samples were washed twice using 0.1xPBS, rinsed with DI water, and dried using flowing N2.

Table 1. Oligonucleotide sequences for amplifying/detecting gram-positive bacteria (see Zhao et al.x and Ma et al.y).a, b, c Name

Function

Sequence

P1

Solid-phase Primer 1

5’BiotinTEG//iSp9/TTTTTTTTTTAATTCTAATACGACTCACTATAGGGGTATTACCGC GGCTGCTGGCAC3’

P2

Solid-phase Primer 2

5’BiotinTEG//iSp9/TTTTTTTTTTTACGGGAGGCAGCAGT3’

b-DNA+

DNA+ mimic of extended P2

5’BiotinTEG/TACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGGCGAAAGCCT GACGGAGCAACGCCGCGTGAGTGATGAAGGTCTTCGGATCGTAAAACTCTGTTA TTAGGGAAGAACATATGTGTAAGTAACTGTGCACATCTTGACGGTACCTAATCA GAAAGCCACGGCTAACTACGTGCCAGCAGCCGCGGTAATAC3’

b-DNA-

DNA- mimic of extended P1

5’BiotinTEG/GTATTACCGCGGCTGCTGGCACGTAGTTAGCCGTGGCTTTCTGATTA GGTACCGTCAAGATGTGCACAGTTACTTACACATATGTTCTTCCCTAATAACAGA GTTTTACGATCCGAAGACCTTCATCACTCACGCGGCGTTGCTCCGTCAGGCTTTC GCCCATTGCGGAAGATTCCCTACTGCTGCCTCCCGTA3’

DNA- synthetic target

ss-DNA mimic of RNA-amplicon

5’GACCTTCATCACTCACGCGGCGTTGCTCCGTC3’

MB

Molecular beacon detection probe

5’Alexa488-CGAGCTAGCAACGCCGCGTGAGTGAAGCTCG-BHQ2-Biotin3’

a

The bold text indicates sequences that hybridize, and the different styles of underlines indicate complementary sequences. Italics indicate the T7 promoter c TEG and iSp9 correspond to triethylene glycol. b

Our SP-NASBA experiments amplified and detected a specific sequence of ribosomal RNA25,28 within total RNA extracted from Staphylococcus aureus (ATCC 12600). Bacteria were cultured in Tryptic Soy Broth (TSB) for 10 h at 37 °C and then vortexed to break bacterial clusters. An aliquot containing 1x105 bacteria was centrifuged to pellet the bacteria. We used an RNeasy mini kit (Qiagen) following the manufacturer’s protocol to isolate the total bacterial RNA in 100 µL of Ultrapure RNase-free distilled water (Invitrogen). This total RNA solution was heated to 65 °C for 2 min, and 1 µL was mixed with 19 µl of NASBA reaction buffer (Life Sciences, St. Petersburg, FL) that contained nucleotides and salts. For the full NASBA reaction, all three enzymes (32 units T7 RNA polymerase, 6.4 units AMV-RT, 0.08 units RNase-H) were added to the reaction buffer. 20 µl of this solution was deposited on a microgel array and left there for 2 h at 41 °C under saturated humidity. The surface was washed twice (10 min) with TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 7.5) and then imaged. We executed experiments designed to isolate the action of individual enzymes or combinations of enzymes. The action of AMV-RT was studied using tethered partial DNA bridges. The partial bridges were made by mixing b-DNA+ and primer 1 (Table 1) in hybridization buffer (4 mM MgCl2, 50 mM KCl, 10 mM Tris–HCl, pH 8.0). These partial bridges each

consisted of a short sequence of ds-DNA and a longer sequence of ss-DNA with biotin at both ends. A 1 µM partialbridge solution was mixed with 1 µM biotinylated MB solution (in 0.1x PBS) in a 1:1 (v:v) ratio. 20 µL of this solution was deposited on a microgel array and incubated for 1 h at room temperature under saturated humidity. Unreacted bridges and beacons were removed by washing twice (10 min) with 0.1xPBS. An aliquot of 20 µL of NASBA reaction buffer containing nucleotides and only the AMV-RT enzyme (6.4 units) was then deposited on the microgel array and left there for 2 h at 41 oC under saturated humidity. The surface was washed twice (10 min) with TE buffer. The dsDNA was stained with PicoGreeen® (Quant-it™ PicoGreen, Thermofisher Scientific) following the manufacturer’s standard protocol and imaged. The action of T7 RNA polymerase was studied using tethered ds-DNA bridges. These double-stranded bridges were formed by mixing b-DNA+ and b-DNA- (Table 1) in hybridization buffer for 2 h to create ds-DNA with biotin at each end. A 1 µM ds-DNA solution was mixed with 1 µM biotinylated MB solution (in 0.1x PBS) in a 1:1 (v:v) ratio. An aliquot 20 µL of this solution was deposited on a microgel array and incubated for 1 h at room temperature under saturated humidity to created ds-DNA bridges tethered at each end to SA sites on the microgels. The substrate was washed



twice with 0.1X PBS. An aliquot of 20 µL NASBA reaction buffer containing nucleotides with only the T7 RNA polymerase (32 units) was deposited on the microgel array and left there for 2 h at 41 °C under saturated humidity. The surface was washed twice with TE buffer and then imaged. The molecular beacons used here contained an Alexa 488 fluorophore. In addition to the MB fluorescence, several specimens were stained with PicoGreen to label ds-DNA. The fluorescence was quantified using a Nikon E1000 upright optical microscope with a mercury lamp and a Cooke SensiCam high-sensitivity CCD Camera. All fluorescence data were collected with a Nikon Plan Apo VC 60× (NA = 1.2) water-immersion objective lens. After completing their amplification treatment, the fully hydrated specimens were each covered with a cover slip and immediately imaged. Digital image data were analyzed with ImageJ and Fiji.29,30 The fluorescence intensity is reported on a per-microgel basis. Microgel-intensity data are reported here as the average measured from at least 5 different microgels with the background subtracted, and the error bars represent the standard deviation of those measurements.

RESULTS AND DISCUSSION Typical image data characteristic of an SP-NASBA experiment are presented in Figure 2. These images were collected from surface-patterned microgels made from a 20 wt% PEG-B solution. MBs, P1, and P2 were tethered to the microgels from a 0.5 µM MB: 0.25 µM P1: 0.25 µM P2 solution. The positive control was exposed to NASBA

Figure 2. The efficiency of SP-NASBA decreases as the tethering density of primers and beacons increases. The negative control corresponds to the background intensity of MBs in the absence of target. The positive control corresponds to MBs exposed to complementary DNA-.

Page 4 of 10

reaction buffer containing 1 µM DNA- synthetic target (Table 1). The positive control exhibits the maximum possible fluorescence. The negative control was exposed to NASBA reaction buffer with no RNA or DNA. The negative control exhibits the minimum possible fluorescence, and signal in the negative control comes primarily from incompletely quenched MBs.31 The SP-NASBA sample was exposed to NASBA reaction buffer that contained total RNA extracted from S. aureus, including 16S ribosomal RNA with a sequence complementary to the gel-tethered P1. The fact that the middle image in Figure 2 exhibits strong fluorescence indicates that the multiple steps associated with solid-phase NASBA all happened to successfully generate RNA- amplicons complementary to the tethered MBs. Except for these amplicons, there are no other oligonucleotides in this reaction that can hybridize to the MBs sufficiently to open them. In addition to microgels consisting of 20 wt % PEG-B, we explored the SP-NASBA reaction for microgels consisting of 40 wt% and 60 wt% PEG-B (Figure 2). The fact that the microgel intensities for both the positive and negative control specimens increase linearly with increasing PEG-B content is consistent with previously published experiments on microgels made from PEG-OH/PEG-B blends23 and indicates that the PEG-B content controls the density of tethering sites. However, while the SP-NASBA reaction is very efficient at low tethering densities (20 wt% PEG-B), it becomes extremely inefficient as the tethering density is increased. Figure 2 shows that the signal from the SP-NASBA samples at both 40 wt% and 60 wt% PEG-B is essentially the same as that from the negative controls. Either RNA- amplicons are not being generated, or these amplicons are unable to sufficiently hybridize to MB probes to produce detectable fluorescent signal. Adjusting the PEG-B concentration within a microgel amounts to controlling the average distance between tethering sites. To understand the possible role of inter-tether length scale on SP-NASBA, we executed experiments to isolate the individual effects of the enzymes. One set of experiments assessed the ability of the AMV-RT to convert a partial oligonucleotide bridge into a complete ds-DNA bridge (Figure 3A). We created partial bridges by mixing in solution P1 and b-DNA+. Both ends of the partial bridges were biotinylated and could thus be tethered to SA-activated microgels. We used tethering solutions with a 1:1 ratio of MBs and partial bridges to preserve the ratio MB:P1:P2 as 50:25:25. Note, however, that RNA- was not produced during this monoenzyme experiment, so the MBs were only passive participants in this particular experiment. Both before and after AMV-RT extension of P1, we used PicoGreen staining to label the ds-DNA. Before extension, we thus see intensity from the initial P1/DNA+ hybrid, which consists of 22 base pairs, and from the MB stem. Figure 3B indicates that this intensity (grey circles) increases linearly with increasing PEGB content and again confirms the linear relationship between PEG-B content and tethering-site density. The PicoGreen intensity after P1 extension is much stronger and comes from the ds-DNA bridges, each of which consists of 229 base pairs, and from the much smaller MB stem. Figure 3B shows that the intensity after extension (green triangles) increases linearly

4 ACS Paragon Plus Environment

Page 5 of 10 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


with increasing PEG-B concentration. We did a similar experiment where the tethering sites were functionalized only with partial DNA bridges and no MB probes. The results of that experiment (Figure S2) show a similar linear increase in microgel intensity across the entire range of tethering densities. The linear increase in microgel intensity in Figure 3B indicates that even our most densely tethered surfaces do not affect the ability of AMV-RT to convert partial bridges into full ds-DNA bridges. Crowding apparently does not influence AMV-RT effectiveness over the range of length scales probed here. We have previously shown that a single microgel comprising 100 wt % PEG-B (5 kDa Mw precursor) has a streptavidin density of 46,900/µm2, which corresponds to an average distance of just under 5 nm between adjacent streptavidin sites. Making the simplifying assumption that AMV-RT behaves like a spherical random-coil polymer, we can estimate its radius, R,32 based on the specific volume, ̅ , of an average protein (0.73 cm3/g):33

…(1)

where Mw is the protein molecular weight and NAV is Avogadro’s number. AMV-RT is a heterodimer with Mw = 158 kDa, and equation (1) predicts that its diameter is 7.1 nm. Hence, when approaching a microgel comprising 100% PEGB, an AMV-RT molecule will interact with at least one and possibly more sites that are occupied either by an MB probe or by one end of a partial bridge. This level of crowding is, however, insufficient to create steric hindrance either in accessing the surface or in adopting whatever conformations are required for the enzymatic extension of P2. Furthermore, in contrast to experiments that tether the primers to rigid substrates,3 here the conversion of a tethered ss-DNA partial bridge into a tethered full ds-DNA bridge appears to introduce no inefficiency despite the concomitant increase in DNA persistence length. Apparently, the increased bridge rigidity can be accommodated by the very large conformational flexibility associated with the outermost portion of an e-beam patterned PEG microgel.22,24 A second set of experiments addressed the issue of RNAamplicon generation from the action of T7 RNA polymerase on a full ds-DNA bridge (Figure 4A). For these experiments, we created ds-DNA bridges by mixing in solution b-DNAand b-DNA+. Both ends of these ds-DNA bridges were biotinylated, and they could subsequently be tethered to SAactivated microgels. We again used tethering solutions with a 1:1 ratio of MBs and ds-DNA bridges. The negative-control data presented in Figure 4B (grey circles) represent the background intensity from incompletely quenched MBs. The fact that this background signal increases linearly with increasing PEG-B content again confirms the linear relation between PEG-B content and tethering density. The positive control samples (Figure 4 green triangles) were exposed to NASBA reaction buffer containing 1 µM DNAsynthetic target. At low tethering densities, the positive control signal from hybridized MBs increases linearly. The data points for 60 wt% PEG-B and below were least-squares fit to a

Figure 3. (A) AMV-RT extends a tethered partial bridge into a complete ds-DNA bridge. (B) PicoGreen staining of ds-DNA shows that AMV-RT remains effective over a broad range of tethering densities. The microgels were initially functionalized from a solution containing equal molar concentrations of partial bridges and MBs.

straight line, and the fact that these points all fall very close to that line indicates that the MB hybridization efficiency in this regime is constant and, presumably, is close to unity. Above 60 wt% PEG-B, however, the positive control intensities level off. Despite the fact that there is an excess of complementary target, a significant fraction of MBs tethered to the 80 wt% and 100 wt% PEG-B microgels do not hybridize. This result is consistent with our previous measurements exploring crowding effects on MB performance in a system involving only tethered MBs with no tethered primers or bridges.23 The reduced hybridization efficiency was previously attributed to the increased role of steric factors on either target access to the tethered MBs or on the ability of the target to sufficiently hybridize to a tethered MB. The T7 RNA polymerase (Figure 4B black squares) shows an even stronger dependence on tethering density than do the MBs. The microgel intensity from samples exposed to the T7 RNA polymerase deviate from the maximum possible at PEGB concentrations of 40 wt% and above. At 40 wt% and 60 wt%, this reduced signal is due only to the action of the T7 polymerase. At 80 wt% and 100 wt% PEG-B, there is essentially no signal above the negative control, which may be due to a combination of reduced RNA- amplicon production and reduced MB hybridization. An analysis of the approximate size of the T7 RNA polymerase using equation (1) suggests that T7 access to the tethered ds-DNA bridges is probably not a limiting factor. T7 RNA polymerase is a single-subunit protein with a molecular weight of 98 kDa.34



Figure 4. (A) T7 RNA polymerase generates RNA- amplicons from pre-formed microgel-tethered ds-DNA bridges. (B) T7 polymerase (black squares) efficiency decreases with increasing tethering density.

Modeling it as a sphere indicates that its diameter is approximately 6.1 nm. Given the fact that T7 is slightly smaller than AMV-RT, we can expect that T7 should be able to access the ds-DNA bridges on microgel surfaces. Once there, however, crowding effects must be occurring. As a model RNA polymerase, the mechanisms of T7 action are well known.35 Importantly, once complexed with the T7 promoter region of the ds-DNA bridge, the T7 polymerase itself must undergo significant conformational changes first as an initiating complex and subsequently as an elongation complex. Furthermore, the transcription process requires local melting of the ds-DNA to form a transcription bubble comprising two short ss-DNA segments complexed with the enzyme, all of which involves substantial conformational rearrangement.36,37 We speculate that the close proximity of ds-DNA bridges, both to each other and to the MB probes, either inhibits these conformational changes or stalls the

Page 6 of 10

transcription process38 at the higher tethering densities. In short, fewer tethered ds-DNA bridges are active when they are crowded together, and the MB probes adjacent to these inactive bridges fail to hybridize and fluoresce. Another experiment explored the sequential effects of AMV-RT and T7 RNA polymerase (Figure S3). We created partial-bridge samples similar to our experiment on AMV-RT conversion of partial bridges into full ds-DNA bridges (Figure 3). After AMV-RT exposure, however, the samples were washed and then exposed to T7 RNA polymerase. Note that, in contrast to a solution-based amplification process, such washing is simple because the product of interest – ds-DNA – is tethered to the microgels on a solid substrate. Rather than use PicoGreen to follow the ss-to-ds DNA conversion as in Figure 3, we followed the MB intensity due to hybridization with RNA- amplicons. We see results very similar to those reported in Figure 4. In other words, AMV-RT appears to very effectively extend P1 to convert partial bridges to full dsDNA bridges, but, as the tethering density increases, T7 RNA polymerase is unable to generate RNA- amplicons from an increasing fraction of these bridges. To assess possible synergistic effects between the enzymes, we did experiments using tethered ds-DNA bridges exposed simultaneously to two enzymes. The samples were similar to those described in Figure 4 with microgels functionalized from buffer solutions containing equal concentrations of ds-DNA bridges and MB probes. The results are shown in Figure 5. The negative control, with no target present, is consistent with all of our experiments. The positive control, consistent with Figures 4 and S3, shows that the microgel intensity increases linearly until about 60 wt% PEG-B, beyond which crowding influences MB hybridization to the DNA- synthetic target. Exposure to T7 RNA polymerase alone (filled black squares) produces results quite similar to those in Figures 4 and S3 where there is a reduced MB hybridization efficiency that begins at about 30 wt% PEG-B. Importantly, very similar behavior is observed when microgels are exposed to T7 RNA polymerase and RNase H simultaneously (Figure 5, filled blue diamonds). RNase H degrades complementary RNA/DNA hybrids, but Figure 5 shows that the degradation of RNA-/MB hybrids is insignificant within this experiment. This behavior could in part be due to the very low concentration of RNase H or to reduced RNase H efficiency because of the relatively short length of the hybrid.39 Another set of experiments exposed the microgels simultaneously to T7 RNA polymerase and AMV-RT (Figure 5, inverted red triangles). Since the microgels were functionalized with full ds-DNA bridges, the role of the AMVRT to convert partial bridges to full bridges was not needed. Nevertheless, the length-scale effects are pronounced. While the MB signal is quite comparable to the positive-control samples for the lowest tethering densities (10 wt% and 20 wt% PEG-B), increasing the tethering density dramatically reduces the efficiency of MB hybridization to the point where there is essentially no significant signal beyond 40 wt% PEG-B. This result is quite consistent with the full SP-NASBA data presented in Figure 2. A similar inhibitory effect has been reported in RT-PCR involving a reverse transcriptase (RT) and Taq polymerase. This effect has been attributed to direct enzyme:enzyme


Page 7 of 10 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


complexation,40 RT modification of amplification primers,41 and contamination in commercial RT formulations.42 Sellner et al. showed experimentally that the inhibitory effect can be minimized if the ratio of RT to Taq polymerase is kept low.40 The interaction can be avoided altogether if cDNA is isolated by a precipitation process prior to subsequent PCR in the absence of the reverse transcriptase.43,44 Our situation is different. RT inhibition during RT-PCR has been studied by varying the average enzyme concentrations or the template concentrations in solution. For a given set of experiments, we hold these constant. Instead, we vary the local template concentration via the tethering density. A high density corresponds to a high local concentration of tethered ds-DNA bridges. In the particular case of Figure 5 where preformed ds-DNA bridges are tethered to the microgels, RT modification of primers cannot account for our results, since these experiments present no single-stranded primer. The dsDNA bridge is already formed. Instead, since AMV-RT can bind to ds-DNA45 and T7 RNA polymerase can bind to a T7 promoter region, we speculate that such binding increases the local concentration of both the AMV-RT and T7 RNA

Figure 5. The simultaneous exposure of microgel-tethered ds-DNA bridges to AMV-RT and T7 RNA polymerase dramatically reduces the efficiency with which adjacent microgel-tethered MB probes generate fluorescent signal.

polymerase in the vicinity of the microgel. Furthermore, since RT binding to ds-DNA is relatively weak,46,47 one can conceive that initially bound AMV-RT could desorb and, because of its nanoscale proximity to adjacent T7 RNA polymerase, would have a higher probability of interaction with the T7 RNA polymerase than it would under the average concentration conditions in the surrounding medium. Despite the various inhibiting effects that appear at higher tethering densities, practically speaking our experiments identify a window of tethering densities where the SP-NASBA reaction appears to be free of length-scale effects and operates very effectively. We see high-efficiency SP-NASBA in the ds-DNA bridge experiments (Figures 4 and 5), in the partialbridge experiment (Figure 3), and, most importantly, in the full SP-NASBA reaction (Figure 2) involving only tethered amplification primers, tethered molecular-beacon detection probes, and bacterial RNA. These experiments indicate that

microgels comprising 20 wt% PEG-B or less lead to efficient amplification irrespective of which combination of enzymes present. This composition corresponds to a tethering density of just under 10,000/µm2 where there would on average be one tethering site in an area just over 100 nm2. In other words, the tethering sites on average are about 10 nm apart. This and larger spacings create conditions where the crowding effects on molecular-beacon hybridization, the conformational constraints on T7 RNA polymerase activity, and the inhibiting effects of AMV-RT are all avoided. Higher tethering densities could be used if the AMV-RT extension of the partial bridges is separated from the subsequent amplicon production by T7 RNA polymerase acting on the resulting ds-DNA bridges. And, in contrast to liquid-phase amplification,43,44 such a serial process is easy to achieve here, since the ds-DNA bridges are tethered to a solid substrate and allow for very simple washing.

SUMMARY AND CONCLUSIONS We have introduced a new variation of solid-phase NASBA that integrates solid-phase RNA amplification and detection. This approach uses surface-patterned biotinylated PEG microgels to tether amplification primers and molecularbeacon detection probes in a spotted format appropriate for a microarray. The tethering density is controlled using microgels comprised of homopolymer blends of biotinterminated and hydroxyl-terminated homo-bifunctional PEG. We have identified a regime of microgel compositions where the NASBA series of reactions is sufficient to convert initially independent primers into tethered ds-DNA bridges. RNAamplicons are generated from the bridges, and these amplicons hybridize to adjacent tethered molecular beacon probes with an efficiency comparable to our positive controls. By varying microgel composition, we have shown that the performance of SP-NASBA, with tethered P1 and P2 amplification primers as well as tethered molecular-beacon detection probes, depends strongly on the tethering density. At the highest densities studied, where the average distance between tethering sites is about 5 nm, the efficiency is decreased in part due to crowding effects associated with hybridization of RNA- amplicons to the tethered molecular beacon probes. We have shown that the SP-NASBA efficiency is further influenced by enzyme activity. We studied the action of AMV-RT and T7 RNA polymerase both individually and in combination. By itself, AMV-RT conversion of tethered ssDNA bridges into tethered ds-DNA bridges is effective over all the tethering densities studied. Importantly, the many degrees of conformational freedom associated with the outer surface of a PEG microgel appear to accommodate the substantial change in persistence length and rigidity associated with the ss-to-ds DNA conversion. In contrast, the efficiency of T7 RNA polymerase decreases substantially at increasing tethering densities. We attribute this effect to conformational constraints imposed on the local ds-DNA unzipping associated with T7 activity. The most significant effect on decreased SPNASBA efficiency occurs when the AMV-RT and the T7 polymerase are present simultaneously. This is consistent with observations of RT inhibition of polymerase in RT-PCR. We speculate that higher concentration of tethered ds-DNA bridges increases the local concentration of AMV-RT and T7



polymerase and thus increases the probability of enzymeenzyme interactions that reduce NASBA efficiency. Here we have explored only a narrow range of variables possible within the SP-NASBA process. We have studied microgels made from only one set of binary homopolymer blends, but one can envision controlling the tethering using polymers of different molecular weights, different degrees of functionality, and different chemical functionalities. In addition to the controlling the overall tethering-site density, one can also control the ratio of amplification primers to molecular beacon detection probes as well as the ratio of P1 to P2. The specific design of the primers may also impact the process, both in terms of the primer length and in terms of the resulting amplicon length. These variables can all influence the probability of generating a tethered ds-DNA bridge from which the process can then avalanche to either create more tethered bridges or activate tethered detection probes.

ASSOCIATED CONTENT Supporting Information Supporting information is provided as a pdf file containing three figures. Figure S1 details the solid-phase NASBA process. Figure S2 shows the absence of crowding effects when AMV-RT converts tethered partial bridges into ds-DNA bridges. Figure S3 shows the effect of tethering density on the conversion of tethered partial bridges by AMV-RT to full ds-DNA bridges followed by RNA- amplification by T7 RNA polymerase. The data are similar to those in Figure 4 involving RNA- amplification from preformed ds-DNA bridges but different from those in Figure 5 where AMV-RT and T7 RNA polymerase are present simultaneously. The Supporting Information is available free of charge on the ACS Publications website.

AUTHOR INFORMATION Corresponding Author * [email protected]

Present Addresses † U.S. Food and Drug Administration, Silver Spring, MD.

Author Contributions The manuscript was written through contributions of all authors. All authors have given approval to the final manuscript version.

ACKNOWLEDGMENT This work has been supported by the National Science Foundation (CBET-1402706) and by an Innovation & Entrepreneurship Fellowship from Stevens Institute of Technology.

REFERENCES (1) Adessi, C.; Matton, G.; Ayala, G.; Turcatti, G.; Mermod, J. J.; Mayer, P.; Kawashima, E. Nucleic Acids Res 2000, 28, 87. (2) Kohsaka, H.; Carson, D. Journal of Clinical Laboratory Methods 1994, 8, 452-455. (3) Mercier, J. F.; Slater, G. W.; Mayer, P. Biophysical Journal 2003, 85, 2075-2086. (4) Ma, Z.; Lee, R. W.; Li, B.; Kenney, P.; Wang, Y.; Erikson, J.; Goyal, S.; Lao, K. Proceedings of the National Academy of Sciences of the United States of America 2013, 110, 14320-14323. (5) Mitra, R. D.; Butty, V. L.; Shendure, J.; Williams, B. R.; Housman, D. E.; Church, G. M. Proceedings of the National

Page 8 of 10

Academy of Sciences of the United States of America 2003, 100, 5926-5931. (6) Chin, W. H.; Sun, Y.; Høgberg, J.; Hung, T. Q.; Wolff, A.; Bang, D. D. Analytical and Bioanalytical Chemistry 2017, 409, 2715-2726. (7) Damin, F.; Galbiati, S.; Ferrari, M.; Chiari, M. Biosensors and Bioelectronics 2016, 78, 367-373. (8) Mayboroda, O.; Benito, A. G.; Del Rio, J. S.; Svobodova, M.; Julich, S.; Tomaso, H.; O'Sullivan, C. K.; Katakis, I. Analytical and Bioanalytical Chemistry 2016, 408, 671-676. (9) Mitterer, G.; Huber, M.; Leidinger, E.; Kirisits, C.; Lubitz, W.; Mueller, M. W.; Schmidt, W. M. J Clin Microbiol 2004, 42, 1048-1057. (10) Sun, Y.; Dhumpa, R.; Bang, D. D.; Handberg, K.; Wolff, A. Diagnostic Microbiology and Infectious Disease 2011, 69, 432439. (11) Palanisamy, R.; Connolly, A. R.; Trau, M. Bioconjugate Chemistry 2010, 21, 690-695. (12) Southern, E.; Mir, K.; Shchepinov, M. Nat. Genet. 1999, 21, 5-9. (13) Rao, A. N.; Grainger, D. W. Biomater. Sci. 2014, 2, 436-471. (14) Kim, E. S.; Hong, B. J.; Park, C. W.; Kim, Y.; Park, J. W.; Choi, K. Y. Biosensors and Bioelectronics 2011, 26, 2566-2573. (15) Jayaraman, A.; Hall, C. K.; Genzer, J. J Chem Phys 2007, 127. (16) Peterson, A. W.; Heaton, R. J.; Georgiadis, R. M. Nucleic Acids Res 2001, 29, 5163-5168. (17) Cederquist, K. B.; Keating, C. D. Langmuir 2010, 26, 1827318280. (18) Josephs, E. A.; Ye, T. ACS Nano 2013, 7, 3653-3660. (19) Lei, Q. L.; Ren, C. L.; Su, X. H.; Ma, Y. Q. Sci. Rep. 2015, 5. (20) Chudinov, A. V.; Kolganova, N. A.; Egorov, A. E.; Fesenko, D. O.; Kuznetsova, V. E.; Nasedkina, T. V.; Vasiliskov, V. A.; Zasedatelev, A. S.; Timofeev, E. N. Microchimica Acta 2014, 182, 557-563. (21) Krsko, P.; Mansfield, M.; Sukhishvili, S.; Clancy, R.; Libera, M. Langmuir 2003, 19, 5618-5625. (22) Wang, Y.; Firlar, E.; Dai, X.; Libera, M. Journal of Polymer Science, Part B: Polymer Physics 2013, 51, 1543-1554. (23) Ma, Y.; Libera, M. Langmuir 2016, 32, 6551-6558. (24) Dai, X.; Yang, W.; Firlar, E.; Marras, S. A. E.; Libera, M. Soft Matter 2012, 8, 3067-3076. (25) Ma, Y.; Dai, X.; Hong, T.; Munk, G. B.; Libera, M. Analyst 2017, 142, 147-155. (26) Compton, J. Nature 1991, 350, 91-92. (27) Morris, C.; Harris, J., United States Patent, 6017738A, 2000. (28) Zhao, Y. A.; Park, S.; Kreiswirth, B. N.; Ginocchio, C. C.; Veyret, R.; Laayoun, A.; Troesch, A.; Perlin, D. S. J Clin Microbiol 2009, 47, 2067-2078. (29) Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; Tinevez, J.-Y.; White, D. J.; Hartenstein, V.; Eliceiri, K.; Tomancak, P.; Cardona, A. Nat Meth 2012, 9, 676-682. (30) Schneider, C. A.; Rasband, W. S.; Eliceiri, K. W. Nature Methods 2012, 9, 671-675. (31) Marras, S. A.; Kramer, F. R.; Tyagi, S. Nucleic Acids Res 2002, 30. (32) Wei, Y.; Latour, R. A. Langmuir 2008, 24, 6721-6729. (33) Harpaz, Y.; Gerstein, M.; Chothia, C. Structure 1994, 2, 641649. (34) Dunn, J. J.; Studier, F. W.; Gottesman, M. Journal of Molecular Biology 1983, 166, 477-535. (35) Sousa, R.; Mukherjee, S. In Progress in Nucleic Acid Research and Molecular Biology, 2003, pp 1-41.


Page 9 of 10 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(36) Jiang, M.; Ma, N.; Vassylyev, D. G.; McAllister, W. T. Molecular Cell 2004, 15, 777-788. (37) Martin, C. T.; Esposito, E. A.; Theis, K.; Gong, P. In Progress in Nucleic Acid Research and Molecular Biology, 2005, pp 323-347. (38) Zhou, Y.; Martin, C. T. Journal of Biological Chemistry 2006, 281, 24441-24448. (39) Gao, H.-Q.; Sarafianos, S. G.; Arnold, E.; Hughes, S. H. Journal of Virology 2001, 75, 11874-11880. (40) Sellner, L. N.; Coelen, R. J.; Mackenzie, J. S. Nucleic Acids Res 1992, 20, 1487-1490. (41) Chumakov, K. M. Genome Research 1993, 4, 62-64. (42) Fehlmann, C.; Krapf, R.; Solioz, M. Clinical Chemistry 1993, 39, 368-369. (43) Liss, B. Nucleic Acids Res 2002, 30. (44) Suslov, O.; Steindler, D. A. Nucleic Acids Res 2005, 33, e181.181-e118.112. (45) Bakhanashvili, M. Biochemistry 1994, 33, 12160-12165. (46) Bohlayer, W. P.; DeStefano, J. J. Biochemistry 2006, 45, 7628-7638. (47) DeStefano, J. J.; Bambara, R. A.; Fay, P. J. Biochemistry 1993, 32, 6908-6915.



Page 10 of 10

Table of Contents Graphic:


Solid-Phase NASBA and Length-Scale Effects during RNA

Recommend Documents