Solid-Phase Oligonucleotide Synthesis and Flow Cytometric Analysis

A novel combinatorial approach to synthesize oligonucleotides on fluorescently encoded microspheres based on flow sorting and segmental solid-phase ...
0 downloads 0 Views 107KB Size
Download PDF
282

Bioconjugate Chem. 2000, 11, 282−288

Solid-Phase Oligonucleotide Synthesis and Flow Cytometric Analysis with Microspheres Encoded with Covalently Attached Fluorophores Alaganandan Nanthakumar,† Richard T. Pon,‡ Abhijit Mazumder,*,† Shuyuan Yu,‡ and Andrew Watson†,§ Axys Pharmaceuticals, 11099 North Torrey Pines Road, Suite 160, La Jolla, California 92037, Department of Biochemistry and Molecular Biology, University of Calgary, Health Sciences Center, 3330 Hospital Drive NW, Calgary, Alberta, Canada T2N 4N1. Received October 25, 1999; Revised Manuscript Received January 12, 2000

A novel combinatorial approach to synthesize oligonucleotides on fluorescently encoded microspheres based on flow sorting and segmental solid-phase synthesis is described. BODIPY dyes were covalently attached to polystyrene (8.8 µm, 55% DVB) microsphere particles to generate four fluorescently encoded sets. 20-mer oligonucleotide sequences can be synthesized on these microspheres with yields comparable to conventional CPG supports (80% overall yield, average stepwise yield ) 99%). The concept of segmental solid-phase synthesis by flow sorting was demonstrated by synthesizing unique 20-mer oligonucleotide sequences on each of four fluorescently encoded microsphere sets by including a flow sorting step (after first eight base additions) and flow cytometric detection of sequences synthesized on each microsphere set by hybridization with fluorescently labeled complementary sequence.

INTRODUCTION

Solid-phase methods for the synthesis of oligonucleotides has evolved into a high-throughput automated system and is based on phosphoramidite coupling chemistry (1-4). Current synthesizers can be programmed to routinely synthesize in the nanomole to micromole scale using porous polystyrene or controlled pore glass (CPG) supports. However, the amount of oligonucleotide synthesized is generally larger than required for most biochemical hybridization assays. The scale of synthesis could be dramatically reduced (to attomoles) by performing oligonucleotide synthesis on a single microsphere (micrometer-sized particles). Typical loading of nonporous microsphere solid supports is ∼1 µmol/g or 100 amol/ microsphere. Our approach couples in situ synthesis on microspheres with a combinatorial segmental solid-phase method which was first used with individual paper filter disks as supports (5-8). However, to synthesize large numbers of oligonucleotide sequences, a rapid method of sorting is required. Efficient sorting of fluorescently encoded microspheres or cells can be achieved using flow cytometric methods. State-of-the-art flow sorters can perform sorting with yields exceeding 90% and purity >99% for a sort rate of 25 000 events/s. Solid supports having covalently anchored oligonucleotide sequences have been of interest due to potential applications involving multiplexed hybridization assays (9, 10). In situ synthesis of oligonucleotides and hybridization studies have also been performed on glass plates (11) derivatized with spacers containing ethylene glycol linkages. Automated in situ oligonucleotide synthesis and * To whom correspondence should be addressed. Present address: Motorola Biochip Systems, 4088 Commercial Ave., Northbrook, IL 60062. † Axys Pharmaceuticals. ‡ University of Calgary. § Present address: Quantum Dot Corporation, 4030 Fabian Way, Palo Alto, CA 94303.

hybridization on uniformly sized polymeric microparticles (50 µm) have been previously demonstrated by Lonnberg et al. (12-14) on linkers stable to ammonolysis deprotection conditions. Another study has reported on synthesis of oligonucleotide combinatorial libraries using a split-pool-combine technique with tentagel (15) or polystyrene (8) microspheres. We have adopted a similar approach by covalently immobilizing a bifunctional (DMTO/COOH), hydrocarbon linker (I) to amino functionalized 8.8 µm, 55% divinylbenzene cross-linked polystyrene microspheres and performing flow sorting to separate mixture of fluorescently encoded microspheres. Methods to synthesize uniform fluorescent latex particles are well documented in the literature (16). However, the methods used are exclusively devoted to applications which are limited to aqueous medium due to the means by which the microspheres are noncovalently labeled with dye. Labeling polymeric microspheres depends on the ability of microspheres to swell in organic solvents, thus allowing incorporation of dye into the interior of particles. Removal of the solvent then allows entrapment of the dye within the microparticles. However, this approach is not feasible for oligo synthesis applications, since nonswelling, rigid polymeric supports (macroporous high cross-linked polystyrene) are required to perform efficient synthesis (17). This manuscript also describes an alternate encoding approach by covalently binding functionalized dye molecules to reactive functional groups on the microsphere surface thus allowing nonswelling high cross-linked polystyrene microparticles to be used as fluorescently encoded oligonucleotide synthesis supports. These encoded microspheres are then used in segmental solid phase synthesis with flow sorting to rapidly generate oligonucleotide sequences on a subnanomole scale. EXPERIMENTAL PROCEDURES

Derivatization of Microspheres. Scheme 1 shows the method adopted to synthesize microspheres with

10.1021/bc990145z CCC: $19.00 © 2000 American Chemical Society Published on Web 02/25/2000

Technical Notes Scheme 1. Synthetic Scheme to Generate Fluorescently Encoded Microspheres Suited for Oligonucleotide Synthesisa

a

SE ) succinimidyl ester functional group.

bifunctionality, separating oligonucleotide synthesis sites from sites to be used for coupling of dye molecules. Compact (nonporous) polystyrene (55% DVB/20%GMA, 8.8 µm) microspheres with -NH2 functional groups were purchased from Bangs Laboratories. Dry microspheres were recovered from the suspension by filtering through a Whatman type 42 (2-5 µm pore) filter paper followed by washes with water, methanol, acetonitrile, and dichloromethane. Bifunctional DMTO/carboxyl derivatized hydrocarbon linker (1) [DMTO-(CH2)11COOH] was synthesized by coupling dimethoxytrityl chloride with 12hydroxydodecanoic acid and was purified by silica gel column chromatography. Hydrocarbon linker (I) [DMTO(CH2)11COOH] was initially attached to amino functionalized to 8.8 µm 55% DVB cross-linked polystyrene microsphere surface to separate the oligonucleotide synthesis sites from amino sites to be used for covalent attachment of fluorescent dye. The linker was attached to the surface amine of microparticles by direct coupling of carboxyl group on linker with aliphatic amine sites on particles using HBTU (O-benzotriazol-1-yl-N,N,N′,N′tetramethyluronium hexafluorophosphate) as the coupling reagent. [DMTO-(CH2)11COOH] linker disolved in acetonitrile was mixed with dried polystyrene microparticles to form a suspension in a 1 mL glass vial. The linker was added in more than 10-fold M excess relative to the amino sites on microspheres. Equal moles of HBTU and (dimethylamino)pyridine were disolved in acetonitrile in a separate glass vial and added to microsphere suspension (moles of HBTU per DMAP added was equal to amount of linker). After 30 min of reaction, the microspheres were filtered (Whatman grade 42 filter) and washed with several portions of acetonitrile and dichloromethane and allowed to air-dry. The derivatized microspheres were stored in a vacuum desiccator. The DMT loading of the derivatized microspheres was estimated to be ∼1.5 µmol/g by measuring the absorbance of the released trityl ions at 503 nm (the amount of linker on

Bioconjugate Chem., Vol. 11, No. 2, 2000 283

microspheres can be controlled by varying the amount of linker and time of reaction). A loading of 1 µmol/g is equivalent to ∼2 × 10-16 mol/microsphere for 8.8 µm polystyrene beads. The total surface loading of amino functional groups was determined to be ∼4 µmol/g by reaction with dimethoxytrityl chloride and tetrabutylammonium perchlorate (18, 19) and subsequent analysis of released DMT group upon detritylation. Hence, a large fraction of reactive surface amino sites is still available for subsequent conjugation with fluorescent dye molecules. Total coverage of surface sites with linker and dye molecules is not possible due to steric constraints associated with close proximity of reactive sites. The amino groups remaining after attachment of hydrocarbon linker and dye molecules were blocked prior to oligonucleotide synthesis, using standard capping reagents (N-methylimidazole/acetic anhydride). Capping of underivatized surface sites on fluorescently encoded microspheres was done manually on the synthesizer by exposing microspheres in synthesis columns to capping solution for ∼30-45 min. The microspheres were then washed by acetonitrile flow through the column. As an alternate, multiple capping/washing steps were performed in the synthesizer prior to synthesis, to achieve more efficient capping. A cleavable linker (II) was used when quality of oligonucleotide product was interrogated. Column Preparation. Microsphere support derivatized with linker (I) was weighed directly in to an empty synthesis column (1 µmol empty columns from PE Biosystems). A Zitex 5-10 µm membrane filter disk (Norton Plastics) was used to hold the microparticles. The top and bottom column fittings were sealed in place with aluminum caps using a crimper tool. A TWIST type column, custom-made to include 5 µm frits (Glen Research) was also used with similar results. Microsphere suspensions were transferred into the column via plastic syringe attached to column body. Oligo Synthesis/Deprotection. PE Biosystems model 394 (4 column) automated DNA synthesizer was used for all oligonucleotide synthesis. The 0.2 µmol scale oligonucleotide synthesis cycle was modified by increasing washing and reagent contact times appropriately to compensate for lower flow rates through column (due to impeded flow through smaller pores of membrane filters). The flow rate through TWIST type (5 µm frit) columns was not significantly affected despite smaller pore size, and product quality was not affected by unmodified cycles. The microspheres, after oligo synthesis, were dried by argon flow-through column. The dried particles were transferred into a screw-capped microcentrifuge tube (1.5 mL) and treated with concentrated ammonia for 16 h at room temperature or for 4 h at 55° C. The excess ammonia was decanted off and the microspheres washed with water. Deprotection of sorted beads were performed directly on synthesizer (ammonia, 18 h room temperature). The beads were recovered from synthesis column by extraction with TE (PH 8. SDS 0.4%) buffer. We note that the synthesis process could be increased additionally by using UltraFAST chemistry (for cleavage and deprotection using methylamine). Reagents. Standard PE Biosystems reagents were used for synthesis of oligonucleotides. Protected phosphoramidites used were dAbz, dGDMF, and dCbz (PE Biosystems). The cleavable phosphoramidite linker (II) [2[2-(4,4′-dimethoxy trityloxy)ethylsulfonyl]ethyl-(2-cyanoethyl)-(N,N-diisopropyl)phosphoramidite)] was purchased from Glen Research. BODIPY dyes were obtained

284 Bioconjugate Chem., Vol. 11, No. 2, 2000

from Molecular Probes. Fluorescein-labeled oligonucleotide probe sequences were purchased from Operon Technologies. Flow Cytometric Analysis/Sorting. Two-way sorting was performed using BD FACStar at the VA Hospital in San Diego. Flow cytometric analysis for 488 nm excitation was done using FACScan (Becton Dickinson). The filter for FL1 (green) channel transmits 530 nm light (bandwidth ) 30 nm) and FL2 (orange) filter transmits at 585 nm (bandwidth ) 40 nm). Four-way sorting and analysis using He-Ne 630 nm laser excitation was performed using MOFLO (cytomation) instrument (FL1; 670 nm, 40 nm band-pass; FL2; 700 nm and above). Analysis and sorting were performed in TE (10 mM Tris and 1 mM EDTA, pH 8) or PBS (phosphate-buffered saline) buffers. Trityl Assays/Product Analysis. The coupling efficiency was measured by monitoring the absorbance (503 nm) of released dimethoxytrityl ions following the detritylation step. The trityl output was collected in glass test tubes by fraction collector (Bio-Rad model 2110). The solution was allowed to evaporate to dryness by placing tubes in fume hood for 48 h. A total of 1.5 mL of trichloroacetic acid/dichloromethane solution was added to each tube, and the weight of solution was measured. The absorbance was measured using a spectrophotometer (Pharmacia Biotech, Uptrospec 4000). The absorbance readings were corrected for discrepancy in volumes due to solvent evaporation. Oligonucleotide products were analyzed by capillary electrophoresis at the University of Calgary, DNA synthesis core facility. MALDI (matrixassisted laser desorption ionization) mass spectroscopy analysis was performed at the Mass Consortium in San Diego. Covalent Attachment of BODIPY-TMR and Generation of 4 Microsphere Set. All BODIPY (4,4difluoro-4-bora-3a,4a-diaza-s-indacene) dyes were purchased from Molecular Probes with succinimidyl ester functionality. The succinimidyl ester functional group of the dye (Bodipy TMR SE, BODIPY substitute for tetramethylrhodamine, Abs/Em ) 542/574 nm) was coupled directly to the free (unreacted) surface aliphatic amine sites of hydrocarbon (I)-linked microparticles in acetonitrile to form a carboxamide bond. The amount of dye attached to the surface of microparticles was controlled by varying the concentration of the dye. Four microsphere sets could be generated by reacting with four solutions of dye prepared by serial dilution (10-fold dilution) of stock solution (∼1 mM). The dye-loaded microspheres were filtered through a 2.5 µm (Whatman grade 42) filter paper and washed with several portions of acetonitrile. As an alternate, the background fluorescence emission from unlabeled hydrocarbon (I)-linked microspheres could also be used as a fluorescently addressable microsphere set. The amount of hydrocarbon linker (oligo synthesis sites) on the microparticles corresponds to ∼40% of total available sites, thus leaving about 60% of the sites available for dye binding. However, steric crowding would prevent occupation of all available sites. Steric factors associated with close proximity of oligonucleotides on surface of microspheres is known to prevent hybridization reactions (20). Optimum hybridizations have been observed for support surfaces occupied by less than 50% of available sites. Synthesis/Two-Way Sorting. The sorted microsphere suspensions were transferred via plastic syringe attached to the open end of a synthesis column. The suspension was filtered through membrane filter (5-10

Nanthakumar et al.

Figure 1. (a) Capillary electrophorograms of 20-mer sequence synthesized on 8.8 µm polystyrene (55% DVB cross-linked) microspheres; Sequence synthesized; 5′-d(AGCT AGCT TTTT AGCT AGCT)-3′. (b) CE data for same sequence synthesized on 40 nmol polystyrene column (PE Biosystems). The products were simultaneously cleaved from support and deprotected in ammonium hydroxide (55 °C, 16 h). Cleavable linker 2[2-(4,4′dimethoxytrityl-oxy)ethylsulfonyl]ethyl-(2-cyanoethyl)-(N,Ndiisopropyl)-phosphoramidite) was linked to surface amino sites of polystyrene microspheres before synthesis of sequence. (c) Mass spectroscopy (MALDI) data for 20-mer synthesized on 8.8 µm 55% DVB polystyrene support. Expected mass ) 6072; observed mass ) 6071 (mass includes 3′ phosphorylation from cleavable chemical phosphorylating reagent). Sequence synthesized: 5′-d(ATCCCCAACAGACCACTGCTC)-3′ DMT off.

µm, sealed on other end of column) by mild pressure on the plunger. The microsphere support was washed by flowing acetonitrile through synthesis column for at least 5 min. RESULTS AND DISCUSSION

In Situ Synthesis on Microspheres. The cleavable linker (II) was used for cleavage and analysis by capillary electrophoresis. 20-mer synthesized on 8.8 µm, 55% DVB polystyrene microsphere supports gave comparable results as the same 20-mer sequence synthesized on standard 40 nmol (PE Biosystems) columns (Figure 1, panels a and b). Average stepwise yields of 99 and 98.3% were calculated for 20-mer synthesis on 8.8 µm polystyrene microspheres derivatized with linker (1) and 40 nmol PE Biosystems polystyrene columns, respectively. Spectrophotometric trityl (DMT) assays also confirmed the high coupling efficiencies observed when synthesis was performed on polystyrene microsphere supports with ∼1 µmol/g DMT loadings. Supports with higher loadings showed low-coupling efficiencies for initial coupling steps but proceeded with high coupling efficiencies after DMT

Technical Notes

Bioconjugate Chem., Vol. 11, No. 2, 2000 285 Table 1. Complete Sequences Synthesized on Fluorescently Encoded Microspheres 1, 2, 3, and 4 microsphere 1, seq 1: 5′-d(TCGA TCGA AAAA TCGA TCGA)-3′ microsphere 2, seq 2: 5′-d(TCGA TCGA GGGG TCGA TCGA)-3′ microsphere 3, seq 3: 5′-(TCGA TCGA CCCC TCGA TCGA)-3′ microsphere 4, seq 4: 5′-d(TCGA TCGA TTTT TCGA TCGA)-3′ Table 2. Probe Sequences Useda probe 1: probe 2: probe 3: probe 4:

5′-d(TCGA TCGA TTTT TCGA TCGA F)-3′ 5′-d(TCGA TCGA CCCC TCGA TCGA F)-3′ 5′-d(TCGA TCGA GGGG TCGA TCGA F)-3′ 5′-d(TCGA TCGA AAAA TCGA TCGA F)-3′

a F ) fluorescein amidite. Hybridization was performed in TE, pH 8, 1 M NaCl, 0.5 % SDS solution at 50 °C for 30 min.

Figure 2. Effect of oligo synthesis conditions on mixture of microsphere sets 1, 2, 3, and 4; FL2 (orange) histograms of (a) mixture, before oligo synthesis treatment, (b) after subjecting microspheres with 20-mer synthesis using modified synthesis cycle and deprotection with ammonium hydroxide. Analysis performed in TE, pH 8 buffer. All intensities were recorded in logarithmic scale.

loading of ∼1 µmol/g was achieved. The exclusion of the hydrocarbon linker (I) did not significantly effect overall yield of product. The 20-mer oligonucleotide synthesized on polystyrene (8.8 µ, 55% DVB) microspheres was also analyzed by mass spectroscopy (MALDI) after cleavage and deprotection by ammonia (product was not purified). The mass spectrum shows the presence of only the mass peak of the complete 20-mer sequence (Figure 1c). Encoded, Organotolerant Microsphere Sets. To demonstrate stability of covalently attached BODIPYTMR dye to oligo synthesis conditions, histograms (FL2, orange) were recorded before and after oligonucleotide synthesis/deprotection (Figure 2). Intensities for microspheres 2-4 remain unchanged. Increase in intensity on microsphere 1 is due to added background emission from the synthetic process (reagents). However, intensities are not changed sufficiently as to hinder the subsequent sorting. Flow Sorting-Directed Segmental Solid-phase Synthesis. A synthetic strategy was devised to include (a) initial synthesis of common 8-mer 5′-d(TCGA TCGA)3′ on all four sets; (b) sorting of microsphere sets; (c) transfer to four separate synthesis columns; (d) synthesis of unique 4-mer sequence on each microsphere set followed by common 8-mer to complete 20-mer sequences which differ by only four bases in the middle of sequence (Table 1). The sequence 5′-d(TCGA TCGA)-3′ was synthesized (DMT removed after last base addition) on microsphere sets 1, 2, 3, and 4. The microspheres were combined and

suspended in TE (pH 8) buffer and divided into two portions. Microsphere sets 1 and 2 were sorted from the first portion and microspheres 3 and 4 were sorted from the second portion. The sorted microspheres were collected in PBS buffer. Sorts 1, 2, 3, and 4 were transferred into four different synthesis columns and subjected to 12mer synthesis to complete unique 20-mer sequences on each microsphere set. The histogram of mixed microspheres (before sorting) and histograms for each sort (sort 1, 2, 3, and 4) are shown in Figure 3. Visual inspection of the figure indicates efficient sorting of mixture with minor amounts of impurities. Overlap of intensities due to broad nature of histograms results in loss or improper sorting of beads found between defined gate regions selected for sorting. Exposure of micropheres with dye solutions (BODIPY TMR in acetonitrile) for shorter periods (less than 1 min) resulted in sharper and better resolved histograms. Aggregation of microspheres was evident from forward and side scatter (FSC vs SSC) two-dimensional dot plots (not shown). Loss of yield due to aggregation could be minimized by adding small amounts of surfactants (∼0.5% SDS) to microsphere suspension. Detection of Microsphere Type (sequence) by Hybridization. Microspheres 1, 2, 3, and 4 were mixed together and divided into five portions. Probes 1-4 (complementary sequences labeled with green fluorescein dye, ∼7 pmol) were added to each tube (probe 1 to tube 1, probe 2 to tube 2, probe 3 to tube 3, and probe 4 to tube 4). The fifth tube contained no added probe. The probe sequences used for hybridization are summarized in Table 2. Results of the above experiment are shown in Figure 4. The increase in FL1 intensity (green probe channel) is observed only for microspheres containing a perfectly matched complementary sequence. Although the microsphere set affected by hybridization is clearly evident from the plots, a small fraction of the population from that set remains unaffected. This may be as a result of inefficient sorting due to poorly resolved fluorescence emission histograms as explained above. Effect of Transfer to Aqueous Medium. To determine the effect on nucleotide-coupling efficiency from the transfer of beads to and from the synthesis column, a necessary maneuver involved in moving from the aqueous flow sorting environment to the anhydrous oligonucleotide synthesis environment, the following experiments were performed. Two microsphere sets were generated by reacting BODIPY 630/650 and BODIPY 650/665 succinimidyl ester-linked dyes with the amino-functionalized, 55% DVB polystyrene microspheres derivatized with hydrocarbon linker (I). Cleavable chemical phosphorylating reagent (II) was attached initially for subsequent cleavage of synthesized oligonucleotide from

286 Bioconjugate Chem., Vol. 11, No. 2, 2000

Nanthakumar et al.

Figure 3. Sorting mixture of microspheres: FL2 (orange) histograms of (a) mixture of microspheres (1, 2, 3, 4) before sorting, (b) after sorting each component of mixture based on intensity of FL2 (orange) emission (sort 1, sort 2, sort 3, sort 4). TE, pH 8 buffer. All intensities were recorded in logarithmic scale.

Figure 4. Two-dimensional dot plot (orange FL2 vs green FL1) of mixture of microspheres 1, 2, 3, and 4 with oligo sequences 1, 2, 3, and 4, respectively, and intensity changes observed upon adding fluorescently labeled (green FL1) probes 1, 2, 3, and 4. Analysis were performed in TE (pH 8) buffer with 50% FL2-FL1 compensation. Probes 1, 2, 3, and 4 have sequences which are complementary to sequences 1, 2, 3, and 4, respectively. Histograms were recorded with FL2-FL1 50% compensation. All intensities were recorded in logarithmic scale.

support. The beads were extracted from column using PBS buffer (after each nucleotide base addition) and transferred back into synthesis column (TWIST type) via syringe attached to column body. The emission intensities of the beads were monitored using the flow cytometer

(He-Ne laser excitation). Extensive acetonitrile-washing steps were performed before each synthesis cycle to remove traces of water from support. The emission intensities of the microsphere sets remained unchanged throughout the synthesis/transfer process (data not

Technical Notes

shown), thus confirming the suitability of using BODIPY dyes to encode microspheres for oligonucleotide synthesis. After completion of T10 synthesis, the oligonucleotide was cleaved and deprotected by ammonia. The cleaved product was analyzed by capillary electrophoresis (CE) and mass spectroscopy. MALDI spectrum indicated the presence of only mass peaks indicative of full-length T10 sequence (split peaks were observed due to association of cations from PBS buffer). However, CE data showed the presence of shorter sequences presumably due to lower coupling efficiencies during the first coupling steps. Loss of capping and/or generation of new reactive sites on microsphere surface due to transfer/washing process may also account for the presence of shorter sequences. Optimization of Sorting, Synthesis, and Transfer. The above manipulations are a simulation study for synthesis by sorting protocols. Loss of beads are expected due to inefficient extraction from synthesis column as a result of beads sticking to column walls and frits. The TWIST type column is easier to manipulate since the top fitting can be removed with ease and sorting could be performed directly into columns. The flow of reagents through this column is also not impeded, thus allowing shorter reagent flow times compared with membrane filters. BODIPY dyes are available in a wide spectrum of excitation, and emission wavelengths, hence, are easily adaptable to varying excitation sources (wavelengths). The number of microsphere sets generated by covalent attachment of dye is limited by the number of available reactive sites, background emission from particles, and broad nature of histogram profiles. Supports with higher loading such as poly(ethylene glycol) grafted polystyrene polymers (tentagel) should allow generation of more fluorescently encoded microsphere sets. Problems and Limitations. Although we have successfully demonstrated sorting-directed synthesis with the four microsphere set, increasing the complexity (i.e., the size of the library) will generate new issues. For example, the sorting rate, purity, and yield will dictate the total sorting time and initial number of microspheres needed for synthesis of an oligonucleotide. Optimizing these parameters is critical to enable execution of the combinatorial approach in a meaningful time frame and with final yields appropriate for subsequent assays. Furthermore, the availability of dyes which produce little or no spectral overlap and quenching will determine the size of the library. Finally, the success of the combinatorial method of oligonucleotide synthesis ultimately would depend on finding methods to efficiently transfer beads to and from the synthesis column and flow sorter as well as minimizing losses due to aggregation of particles. Preliminary studies performed with a four-way flow sorter indicate efficient sorting is possible using 630 nm He-Ne laser excitation and a four microsphere set generated by reacting succinimidyl ester functionalized BODIPY 630/650 dye with amino functionalized polystyrene (55% DVB) microspheres (sorting purity >98%). For these studies, a custom designed curved charge plate (Cytomation, Inc.) was used to sort microspheres directly into DNA synthesis columns. In summary, we have shown efficient oligonucleotide synthesis on fluorescently encoded microspheres generated by covalent attachment of linkers and dye and demonstrated feasibility of using flow sorting to identify and separate microphere sets. Sequences synthesized on each microsphere set were identified by performing hybridization with fluorescently labeled complementary sequences.

Bioconjugate Chem., Vol. 11, No. 2, 2000 287 ACKNOWLEDGMENT

This work was supported by a grant from the National Institute of Science and Technology, Advanced Technology Program (70NANB8H4003). LITERATURE CITED (1) Mattecui, M. D., and Caruthers, M. H. (1981) Synthesis of deoxyoligonucleotides on a polymer support. J. Am. Chem. Soc. 103, 3185-3191. (2) Beaucage, S. L., and Iyer, R. P. (1992) Advances in the synthesis of oligonucleotides by the phosphoramidite approach. Tetrahedron 48, 2223-2311. (3) Beaucage, S. L., and Iyer, R. P. (1993) The functionalization of oligonucleotides via phosphoramidite derivatives. Tetrahedron 49, 1925-1963. (4) Gait, M. J., Ed. (1984) Oligonucleotide synthesis. In A Practical Approach, IRL Press, New Edition, Oxford. (5) Frank, R., Heikens, W., Heisterberg-Moutsis, G., and Blocker, H. (1983) A new general approach for the simultaneous synthesis of large numbers of oligonucleotides: segmental solid supports. Nucleic Acids Res. 13, 4365-4377. (6) Ott, J., and Eckstein, F. (1984) Filter disc supported oligonucleotide synthesis by the phosphite method. Nucleic Acids Res. 12, 9137-9142. (7) Matthes, H. W. D., Zenke, W. M., Grundstrom, T., Staub, A., Wintzerith, M., and Chambon, P. (1984) Simultaneous rapid chemical synthesis of over one hundred oligonucleotides on a microscale. EMBO J. 3, 801-805. (8) Markiewicz, W. T., Adrych-Rozek, K., Markiewicz, M., Zebrowska, A., and Astriab, A. (1994) Synthesis of oligonucleotides permanently linked with solid supports for use as synthetic oligonucleotide combinatorial libraries. In Innovation and Perspectives in Solid-Phase Synthesis: Peptides, Proteins and Nucleic Acids: Biological and Biomedical Applications (Epton, R., Ed.) pp 339-346, Mayflower Worldwide, Birmingham. (9) Watson, A., Mazumder, A., Stewart, M., and Balasubramanian, S. (1998) Technology for microarray analysis of gene expression. Curr. Opin. Biotechnol. 9, 609-614. (10) Southern, E., Mir, K., and Shchepinov, M. (1999) Molecular interactions on microarrays. Nat. Genet. 21 (Suppl), 5-9. (11) Maskos, U., and Southern, E. M. (1992) Oligonucleotide hybridisations on glass supports: a novel linker for oligonucleotide synthesis and hubridisation properties of oligonucleotides synthesised in situ. Nucleic Acids Res. 20, 16791684. (12) Hakala, H., Heinonen, P., Iitia, A and Lonnberg, H. (1997) Detection of oligonucleotide hybridization on a single microparticle by time-resolved fluorometry: Hybridization assays on polymer particles obtained by direct solid phase assembly of the oligonucleotide probes. Bioconjugate Chem. 8, 378384. (13) Hovinen, J., Guzaev, A., Azhayev, A., and Lonnberg, H. (1994) Novel solid supports for the preparation of 3′-alkyl phosphate tether groups bearing amino, carboxy, carboxamido and mercapto functionalities. Tetrahedron 50, 7203-7218. (14) Hakala, H., and Lonnberg, H. (1997) Time-resolved fluorescence detection of oligonucleotide hybridization on a single microparticle: Covalent immobilization of oligonucleotides and quantitation of a model system. Bioconjugate Chem. 8, 232-237. (15) Seliger, H., Bader, R., Hinz, M., Rotte, B., Astriab, A., Makiewicz, M., and Markiewicz, W. T. (1997) Synthetic oligonucleotide combinatorial libraries-tools for studying nucleic acid interactions. Nucleosides Nucleotides 16, 703710. (16) Fluorescent labeling using microparticles with controllable Stokes shift. Singer, V. L. and Haugland, R. P. U.S. patent 5,573,909, Nov 1996. (17) McCollum, C., and Andrus, A. (1991) An optimized polystyrene support for rapid efficient oligonucleotide synthesis. Tetrahedron Lett. 32, 4069-4072.

288 Bioconjugate Chem., Vol. 11, No. 2, 2000 (18) Reddy, M. P., and Voelker, P. J. (1988) Novel method for monitoring coupling efficiency in solid-phase peptide synthesis. J. Pept. Protein Res. 31, 345-348. (19) Reddy, M. P., Rampal, J. B., and Beaucage, S. L. (1987) An efficient procedure for the solid-phase tritylation of nucleosides and nucleotides. Tetrahedron Lett. 28, 23-26.

Nanthakumar et al. (20) Shchepinov, M. S., Case-Green, S. C., and Southern, E. M. (1997) Steric factors influencing hybridisation of nucleic acids to oligonucleotide arrays. Nucleic Acids Res. 25, 1155-1161.

BC990145Z