Solution NMR Structure and Backbone Dynamics of the Partially

Subscriber access provided by READING UNIV

Article

Solution NMR Structure and Backbone Dynamics of the Partially Disordered Arabidopsis thaliana Phloem Protein 16-1, A Putative mRNA Transporter Pulikallu Sashi, Kiran Kumar Singarapu, and Abani K Bhuyan Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.7b01071 • Publication Date (Web): 10 Jan 2018 Downloaded from http://pubs.acs.org on January 10, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Biochemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Solution NMR Structure and Backbone Dynamics of the Partially Disordered Arabidopsis thaliana Phloem Protein 16-1, A Putative mRNA Transporter

Pulikallu Sashi,1 Kiran K. Singarapu,2 and Abani K. Bhuyan1,* 1

2

School of Chemistry, University of Hyderabad, Hyderabad 500046, India Innovation Plaza, Integrated Product Development Organization, Dr. Reddy’s Laboratory,

Hyderabad 500090, India

Correspondence: [email protected]

Short title:

Structure of the mRNA transporter AtPP16-1

Keywords:

Phloem protein, RNA-binding protein, intrinsically disordered protein, RBP, IDP, AtPP16

1 ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 46

ABSTRACT Although RNA-binding proteins in plant phloem are believed to carry out long-distance systemic transport of RNA in the phloem conduit, the structure of none of them is known. The Arabidopsis thaliana phloem protein 16-1 (AtPP16-1) is such a putative mRNA transporter whose structure and backbone dynamics have been studied at pH 4.1, 25°C, by high-resolution NMR spectroscopy. Results obtained using basic optical spectroscopic tools show that the protein is unstable with little secondary structure near the physiological pH of the phloem sap. Fluorescence-monitored titrations reveal that AtPP16-1 binds not only A. thaliana RNA (Kdiss ~ 67 nM) but also sheared DNA and model dodecamer DNA, albeit the affinity for DNA is ~15fold less. In the solution structure of the protein secondary structural elements are formed of residues 3−9 (β1), 56−62 (β2), 133−135 (β3), and 96−110 (α-helix). Most of the rest of the chain segments is disordered. The N-terminal disordered regions (residues 10−55) form a small lobe, which conjoins the rest of the molecule via a deep and large irregular cleft that could have functional implications. The average order parameter extracted by model-free analysis of

15

N

relaxation and {1H}−15N heteronuclear NOE data is 0.66, suggesting less restricted backbone motion. The average conformational entropy of the backbone NH vectors is −0.31 cal mol-1 K-1. These results also suggest structural disorder in AtPP16-1.


Page 3 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

INTRODUCTION Phloem in plants is a highly organized traffic conduit by which nutrients, minerals, amino acids, sugars, peptides and proteins, and RNAs are transported over long distances from source to sink.1−7 The phloem route in fact is most suitable for RNA transport because of minimal RNase activity in the phloem sap,8 although 3′−5′ exoribonuclease activity has been found in the phloem of some plant species.9 Transported RNA types include viral RNA genomes, and mRNA, miRNA, siRNA, ribosomal RNA, tRNA, and several non-coding smaller RNAs such as micro RNAs that are endogenous to the host cells.6,7,10−12 In recent years, a large class of proteins called RNA-binding proteins (RBPs) has been described that are not only involved in the regulation of post-transcriptional fate of mRNAs in eukaryotic cells,13−16 but also have been suggested or demonstrated to take part in long-distance systemic transport of RNAs in plants.2,17 Indeed, enormous diversity of RBPs allows for the formation of RNA-specific ribonucleoprotein.15 Focusing on plant RBP, Cucurbita maxima phloem protein 16 (CmPP16), an archetypal 16 kDa RBP expressed in companion cells, has been shown to perform some appealing functions. It interacts with plasmodesmata to enlarge the pore size so as to facilitate its own passage, binds mRNA in the companion cell and crosses the plasmodesmata along with the bound mRNA into the sieve element for transportation in the phloem conduit.18 It has also been shown that CmPP16 is translocated freely to the shoot or bud regions by the bulk flow in the phloem, but its translocation toward the root is regulated, suggesting that the mechanism of mRNA transport is destination-dependent.19 Evidences suggest that the phloem protein PP2, called CmPP2, is also involved in long-distance RNA transport.20,21 In fact, the presence of a large number of RNA−RBP complexes in the phloem


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

sap has been described,3,9,22−25 although actual functions of the complexes remain to be established. Some RBPs appear to be specifically induced by stimulus, and many are specific to species and tissue types, and may even be specific to developmental stages of plants.26 Such observations suggest that they may be involved in diverse functions, even though the details of in vivo function are not understood. The genome of A. thaliana encodes for at least 200 different RBPs.27 Two close homologs of CmPP16 found in A. thaliana are the 17 kDa proteins AtPP16-1 and AtPP16-2, both expressed highly in flower and stem, but sparsely or not at all in the leaf.28 Sequence alignment (Figure 1A) shows that CmPP16 and AtPP16 share 23% conserved amino acid positions, and AtPP16-1 and AtPP16-2 are identical by 35%. The homology and sequence conservation provide a hint that AtPP16 may serve to bind RNA as does CmPP16, and 35% sequence conservation within AtPP16-1 and AtPP16-2 appears to suggest that they are functionally similar. These presumptions provide rationales to inquire into the structure and function of AtPP16. Since not much is known about RBP structures and in vivo roles of RBP in phloem transport, a structural study was taken up with AtPP16-1. The possibility that the AtPP16 proteins could be RBPs also leads one to cogitate about its structural order. Many RBPs are now known to contain structurally disordered regions29−31 that presumably promote binding with RNA, and consequently undergo disorder-to-order transition.32,33 In fact, structural disorder associated with mRNA-transport proteins has also been suggested.34 Such conformationally ill-defined proteins are called intrinsically disordered proteins (IDPs), which account for at least 33% of human proteins.35 The inherent disorder is thought to be a requirement for binding with proteins and ligands, and a large body of available evidences shows that ligand binding leads to folding of the disordered regions36−44 even though 4 ACS Paragon Plus Environment

Page 4 of 46

Page 5 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

some studies have also found retention of considerable structural disorder in the ligand-bound form.45−47 IDPs are thus attractive for studies of structure-function relationships and ligand recognition mechanisms. CmPP16 MGMGMMEVHL ISGKGLQAHD PLNKPIDPYA EINFKGQERM SKVAKNAGPN 50 AtPP16-1 MAVGILEVSL ISGKGLKRSD FLGK-IDPYV EIQYKGQTRK SSVAKEDGGR 50 AtPP16-2 MPHGTLEVVL VSAKGLEDAD FLNN-MDPYV QLTCRTQDQK SNVAEGMGTT 50 CmPP16 PLWDEKFKFL AEYPGSGGDF HILFKVMDHD AIDGDDYIGD VKIDVKNLLA 100 AtPP16-1 PTWNDKLKWR AEFPGSGADY KLIVKVMDHD TFSSDDFIGE ATVHVKELLE 100 AtPP16-2 PEWNETFIFT V----SEGTT ELKAKIFDKD VGTEDDAVGE ATIPLEPVFV 100 CmPP16 EGVRKGKSEM PPRMYHVLAH KIHFKGEIEV GVSFKLQGGG --GCGG--CN 150 AtPP16-1 MGVEKGTAEL RPTKYNIVDS DLSFVGELLI GVSYSLLQDR --GMDGEQFG 150 AtPP16-2 EG------SI PPTAYNVVKD E-EYKGEIWV ALSFKPSENR SRGMDEESYG 150 CmPP16 PWEN----- 159 AtPP16-1 GWKHSQVD- 159 AtPP16-2 GWKNSEASY 159

A MAVGILEVSL ISGKGLKRSD FLGKIDPYVE IQYKGQTRKS SVAKEDGGRN 50 PTWNDKLKWR AEFPGSGADY KLIVKVMDHD TFSSDDFIGE ATVHVKELLE 100 MGVEKGTAEL RPTKYNIVDS DLSFVGELLI GVSYSLLQDR GMDGEQFGGW 150 KHSNVD 156

B

Figure 1. Homology of CmPP16 and AtPP16, and expression of AtPP16-1. (A) Alignment of sequences of CmPP16, AtPP16-1, and AtPP16-1 to show homology and sequence conservation. (B) The sequence of the recombinant AtPP16-1 shows a benign Q→N substitution.

Determination of IDP structure is however a challenge most often due to largely unstable structures of these proteins. Nevertheless, disordered regions in some proteins and the importance of such disorder in function have been recognized since early days of X-ray crystallography.48−51 The sensitivity of NMR is enhanced due to rapid internal motions in 5 ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 46

structurally disordered proteins. Solution structures of some IDPs have been obtained by NMR,36−38,45−47,52,53 but structures determined are fewer given the widespread prevalence of IDPs. Plant IDPs in particular have been barely studied in detail notwithstanding the multitude of functions they perform. Based on these rationales we cloned, purified, and characterized AtPP16-1 to establish its basic properties, including RNA and DNA binding affinities, and then solved its solution NMR structure. Backbone

15

N relaxation and 1H−15N order parameters of

resolved residues are also described.

MATERIALS AND METHODS Cloning of A. thaliana Phloem Protein Atpp16-1. Total RNA was isolated from the A. thaliana leaf, and cDNA was synthesized from the total RNA using the following primers. NcoI Atpp16-1 Forward

5′

CATGCCATGGCTGTTGGAATCCTTGAGGTTA

3′

Atpp16-1 Reverse

5′

ACCGCTCGAGATCAACGTTGCTATGCTTCCATC

3′

Xho1 The synthesized cDNA was cloned into pTZ57R/T by TA ligation, and positive recombinant plasmids were isolated and sequenced. The Attp16-1 gene was released from the TA vector and sub-cloned between NcoI and Xho1 sites of pET28a(+) vector. The sequence-confirmed plasmid was transformed into Rosetta (BL21 lacZY) and BL21(DE3)RIL cells for protein expression.

Protein Expression and Purification. Recombinant AtPP16-1 was overexpressed in BL21(DE3)RIL strain of E. coli cells harboring the protein expression vector pET28a(+). Cells


Page 7 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

were grown at 37ºC in LB medium containing kanamycin (50 µg mL−1), and protein expression was induced at A600 ~ 0.5 with 0.5-1 mM IPTG for 4 hours. Cells were harvested by centrifugation at 10,000 rpm for ~10 minutes and suspended in a pH 8 buffer consisting of 20 mM Tris, 50 mM NaCl and 4 mM imidazole. Suspended cells were sonicated for ~ 4 minutes, and centrifuged at 15,000 rpm at 4ºC to remove the cell debris. The supernatant was loaded in a nickel affinity column equilibrated in the same buffer. A pre-elution step, by which unwanted proteins bound to the Ni-NTA matrix is eliminated, was carried out using 20 mM Tris, 50 mM NaCl, 50 mM imidazole, pH 8. Elution of bound AtPP16-1 was done by raising the imidazole level in this buffer to 150 mM. Chromatography involved a AKTAexplorer FPLC system. The eluted protein was dialyzed extensively against 100 mM acetic acid (pH~ 3.7), and subjected to SDS-PAGE to ascertain the purity. All steps from cell harvesting to dialysis were carried out at 4°C. For

15

N- and

13

C-labeling, cells were grown in the standard M9 medium. A mixture of

Na2HPO4 (6 g), KH2PO4 (3 g), NaCl (0.5 g), 15NH4Cl (1 g), and 13C-glucose (4 g) was dissolved in water up to 1 L, and autoclaved at 10 lb pressure for ~ 20 min. After cooling the medium, 100 µL of 1 M CaCl2, and 2 mL of 1 M MgSO4, each separately autoclaved already, were added to it. Then were added 1 mL of a 0.22 µM membrane-filtered thiamine solution (4 mg mL-1), and 1 mL of a 50 mg mL-1 kanamycin solution. Supplementing the medium with amino acids was not required. For single isotope labeling, either 15NH4Cl or 13C-glucose was excluded. To inoculate the M9 medium, BL21(DE3)RIL cells containing the pET28a(+) protein-expressing vector were separately grown in 100 mL of LB broth as a primary culture. Cells pelleted from the primary culture by centrifugation were suspended in the M9 medium, and grown at 180 rpm orbital motion for ~ 4 h before inducing protein production by adding IPTG to a final concentration of


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

0.5-1 mM. Cells grown up to ~8 h after IPTG addition were harvested by centrifugation at 10,000 rpm for ~ 10 minutes. The procedures for treatment of harvested cells and purification of the isotope-labeled protein were identical as described above for the unlabeled protein.

pH titration. Buffers used were Glycine-HCl (pH 2−3), sodium acetate (pH 3.5−5.5), sodium phosphate (pH 6−7.5), Tris (pH 7.5−9), and CAPS (pH 9−11), each in the 7−10 mM in concentration. The final AtPP16-1 concentration in each sample was ~15.5 µM. Samples were equilibrated at 25ºC for ~2 hours before spectral measurement. Reported pH values are those determined after completing all measurements. Fluorescence measurements were carried out using a Jasco FP-8300 instrument, and CD measurements were performed in a AVIV SF420 spectrometer.

ANS Binding. In this experiment 0.5 mL of AtPP16-1 (6 µM) in 50 mM sodium acetate buffer, pH 4.2, was titrated by adding very small volumes of concentrated solutions of ANS (Sigma) so as to obtain its final concentration in 0−100 µM range in the protein solution without diluting the protein concentration considerably. Fluorescence was excited at 380 nm, and the emission spectrum in the 390−500 nm region was recorded after each addition of ANS.

Binding of RNA and DNA to AtPP16-1. Arabidopsis thaliana RNA was isolated by using TRI reagent (Applied Biosystem). A large part of the RNA in the preparation is ribosomal RNA. The Protein−RNA titration experiment was performed in 20 mM sodium acetate buffer, pH 4 8 ACS Paragon Plus Environment

Page 8 of 46

Page 9 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

containing 2% glycerol. Titration samples contained a variable amount of RNA in the range 0-2 µM holding the protein concentration constant at 8.25 µM. Samples were incubated at 25ºC for 1 h before measuring fluorescence emission spectra (ex: 280 nm) at the same temperature. The same procedure was used for protein−DNA titration, in which calf thymus DNA (Sigma) sheared to ~500 bp by sonication was used for binding. In another set of experiments, the Dickerson-Drew dodecamer self-complementary sequence ds-(5′ d−CGCGAATTCGCG 3′ ) was used as a model DNA sequence to titrate the protein.

NMR Spectroscopy. Protein samples for NMR experiments were prepared in 10% D2O buffer of 20 mM sodium acetate, pH 4.1, and contained typically 300 µM of uniformly 15N-labeled or doubly

15

N/13C-labeled AtPP16-1. Spectra recorded include 2D [1H−15N] HSQC, and 3D

HNCO, HNCA, HNCACB and CBCA(CO)NH for sequential backbone resonance assignment. 54−56

In general, spectral widths for 1H and

corresponding

carrier

frequencies

15

N were 11 and 36 ppm, respectively, with

positioned

at

4.7

and

117

ppm.

For

CBCA(CO)NH/HNCACB, HNCO, and HNCA experiments, the carbon spectral widths were 60, 14, and 30 ppm, respectively, with respective carrier frequencies placed at 40, 171.8, 53.8 ppm. FID sizes were 2048×128 for F2 and F1 in 2D [1H−15N] HSQC, 2048×36×128 for F3, F2, and F1 in CBCA(CO)NH and HNCACB, 2048×36×128 for F3, F2, and F1 in HNCO, and 2048×36×72 for F3, F2, and F1 in HNCA experiments. Three-dimensional HC(CC)CONH, HBHACONH, HCCH TOCSY ,15N-edited 1H−1H NOESY (τm=100 ms mixing time) and edited 1H−1H NOESY (τm=120 ms mixing time) spectra were used for side-chain 1H, 13

15

13

C-

N, and

C resonance assignment. All experiments were done at 298 K in 700 and 800 MHz Bruker 9 ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 46

spectrometers equipped with 5 mm triple-resonance cryoprobe. Data were processed using TopSpin 3.1 (Bruker) and NMRpipe software,57 and were then moved to CARA 1.9.4 and Sparky softwares for peak picking and assignments. T1, T2, and NOE experiments were performed at 500 MHz using pulse sequences for inversion recovery, CPMG, and steady-state {1H}–15N NOE, respectively. Eight inversion recovery delays from 10 ms to 1200 ms were used for T1 measurements. For T2, 7 CPMG delays with multiple of 16.96 ms from 16.96 ms to 169.6 ms were employed. Spectra were recorded as 128×2048 complex matrices with 32 scans per complex t1 point. Steady-state NOE spectra with and without proton saturation were recorded as 256×1024 complex matrices with 64 scans for each complex t1 point. Proton presaturation in NOE experiments was achieved by the use of the standard 120° 1H pulses. In all experiments echo-antiecho was used in the indirect dimension. To extract the relaxation time, peak intensities of all resolved resonances in T1 and T2 spectra were plotted with relevant time delays, and fitted to single exponential decays

= + Values of {1H}–15N NOE were determined from NOE =

where Isat and Iunsat are resonance intensities with and without proton saturation, respectively.

Structure Calculation. Intramolecular distance constraints were derived from

15

N- and

13

C-

edited 1H−1H NOESY spectra. Restraints on backbone dihedral angles φ and ψ were obtained 10 ACS Paragon Plus Environment

Page 11 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

from 1H, 15N, 13Cα, 13Cβ, and 13Cʹ chemical shifts by using the TALOS+ routine incorporated in the CYANA software. These constraints along with NOESY cross peaks and the amino acid sequence of AtPP16-1were used in CYANA 2.1 software (L.A. Systems, Inc) to calculate and refine 20 structures from 200 structures calculated by 2×104 anneal steps at tolerance levels of 0.040, 0.030, and 0.4 for H/H′, C/N′, and C/N, respectively.

RESULTS Recombinant AtPP16-1. Phloem proteins can be abundantly purified from phloem sap for use in a variety of biochemical and biophysical work, but this does not obviate the requirement of recombinant proteins for studies involving atom-level structure and mutational analysis of their functions. Here, cloning and overproduction of AtPP16-1 was necessary for isotope-labeling of nitrogens and carbons that largely facilitates sequence-specific backbone resonance assignments and side-chain resonance identification in NMR spectra. Both Rosetta BL21 lacZY and BL21(DE3)RIL host strains of E. coli show IPTG-induced overexpression of the AtPP16-1 gene in ~3 h at 37ºC, and the protein is localized in the cytoplasmic fraction (Supporting Information, Figure S1). Obtaining the protein in the soluble fraction is highly desirable for NMR studies, because isolation of a protein from insoluble fraction requires unfolding and refolding before chromatographic procedures, and the structure of the refolded product may not sufficiently correspond to the in vivo native-state of the protein. Highly pure AtPP16-1 is


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

isolated from the soluble fraction of cultured cells by Ni-NTA chromatography at pH 8 (Figure S1). The yield from the LB growth was ~10 mg L−1, which decreased by ten-fold when cells were grown in

15

NH4Cl and

13

C glucose-containing M9 medium. We also noticed that our

recombinant AtPP16-1 has the benign Q→N mutation at position 154 (Figure 1B).

Basic Physicochemical Properties of AtPP16-1. There appears uncertainty regarding the pH of phloem sap. The earlier report of acidic pH has been contested by a later study that finds the value in the range 7.3−8.5,58 even as a more recent report projects the value to 6.04.59 To find out the working buffer for experiments with AtPP16-1, the pH dependence of turbidity, UV absorption, fluorescence, and far-UV CD absorption were recorded. The 450-nm light scattering, which is a qualitative measure of turbidity, shows the least solubility of the protein near pH 6 (Figure 2A), although the 280-nm absorbance is highest in the neutral pH region (Figure 2B). Fluorescence values across the pH range show protein denaturation at both acidic (pH 10) conditions (Figure 2C). This result is also obtained from pH dependence of far-UV CD spectra, which shows that the secondary structure is nearly entirely lost near pH 6 (Figure 2D). To emphasize on the influence of pH on the secondary structure of the protein we also show the variation of the 218-nm CD at different pH values (Figure 2E). Clearly, the data mark out two regions of structural stability near pH 4 and 8.8, of which the former offers a condition where the structure content is still higher. The condition of pH 9 is not preferable because the rate of backbone amide hydrogen exchange is about 5-orders of magnitude faster in this pH region − a condition not desirable for NMR studies. All experiments henceforth were carried out at pH 4.1(±0.05).


Page 12 of 46

Page 13 of 46

BBBB

AAAA

0.3

OD280 nm

OD450 nm

0.75 0.2 0.1

0.50

0.0

0.25 2

4

6

8

10

12

2

4

6

8

10

12

pH

EEEE

-5

θ 218 nm (mdeg)

Fluorescence, 330 nm (au)

pH

CCCC 1.3

0.8

-15 -25

0.3 2

4

6

8

10

12

2

4

6

pH

8

10

pH

FFFF

DDDD

2

θ (mdeg)

10

0

0 250

6.65

θ (mdeg)

1

260

270

280

40

60

290

300

10.7 7.50

-10

-20 200

220

Fluorescence, 482 nm (au)

pH 6.65 10.70 7.50 8.00 8.35 8.35 5.50 5.50 2.00 (blue) 2.55 3.30 (red) 3.30 4.40 4.40

240

GGGG

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

60 40 20 0 0

20

ANS, µM

Wavelength (nm)


80

100

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 2. Basic physicochemical properties of recombinant AtPP16-1. (A) pH dependence of 450-nm light scattering. (B) Variation of 280-nm absorption with pH. (C) pH dependence of tryptophan (excitation: 280 nm) fluorescence. (D) Variation in the far-UV spectrum at different pH. Each spectrum is the average of two spectra. The pH labels alongside the arrow have been arranged according to spectra showing decreasing CD signal at 218 nm. (E) CD absorption at 218 nm across the pH scale to show the stability of secondary structure. These measurements were done separately with an average of 20 readings for each point. Hence CD values shown here do not correspond to those found in panel D. (F) The CD spectrum of AtPP16-1 in the near-UV region, pH 4.1, 50 mM sodium acetate showing distinctly stronger absorption due to phenylalanine and tyrosine side chains (~270 nm). Much weaker absorption in the 280−290 nm region indicates smaller contribution of tryptophan side chains. (G) Binding of ANS to AtPP161, pH 4.1, 50 mM sodium acetate, monitored by ANS fluorescence at 482 nm. The excitation wavelength is 380 nm.

Figure 2F shows the CD spectrum of AtPP16-1 in 200-300 nm region at pH 4.1, 50 mM sodium acetate. The far-UV region reports on the presence of both α-helix and β-sheet structures, although the stability of the secondary structures is not determined. The near-UV CD absorption is dominated by Phe and Tyr side chains, as inferred from the profile in the 255-285 nm region, where the band at ~273 nm is reproducibly flanked by at least one shoulder band on either side. The contribution of Trp side chain (280-290 nm region) is minor. The intense absorption around 270 nm appears to indicate that Phe and Tyr side chain are lodged in asymmetric environments undergoing anisotropic motions. These results suggest the presence


Page 14 of 46

Page 15 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

of ordered structures, although some structural disorder cannot be ruled out, because AtPP16-1 is a putative RNA binding protein. A basic test for intrinsic structural disorder in a protein is the binding of the dye 8anilino naphthalene sulfonate (ANS) to the native state of the protein, the idea being a substantial dye binding due to its larger accessibility to the interior hydrophobic surfaces if the protein is disorderd.60,61 Figure 2G shows ANS binding to AtPP16-1 monitored by enhancement of the dye fluorescence, which is an indication of some structural disorder in the protein − a possibility that we thought should be studied in detail by NMR.

Binding of Nucleic Acids to AtPP16-1. The hypothesis that AtPP16-1 may serve to bind RNA as does CmPP16,18 because they are homologous and sequence-conserved to the extent of 23%, can be checked by titrating the protein with RNA. Since certain RNA-binding proteins also interact with single-stranded and nicked double-stranded DNA,62,63 AtPP16-1 may also be titrated with DNA. Without knowing details of nucleic acid types that might bind, we carried out titration of AtPP16-1 with total RNA isolated from A. thaliana, commercial calf thymus DNA sheared to ~500 bp, and the dodecamer self-complementary sequence ds-(5′ d−CGCGAATTCGCG 3′). Although protein-nucleic acid interactions are generally carried out by measuring changes in fluorescence anisotropy of fluorophor-labeled nucleic acid after each addition of small aliquots of the protein sample,64 fluorescence quenching of intrinsic Trp or Tyr side chains by small additions of the nucleic acid solution has also been used in the past.65,66 Here, quenching of the intrinsic fluorescence of AtPP16-1 was monitored after each addition of small volumes of the RNA or DNA solution (Figure 3A,B).


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 3. Nucleic acid binding to AtPP16-1 at pH 4.1, 50 mM sodium acetate, 25°C. (A) The protein fluorescence increases with increasing addition of total RNA from Arabidopsis thaliana. (B) The protein fluorescence decreases with sheared DNA (~500 bp) from calf thymus. (C) The Kdiss value for AtPP16-1−RNA interaction is ~67 nM. (D) Kdiss values for interactions of AtPP16-1 with calf thymus DNA (grey) and the dodecamer DNA, ds-5′ d−CGCGAATTCGCG 3′, (cyan) are ~864 and 1330 nM, respectively.

We suppose a 1:1 protein-nucleic acid association, and use the simplest binding model RNAfree

PL = ass

ass RNAfree


Page 16 of 46

Page 17 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

where fPL is the fraction of protein bound to nucleic acid, and calculate the dissociation constant Kdiss=1/Kass using the general assumption that the percent nucleic acid that binds to the protein is often small so that [Nucleic Acid]free can be approximated by [Nucleic Acid]total. The binding isotherms, plotted with the logarithm of [Nucleic Acid]total in Figure 3C,D, provide Kdiss values of ~ 67 nM for the interaction of AtPP16-1 with total A. thaliana RNA, and ~864 and 1330 nM for the protein interaction with calf thymus DNA and dodecamer DNA, respectively. The results suggest a higher affinity for RNA.

NMR Spectra and Resonance Assignment. The initial thought that AtPP16-1 could have conformational disorder is substantiated by the [1H−15N] HSQC spectrum (Figure 4) which shows clustering of a large number of 1H frequencies in the 7.9−8.6 ppm that causes exceedingly narrow chemical shift dispersion − a hallmark of structural disorder. Similar narrow dispersion of chemical shifts in the HSQC spectra of several IDPs has been observed earlier.67,68 The protein contains 156 amino acids and a C-terminal six-histidine tag for purification, and the spectrum shows 149 labeled backbone-NH resonances that were assigned using the 2D [1H−15N] HSQC experiment along with 3D CBCANH, CBCA(CO)NH, HNCA, and HNCO experiments. The quality of spectra presented with representative slices showing some of the residue assignments and chemical shifts is provided in the Supporting Information (Figure S2). All 3D experiments were synchronized to

15

N and 1H of HSQC. Backbone information was

mostly derived from HNCACB and CBCA(CO)NH spectra, and at times the HNCA spectrum was used to resolve the ambiguities in peak picking. While verifying the assigned resonances by PINE software (pine.nmrfam.wisc.edu) the output was found to be

Solution NMR Structure and Backbone Dynamics of the Partially

Recommend Documents