Solid-State Probe Based Electrochemical Aptasensor for Cocaine: A

Anal. Chem. 2010, 82, 1556–1563

Solid-State Probe Based Electrochemical Aptasensor for Cocaine: A Potentially Convenient, Sensitive, Repeatable, and Integrated Sensing Platform for Drugs Yan Du,†,‡ Chaogui Chen,†,‡ Jianyuan Yin,§ Bingling Li,†,‡ Ming Zhou,†,‡ Shaojun Dong,*,† and Erkang Wang*,† State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun, Jilin 130022, P. R. China, Graduate School of the Chinese Academy of Sciences, Beijing 100039, P. R. China, and Department of Nature Product Chemistry, Pharmacy College, Jilin University, Changchun, Jilin 130021, P. R. China Aptamers, which are artificial oligonucleotides selected in vitro, have been employed to design novel biosensors (i.e., aptasensors). In this work, we first constructed a label-free electrochemical aptasensor introducing a probe immobilization technique by the use of a layer-by-layer (LBL) self-assembled multilayer with ferrocene-appended poly(ethyleneimine) (Fc-PEI) on an indium tin oxide (ITO) array electrode for detection of cocaine. The Fc-PEI and gold nanoparticles (AuNPs) were LBL assembled on the electrode surface via electrostatic interaction. Then, cocaine aptamer fragments, SH-C2, were covalently labeled onto the outermost AuNP layer. When the target cocaine and cocaine aptamer C1 were present simultaneously, the SH-C2 layer hybridized partly with C1 to bind the cocaine, which led to a decreased differential pulse voltammetry (DPV) signal of Fc-PEI. This DPV signal change could be used to sensitively detect cocaine with the lowest detectable concentration down to 0.1 µM and the detection range up to 38.8 µM, which falls in the the expected range for medical use of detecting drug abuse involving cocaine. Meanwhile, the sensor was specific to cocaine in complex biologic fluids such as human plasma, human saliva, etc. The sensing strategy had general applicability, and the detection of thrombin could also be realized, displayed a low detection limit, and exhibited worthiness to other analytes. The aptasensor based on the array electrode held promising potential for integration of the sensing ability in multianalysis for simultaneous detection.

to specific targets.4-7 Due to the inherent selectivity, affinity, and multifarious advantages over the traditional recognition elements, aptamers have attracted more and more attention and have been widely developed in many research fields. Especially, label-free aptamer-based biosensors (i.e., aptasensors) play an important role for their simplicity, convenience, and low cost. Recently, a lot of label-free electrochemical aptasensors have been developed, and the electrochemical method mainly included electrochemical impedance spectroscopy (EIS),8-11 differential pulse voltammetry (DPV),12-17 chronocoulometry (CC),18,19 and so on. For example, a label-free reagentless aptasensor for the selective detection of the small molecule adenosine monophosphate (AMP) using EIS measurement has been reported by Willner’s group.9 We have reported a simple, label-free, and regenerative method to study the interaction between an aptamer and a small molecule using methylene blue (MB) as an electrochemical indicator.14 Shao and co-workers have developed a chronocoulometric aptasensor for AMP through detecting the (3) (4) (5) (6) (7) (8) (9) (10) (11) (12) (13)

Aptamers, which are important members of the artificial functional nucleic acids family,1-3 possess high recognition ability * To whom correspondence should be addressed. Fax: (+86) 431-85689711 (S.D. and E.W.). Tel: (+86) 431-85262101 (S.D.). Tel: (+86) 431-85262003 (E.W.). E-mail: [email protected] (E.W.); [email protected] (S.D.). † Changchun Institute of Applied Chemistry, Chinese Academy of Sciences. ‡ Graduate School of the Chinese Academy of Sciences. § Jilin University. (1) Ellington, A. D.; Szostak, J. W. Nature 1990, 346, 818–822. (2) Robertson, D. L.; Joyce, G. F. Nature 1990, 344, 467–468.

1556

Analytical Chemistry, Vol. 82, No. 4, February 15, 2010

(14) (15) (16) (17) (18) (19)

Tuerk, C.; Gold, L. Science 1990, 249, 505–510. Jayasena, S. D. Clin. Chem. 1999, 45, 1628–1650. Famulok, M.; Mayer, G.; Blind, M. Acc. Chem. Res. 2000, 33, 591–599. Tombelli, S.; Minunni, A.; Mascini, A. Biosens. Bioelectron. 2005, 20, 2424– 2434. Willner, I.; Zayats, M. Angew. Chem., Int. Ed. 2007, 46, 6408–6418. Li, B. L.; Du, Y.; Wei, H.; Dong, S. J. Chem. Commun. 2007, 3780–3782. Zayats, M.; Huang, Y.; Gill, R.; Ma, C. A.; Willner, I. J. Am. Chem. Soc. 2006, 128, 13666–13667. Elbaz, J.; Shlyahovsky, B.; Li, D.; Willner, I. Chembiochem 2008, 9, 232– 239. Du, Y.; Li, B. L.; Wei, H.; Wang, Y. L.; Wang, E. K. Anal. Chem. 2008, 80, 5110–5117. Feng, K. J.; Sun, C. H.; Kang, Y.; Chen, J. W.; Jiang, J. H.; Shen, G. L.; Yu, R. Q. Electrochem. Commun. 2008, 10, 531–535. Du, Y.; Li, B. L.; Wang, F.; Dong, S. J. Biosens. Bioelectron. 2009, 24, 1979– 1983. Wang, J. L.; Wang, F.; Dong, S. J. J. Electroanal. Chem. 2009, 626, 1–5. Lu, Y.; Li, X. C.; Zhang, L. M.; Yu, P.; Su, L.; Mao, L. Q. Anal. Chem. 2008, 80, 1883–1890. Zuo, X. L.; Song, S. P.; Zhang, J.; Pan, D.; Wang, L. H.; Fan, C. H. J. Am. Chem. Soc. 2007, 129, 1042–1043. Xiao, Y.; Lubin, A. A.; Heeger, A. J.; Plaxco, K. W. Angew. Chem., Int. Ed. 2005, 44, 5456–5459. Li, W.; Nie, Z.; Xu, X. H.; Shen, Q. P.; Deng, C. Y.; Chen, J. H.; Yao, S. Z. Talanta 2009, 78, 954–958. Shen, L.; Chen, Z.; Li, Y. H.; Jing, P.; Xie, S. B.; He, S. L.; He, P. L.; Shao, Y. H. Chem. Commun. 2007, 2169–2171. 10.1021/ac902566u  2010 American Chemical Society Published on Web 01/22/2010

Scheme 1. (A) Fabrication of the Sensing Interface and (B) Schematic Routine for Cocaine Detection

changes of the surface charge via [Ru(NH3)6]3+ (RuHex) redox in solution.19 However, these studies have their inherent disadvantages. The EIS method often uses a redox probe (Fe(CN)64-/3- probe) in electrolyte20-23 which needs timely replacement, because the Fe(CN)64-/3- probe in the electrolyte is easily metamorphic. Thus, the complicated operation is not good for the development of miniaturized sensors. MB could intercalate the nucleic acid duplexes,24,25 and RuHex could bind to anionic phosphates of DNA strands completely through electrostatic interactions,26-28 which highly depends on the DNA conformation and the type and number of DNA bases. Moreover, though both MB and RuHex are feasible redox probes, they could be used only in a nitrogen atmosphere when the electrochemical experiments were carried out. Thus, searching for effective probes attached to aptasensors is necessary for the label-free target detection. Our group had made many efforts for solid-state Ru(bpy)32+ technologies in an electrochemiluminescence (ECL) method, which can decrease the consumption of expensive reactant and enrich the ECL probe to enlarge the signal.29-32 (20) Katz, E.; Willner, I. Electroanalysis 2003, 15, 913–947. (21) Radi, A. E.; Sanchez, J. L. A.; Baldrich, E.; O’Sullivan, C. K. Anal. Chem. 2005, 77, 6320–6323. (22) Rodriguez, M. C.; Kawde, A. N.; Wang, J. Chem. Commun. 2005, 4267– 4269. (23) Xu, D. K.; Xu, D. W.; Yu, X. B.; Liu, Z. H.; He, W.; Ma, Z. Q. Anal. Chem. 2005, 77, 5107–5113. (24) Kara, P.; Kerman, K.; Ozkan, D.; Meric, B.; Erdem, A.; Ozkan, Z.; Ozsoz, M. Electrochem. Commun. 2002, 4, 705–709. (25) Kerman, K.; Ozkan, D.; Kara, P.; Meric, B.; Gooding, J. J.; Ozsoz, M. Anal. Chim. Acta 2002, 462, 39–47. (26) Lao, R. J.; Song, S. P.; Wu, H. P.; Wang, L. H.; Zhang, Z. Z.; He, L.; Fan, C. H. Anal. Chem. 2005, 77, 6475–6480. (27) Steel, A. B.; Herne, T. M.; Tarlov, M. J. Anal. Chem. 1998, 70, 4670–4677. (28) Zhang, J.; Song, S. P.; Zhang, L. Y.; Wang, L. H.; Wu, H. P.; Pan, D.; Fan, C. J. Am. Chem. Soc. 2006, 128, 8575–8580. (29) Sun, X. P.; Du, Y.; Dong, S. J.; Wang, E. K. Anal. Chem. 2005, 77, 8166– 8169. (30) Sun, X. P.; Du, Y.; Zhang, L. X.; Dong, S. J.; Wang, E. K. Anal. Chem. 2007, 79, 2588–2592. (31) Sun, X. P.; Du, Y.; Zhang, L. X.; Doug, S. J.; Wang, E. K. Chem. Asian J. 2007, 2, 1137–1141. (32) Du, Y.; Qi, B.; Yang, X. R.; Wang, E. K. J. Phys. Chem. B 2006, 110, 21662– 21666.

This research supported the development of a simple solid-state electrode platform used in microchips.33,34 Elicited by these thoughts, we first imported the “solid-state probe” technique into the label-free electrochemical aptasensor to realize drug detection. Cocaine is a powerfully addictive stimulant drug that increases the level of dopamine, a brain chemical associated with pleasure and movement, in the brain’s reward circuit. Abusing cocaine has a variety of adverse effects on the body. For example, cocaine constricts blood vessels, dilates pupils, and increases body temperature, heart rate, and blood pressure. Additionally, the Food and Drug Administration (FDA, U.S.A.) has devised a cocaine and cocaine metabolite test system to measure cocaine and cocaine metabolite (benzoylecgonine) in serum, plasma, and urine. Thus, due to its physiological significance, here, we took cocaine as the model target. The sensing strategy was shown in Scheme 1A,B. First, the electrochemical probe ferrocene (Fc) was covalently appended on poly(ethyleneimine) (PEI) to form a ferrocene-appended poly(ethyleneimine) (Fc-PEI) complex. Then, through layer-by-layer (LBL) assembly of Fc-PEI and gold nanoparticles (AuNPs), Fc molecules were immobilized on the ITO array electrode to realize the probe in “solid-state” (Scheme 1A). Finally, cocaine aptamer fragments (SHC2) were covalently labeled onto the outermost AuNP layer (Scheme 1B), and the sensing interface was formed. When the target cocaine and cocaine aptamer fragment C1 were present simultaneously, the SH-C2 layer partly hybridized with C1 to bind the cocaine, leading to a decreased DPV signal of Fc-PEI. This DPV signal change could be used to sensitively detect cocaine with the lowest detectable concentration down to 0.1 µM (∼40 ng mL-1) which is lower than the GC/MS cutoff concentration of cocaine (100 ng mL-1). Meanwhile, the sensor was specific to cocaine in complex biologic fluids such as human plasma, human saliva, etc. The sensing strategy had general applicability; the detection of thrombin could also be realized with a low detection limit and exhibited worthiness to macromolecules as protein. The sensing platform has many advantages as (33) Du, Y.; Wei, H.; Kang, J. Z.; Yan, J. L.; Yin, X. B.; Yang, X. R.; Wang, E. K. Anal. Chem. 2005, 77, 7993–7997. (34) Qiu, H. B.; Yan, J. L.; Sun, X. H.; Liu, J. F.; Cao, W. D.; Yang, X. R.; Wang, E. K. Anal. Chem. 2003, 75, 5435–5440.


1557

follows: (1) The sensing strategy provides a new model for introducing a LBL self-assembled solid-state probe method into the label-free aptasensors. (2) Such a label-free aptasensor with a redox probe on the electrode surface has the potential for general application, because the probe could not interact with DNA directly, which does not depend on the DNA conformation and the type and number of DNA bases. (3) Compared with the monomolecular layer aptasensors reported previously, the LBL multilayer with a three-dimensional structure could immobilize more redox probes, resulting in better sensitivity of the sensor. Additionally, AuNPs could increase the electrode areas which could bring in more molecular recognition elements (here, the aptamer) to improve the sensitivity of the sensor. (4) Fc as a good electron transfer mediator exhibits a well-defined stable reversible redox behavior. Compared with MB and RuHex used in the label-free aptasensor, it is not necessary for the Fc probe to be in a nitrogen atmosphere when the electrochemical experiment occurs. (5) Compared with other noble metal array electrodes, the ITO array electrode is cheap, conveniently pretreated, and easily integrated. Meanwhile, the aptasensor based on the array electrode can realize the simultaneous detections of several samples. The designed sensor held promising potential for integration of the sensing ability in multianalysis for simultaneous detection. EXPERIMENTAL SECTION Chemicals and Materials. Oligonucleotides purified by HPLC, the thrombin-binding aptamer (SH-TBA, 5′ TTTTTAAAAAAAAAAAAAAAGGTTGGTGTGGTTGG 3′), the cocaine aptamer fragment (SH-C2, 5′HS-(CH2)6-TTTTTGGGAGTCAAGAACGAA 3′), and the other cocaine aptamer fragment (C1, 5′ TTCGTTCTTCAATGAAGTGGGACGACA 3′) were synthesized by Shanghai Sangon Biotechnology Co. Ltd. (Shanghai, China). The concentrations of oligonucleotides were determined using the 260 nm UV absorbance and the corresponding extinction coefficient. Tris(2-carboxyethyl)phosphine hydrochloride (TCEP) was purchased from Bio Basic Inc. (Markham Ontario, Canada). Cocaine hydrochloride, pethidine hydrochloride, and methadone hydrochloride were purchased from the National Institute for the Control of Pharmaceutical and Biological Products (Changchun, China). R-Thrombin, bovine serum albumin (BSA), and lysozyme were bought from Sigma (Missouri). The other chemicals were of analytical grade. 2-Mecaptoethanol (MCE) was dissolved in the Tris-HAc buffer (10 mM Tris-HAc, pH ) 7.4). SH-DNA samples were dissolved in the Tris-HCl buffer (25 mM Tris-HCl, 300 mM NaCl, 80 µM TCEP, pH ) 8.2). Other samples were prepared in the Tris-HCl buffer (T-buffer, 20 mM Tris-HCl, 140 mM NaCl, 5 mM KCl, 5 mM MgCl2, pH ) 7.4). All the stock and buffer solutions were prepared using distilled water and stored at 4 °C before use. Instrumentation. Differential pulse voltammetry (DPV) measurements were carried out on an Autolab PGSTAT30 (The Netherlands, controlled by GPES4 and Fra software) in 100 mM PBS buffer (pH ) 6.5). The parameters adopted were as follows: modulation time, 50 ms; interval time, 0.5 s; modulation amplitude, 25 mV; potential step, 5 mV; and voltage range from 0.7 to 0 V. The raw voltammograms were treated using the Savitzky and Golay filter (level 2) included in the General Purpose Electro1558


chemical software (GPES) of Eco Chemie (The Netherlands) with moving average baseline correction.35 Cyclic voltammetry (CV) measurements were performed with a model CH Instrument 800 electrochemical workstation (Shanghai Chenhua Equipments, China). A three-electrode system consisting of the ITO array working electrode (5 mm in diameter), an Ag-AgCl reference electrode, and a platinum wire counter electrode. The cell was housed in a homemade Faraday cage to reduce stray electrical noise. All the electrochemical measurements were performed at room temperature at about 22-25 °C. Atomic force microscopy (AFM) was performed on a SPI3800N microscope instrument (Seiko Instruments, Inc., Japan) in tapping-mode in air at ambient temperature. Preparation of ITO Array Electrode. The whole ITO array electrode was 5 cm × 7 cm and contained six independent electrodes. The diameter of each electrode and the electrode-electrode spacing were both 5 mm. The desired ITO electrode arrays were fabricated by a modified photolithographic.33,34 Briefly, the ITO electrode arrays were treated with ethanol and distilled water to get a clean surface. Positive photoresist (RZJ-390) was spin-coated on ITO surface with spinning at 3000 rpm for 30 s. After being preheated for 100 s at 100 °C, the photoresist layer coated ITO slides were covered by a photoresist mask (the photoresist mask with desired electrode pattern was first designed in a computer and printed with a high-resolution laser printer (3000 dpi)) and exposed under UV light by Lithography System (JKG-2A Model). The exposed photoresist part was easily removed by 0.1 M NaOH, and the revealed ITO layer could be developed by wet chemical etching using the mixed solution (HCl/FeCl3/H2O ) 1:2:1). The desired ITO electrode protected by the remaining photoresist was the only thing left. After removing the remaining photoresist, the as-prepared ITO array electrode was cleaned and stored for use in the next step. Fabrication of Array Sensing Interface. The Fc-PEI was synthesized according to previous literature.36 The as-prepared ITO electrode array was cleaned by ultrasonication in an ethanol aqueous solution saturated with NaOH, acetone, ethanol, and distilled water, respectively, to provide a negatively charged clean surface. As shown in Scheme 1A, the negatively charged ITO substrate was first covered with a polydimethylsiloxane (PDMS) frame containing a cuboid cell which could expose all the separated electrodes. An incubation of 20 min was performed after PEI aqueous solution (0.5 mg mL-1, containing 0.5 M NaCl) was added into the cell. Another similar incubation is needed after poly(sodium 4-styrenesulfonate) (PSS) aqueous solution (0.5 mg mL-1, containing 0.5 M NaCl) was added into the cell. The Fc-PEI/AuNPs multilayer was grown on the PSS-terminated film by alternately adding the Fc-PEI (pH 6.0) and AuNP solution (22 nM) into the cell and incubating for 20 min, respectively. This process was repeated twice to obtain the (Fc-PEI/AuNPs)2 multilayer. After that, the PDMS frame was removed, and the resulting membranes were carefully washed with distilled water thoroughly and dried in a nitrogen stream. Then, another PDMS frame containing six wells was aligned onto the ITO array electrode, and each could exactly match (35) Erdem, A.; Papakonstantinou, P.; Murphy, H. Anal. Chem. 2006, 78, 6656– 6659. (36) Hodak, J.; Etchenique, R.; Calvo, E. J.; Singhal, K.; Bartlett, P. N. Langmuir 1997, 13, 2708–2716.

Scheme 2. Schematic Routine for Thrombin Detection

the modified working electrodes well. The sensing interface ((Fc-PEI/AuNPs)2/SH-C2/MCE) was prepared by placing 50 µL of the freshly prepared 2 µM SH-C2 solution on the multilayer modified ITO electrode into each incubation chamber, covering the PDMS frame with a glass slide to prevent the solution from evaporating (Scheme 1B). The assembly was kept 16 h at room temperature and then rinsed with pure water thoroughly. Then, the electrode array was dried in a nitrogen stream, after which the interface was covered with 20 µL of MCE (10 mM Tris-HAc, pH ) 7.41) and kept at room temperature for 1 h, followed by rinsing with pure water. The sensor was obtained after being dried with nitrogen. Electrochemical Detection of Cocaine. The as-prepared sensing interfaces were measured using DPV to collect the electrochemical signals of Fc in PBS buffer. Then, 50 µL samples containing 40 µM C1 and different concentrations of cocaine were added into each incubation chamber and incubated for 40 min. After that, the decreased DPV signal of the Fc was measured. Control experiments were also carried out. Five millimolar ecgonine, 5 mM pethidine, and 5 mM methadone (in T-buffer) containing 40 µM C1 were added into the incubation chamber and incubated for 40 min, respectively. For stability detection, the final sensing electrode was immersed in distilled water and stored at 4 °C. Application of the Cocaine Aptasensor in the Biological Assay. Four kinds of biological fluids were used to confirm the applicability of this aptasensor: human plasma, human serum, human saliva, and human urine. Fresh human plasma and human serum were obtained from the local hospital. Human saliva and human urine were harvested from a member of our laboratory. The saliva was collected 15 min after gargling. The saliva and urine were centrifuged at 4000g at room temperature for 15 min to remove the precipitates. The cocaine solutions in biological fluids were prepared by mixed 7.8 µM cocaine (in T-buffer) and 50% biological fluid (in T-buffer) with the ratio of 1:1. The final concentration of cocaine was 3.8 µM in 25% biological fluids. All the experiment conditions were the same as the foregoing detection in the ordinary buffer. Generality of the Aptasensing for Detection of Thrombin. As a further step, we attempted to prove the general applicability of our strategy by replacing SH-C2 with SH-TBA (Scheme 2). After the sensing interfaces were completely obtained, the thrombin solutions were added into each incubation chamber and incubated for 1 h, and they were measured using DPV. A copious amount of distilled water was used to clean the sensing interface before successive measurement. For control experiments, the sensing interfaces were treated with 50 µg mL-1 BSA and 50 µg mL-1 lysozyme solution (in T-buffer) for 1 h, respectively.

RESULTS AND DISCUSSION Assembly (Fc-PEI/AuNPs)2 Multilayer, Fabrication, and Characterization of the Integrated Sensing Interface. The ninhydrin test was used to evaluate the fraction of amino groups that remained in PEI after its modification with Fc.37 The result indicated that about 26% of the PEI amino groups reacted with Fc and the Fc-PEI still held its positive charge. In this sensing strategy (Scheme 1A), the positively charged Fc-PEI was first assembled on the negatively charged ITO electrode through electrostatic interaction, followed by a negatively charged AuNP assembly. After recycling this LBL assembly twice, more redox probes and more AuNPs were immobilized onto the electrode interface in proportion. After recycling LBL assembly of the Fc-PEI and AuNPs, more redox probes and more AuNPs were immobilized onto the electrode. More probes could bring larger detection signals to improve the sensitivity of the sensor, and more AuNPs would enlarge the electrode area to bring more capture probes (here, SH-C2). To characterize the morphology of the LBL multilayer of (Fc-PEI/AuNPs)2, AFM was performed. Figure 1A exhibited an AFM image of the bare ITO electrode surface. By assembling one layer of Fc-PEI/AuNPs, the ITO electrode surface shows a significant change of the surface morphology. By assembling one bilayer of Fc-PEI/AuNPs, the ITO surface morphology showed a significant change. The assembled AuNPs on the electrode surface were uniformly distributed, but the underlying surface structure of ITO could still be visible (Figure 1B). After the multilayer of (Fc-PEI/AuNPs)2 was assembled, the surface morphology was changed further (Figure 1C). A significantly and uniformly distributed AuNP film was obtained. This indicated that after LBL assembly, the final electrode surface used was compacted with AuNPs as a film. The sensing interface was fabricated by functionalizing the AuNP film on the ITO electrode array with the SH-C2 strand (Scheme 1B). After that, MCE was used as a blocker to make the array of SH-C2 on the electrode interface more regular. The final sensing interface ((Fc-PEI/AuNPs)2/SH-C2/MCE) showed a remarkable repeatability (see latter description). CV was used first to validate the fabrication of the sensing interface and the detection of cocaine. In Figure 2, the multilayer of (Fc-PEI/ AuNPs)2 showed a large current of Fc. After assembling SHC2, the CV response obviously was reduced, because the peakto-peak separation (∆Ep) remained the same in CVs of (Fc-PEI/ AuNPs)2 and (Fc-PEI/AuNPs)2/SH-C2, which may come from the reduced apparent diffusion coefficient of the eletroactive species (Fc). After MCE assembly, the CV response was further reduced compared with the signal of (Fc-PEI/ AuNPs)2. By placing 50 µL samples containing 40 µM C1 and cocaine on the prepared electrode, the CV response kept on decreasing with an increased ∆Ep, which showed the SH-C2 layer partly hybridized with C1 to bind the cocaine and the SH-C2/cocaine/C1 complexes attached on the electrode surface, resulting in blocking the electrode surface with a partially covered adsorption layer. The larger the coverage, the slower was the apparent electron transfer. This was consistent with the partially blocked electrode reported by Amatore.38 (37) Wei, X.; Cruz, J.; Gorski, W. Anal. Chem. 2002, 74, 5039–5046. (38) Amatore, C.; Savieant, J. M.; Tessier, D. J. Electroanal. Chem. 1983, 147, 39–51.


1559

Figure 1. Morphology of the sensing interfaces along with fabrication processes characterized using AFM. The images of the bare ITO electrode (A), the layer of Fc-PEI/AuNPs on the ITO electrode (B), and the multilayer of (Fc-PEI/AuNPs)2 on the ITO electrode (C).

Figure 2. Formation of the integrated sensing interface on the ITO electrode measured using cyclic voltammetry (CV). Cyclic voltammograms (CVs) from top to bottom: the LBL multilayer of (Fc-PEI/ AuNPs)2, SH-C2, MCE, and 20 µM cocaine.

Detection of Cocaine. For cocaine detection (Scheme 1B), the as-prepared functional integrated sensing interfaces were covered with a series of cocaine solutions containing 40 µM C1, respectively, and a significant peak current decrease for Fc reduction was observed. It testified that when cocaine existed, the two strands SH-C2 and C1 would partly hybridize together to form a folio heterodimer which still remained on the electrode. The formed SH-C2/cocaine/C1 complex resulted in a decreasing electrochemical reaction of the Fc attached to the electrode surface.

To investigate the effect of different concentrations of C1, the prepared (Fc-PEI/AuNPs)2/SH-C2/MCE sensing interfaces were treated with 50 µL of different concentrations of C1 solution (without cocaine) at room temperature. As shown in Figure 3A, when the concentration of C1 was over 50 µM, an obvious DPV signal decrease was observed. The reason may be as follows: As we knew, the aptamer, split into two fragments, would equilibrate between its two dissociated parts and a folded complex. When the concentrations of the two strands were high enough, they could hybridize by themselves without cocaine. In this sensing system, we found that, only when the concentration of C1 was not higher than 50 µM, the interference from this strand could be ignored. When the concentration of C1 was 50 µM, i/i0 got a correspondingly large relative standard deviation (RSD ) 0.038). To obtain a stable response, 40 µM C1 (RSD ) 0.017) was employed when the experiment was carried out. It was evident that different immersion times might cause different responses. To determine the optimum operation time for cocaine detection, the kinetic experiment was done. The DPV signal was recorded, and the results were shown in Figure 3B. The peak current of Fc was decreased significantly when 40 µM cocaine containing 40 µM C1 was placed on the sensing interface and reached a plateau at about 40 min. Therefore, 40 min was used to detect cocaine in this sensing system. In the quantitative analysis, the prepared (Fc-PEI/AuNPs)2/ SH-C2/MCE sensing interface was treated with different

Figure 3. (A) DPV response of sensing interface with different concentrations of C1 when cocaine was absent. (B) The time-dependent DPV signal response for cocaine detection. i/i0: i represented the peak current of the sensor after each detection, and i0 represented the blank peak current, the current of the (Fc-PEI/AuNPs)2/SH-C2/MCE system. 1560


Figure 4. (A) DPV response of sensing interface to cocaine at different concentrations. DPV response to cocaine, (a) 0 M, (b) 0.1 µM, (c) 0.3 µM, (d) 0.8 µM, (e) 1.8 µM, (f) 3.8 µM, (g) 8.8 µM, (h) 18.8 µM, (i) 38.8 µM, and (j) 88.8 µM; (B) The relative response of the integrated aptasensor to different concentrations of cocaine (from 0.1 µM to 88.8 µM). Inset: A linear detection range was from 0.1 to 38.8 µM. The average of the RSD is 0.0334.

Figure 5. Selectivity of the integrated sensing interface. Cocaine (3.8 µM) showed an evident decrease in the DPV signal (A). No significant changes of DPV responses for 5 mM ecgonine (B), 5 mM pethidine (C), and 5 mM methadone (D).

amounts of cocaine in the presence of 40 µM C1. After a 40 min incubation, SH-C2/cocaine/C1 complex was formed on the sensing interface, which led to a decrease of DPV in different degrees. As shown in Figure 4A, the decrease of DPV signals were directly related to the concentration of cocaine, which was consistent with the CV responses (Figure 2). In Figure 4B, i/i0 was used to evaluate the DPV cathodal peak current response to cocaine. There was a linear relationship between i/i0 and logarithmic cocaine concentration from 0.1 to 38.8 µM (R2 ) 0.9997). Meanwhile, the lowest detectable concentration as low as 0.1 µM was obtained, which was more sensitive than most available cocaine aptasensors.39-42 Selectivity, Repeatability, and Stability of the Sensing Interface. The two analgesic drugs (pethidine and methadone) and the complete hydrolyzate of cocaine (ecgonine) were used for control experiments to testify the selectivity of this sensing platform (Figure 5). It was observed that 3.8 µM cocaine led

to an evident DPV change (Figure 5A). While when cocaine was replaced by 5 mM ecgonine, 5 mM pethidine, and 5 mM methadone, respectively, the sensing interfaces hardly showed Table 1. Detection of Cocaine in Biologic Fluids Ccocaine ) 0 µM biologic fluids T-buffer 25% human 25% human 25% human 25% human

i/i0a

0.981(±0.017) plasma 0.995(±0.059) serum 1.005(±0.085) saliva 1.038(±0.022) urine 1.013(±0.083)

Ccocaine ) 3.8 µM

recoveryb

i/i0

recovery

100% 101.4% 102.4% 105.8% 103.2%

0.435(±0.063) 0.432(±0.053) 0.458(±0.030) 0.418(±0.088) 0.447(±0.083)

100% 99.3% 105.2% 96.1% 102.7%

a i/i0 means the response of DPV measurements. i represented the peak current of the sensor after detected cocaine, and i0 represented the blank peak current, the current of the (Fc-PEI/AuNPs)2/SH-C2/ MCE system. b Recovery means the ratio of {i/i0 (biologic fluids)}/ {i/i0 (T-buffer)}.


1561

Figure 6. (A) Cyclic voltammograms (CVs) of the integrated sensing interface and the detection of thrombin. The CVs from top to bottom: the LBL multilayer of (Fc-PEI/AuNPs)2, SH-TBA, MCE, and 50 ng mL-1 thrombin. (B) The DPV response of integrated sensing interface to thrombin at different concentrations from 0.1 to 116.6 ng mL-1. Inset: A linear detection range was from 0.1 to 66.6 ng mL-1. The average of RSD is 0.0266. (C) Control experiment for 50 µg mL-1 BSA, 50 µg mL-1 lysozyme, T-buffer, and 16.6 ng mL-1 thrombin.

any change of DPV (Figure 5B-D), which proved the cocaine aptamer was highly specific to cocaine. Besides the high sensitivity and selectivity, the satisfactory performance of the sensing interface embodies the other two aspects. On one hand, the DPV responses of (Fc-PEI/AuNPs)2/ SH-C2/MCE on different electrodes of the ITO array were always the same. (The average reductive peak current was 1.495 µA, RSD ) 0.15, n ) 28.) It shows a remarkable repeatability of the fresh sensing interface. On the other hand, the (Fc-PEI/AuNPs)2/SH-C2/MCE modified ITO array was stored in distilled water at 4 °C over 15 days and then was recovered to room temperature slowly. It was observed that the peak current of the conserved sensing interface exhibited almost the same value as the sensor before cooling treatment (only increased 4%, RSD ) 0.026). The little increase may be ascribed to the partial degradation of the DNA. Moreover, the sensing interface stored in this condition can still be used for detection of cocaine (data not shown). This indicates the stability of the sensing interface. Application of the Versatile Cocaine Aptasensor in the Biological Assay. The feasibility of the integrated aptasensor for practical applications was investigated by analyzing several real samples in comparison with the results of cocaine detection in T-buffer. We chose human plasma, human serum, human saliva, and human urine as four complex biological fluids. In the 25% biological fluids, different concentrations of standard solutions of cocaine were detected by DPV measurement. i/i0 was also used to assess the cocaine detection ability. The results were shown in Table 1. The integrated sensing platform to detect cocaine was not affected much when cocaine existed in these biological fluids. It obviously indicated that there were no significant differences among the cocaine detection in these assays. The results definitely illuminate the potential application of this aptasensor in practical samples. Generality of the Aptasensing for Detection of Thrombin. It was well-known that thrombin was a major target for anticoagulation and cardiovascular disease therapy because of its pivotal (39) Baker, B. R.; Lai, R. Y.; Wood, M. S.; Doctor, E. H.; Heeger, A. J.; Plaxco, K. W. J. Am. Chem. Soc. 2006, 128, 3138–3139. (40) Freeman, R.; Sharon, E.; Tel-Vered, R.; Willner, I. J. Am. Chem. Soc. 2009, 131, 5028–5029. (41) Stojanovic, M. N.; de Prada, P.; Landry, D. W. J. Am. Chem. Soc. 2001, 123, 4928–4931. (42) Stojanovic, M. N.; Landry, D. W. J. Am. Chem. Soc. 2002, 124, 9678–9679.

1562


role in both thrombosis and hemostasis.43 Thus, as a further step, we attempted to fabricate another sensing strategy for thrombin using the SH-TBA to testify the generality of the integrated sensing platform. In Scheme 2, instead of the SH-C2, SH-TBA was covalently labeled onto the multilayer of (Fc-PEI/AuNPs)2. After MCE assembly, the sensing interface of (Fc-PEI/AuNPs)2/ SH-TBA/MCE could be used to detect thrombin directly. When thrombin was present, the SH-TBA strand would catch the target molecules and the thrombin-TBA complex formed still remained on the electrode. This sensing strategy was testified by CV measurement for qualitative detection of thrombin. In Figure 6A, when thrombin existed, the CV response was reduced significantly compared with the signal of sensing interface of (Fc-PEI/AuNPs)2/SH-TBA/ MCE. The sensitive thrombin detection was shown in Figure 6B; the sensing interface could detect thrombin with the lowest detectable concentration of 0.1 ng mL-1. The linear detection range between i/i0 and the logarithm of thrombin concentration is from 0.1 to 66.6 ng mL-1 (R2 ) 0.9965). Control experiments were also done in this sensing strategy. The sensing interfaces were covered with 50 µg mL-1 BSA, 50 µg mL-1 lysozyme, T-buffer, and 16.6 ng mL-1 thrombin in the same experimental conditions, respectively. In Figure 6C, the peak current of Fc reduction was reduced significantly only with thrombin. This means that the two kinds of proteins could not interact with the LBA and interfere in the detection of thrombin. CONCLUSION Here, a label-free functional integrated electrochemical aptasensor, introducing a solid-state probe immobilization technique for drug cocaine detection on the ITO array electrode, is first developed using DPV measurement. The detection is based on an LBL self-assembled multilayer of (Fc-PEI/AuNPs)2 sensing platform. In this measurement, the lowest detectable concentration of cocaine is 0.1 µM, and the linear detection range extends up to 38.8 µM. To prove the general applicability of the sensing strategy, the detection of thrombin can also be realized and displayed a lowest detectable concentration of 0.1 ng mL-1. The detection range is from 0.1 to 66.6 ng mL-1. It also exhibits huge investigation worthiness to other analytes. (43) Paborsky, L. R.; McCurdy, S. N.; Griffin, L. C.; Toole, J. J.; Leung, L. L. K. J. Biol. Chem. 1993, 268, 20808–20811.

These sensing results prove that the integrated sensing strategies developed possess good sensitivity, repeatability, stability, and generality. The solid-state probe used is controllable and convenient in the label-free electrochemical apatasnsors, and the signal from the solid-state probe does not depend on the property of DNA. Meanwhile, the solid-state probe shows a high potential application in the integrated array electrode, for it can bring a relatively replicable signal for an integrated electrode. Furthermore, the fabrication of ITO array electrode is very simple and controllable, which facilitates the future design of the integrated electrode according to the different requirements. Moreover, the integrated aptasensing

platform holds promising potential for integration of the sensing ability, especially the simultaneous detection in multianalysis. ACKNOWLEDGMENT This work was supported by the National Natural Science Foundation of China, Grant Nos. 20820102037 and 20935003 and 973 projects 2009CB930100 and 2010CB933600.

Received for review November 10, 2009. Accepted January 10, 2010. AC902566U


1563

Solid-State Probe Based Electrochemical Aptasensor for Cocaine: A

Recommend Documents