Sortase A-Catalyzed Site-Specific Coimmobilization on Microparticles

Jan 25, 2012 - Pentaglycine lipid derivates – rp-HPLC analytics for bioorthogonal anchor molecules in targeted, multiple-composite liposomal drug de...
0 downloads 0 Views 1MB Size
Download PDF
Article pubs.acs.org/Langmuir

Sortase A-Catalyzed Site-Specific Coimmobilization on Microparticles via Streptavidin Takuya Matsumoto, Tsutomu Tanaka,* and Akihiko Kondo Department of Chemical Science and Engineering, Graduate School of Engineering, Kobe University, 1-1 Rokkodaicho, Nada, Kobe 657-8501, Japan ABSTRACT: A microparticle surface was designed by the unique method incorporating streptavidin−biotin affinity and sortase A (SrtA)-catalyzed transpeptidation. Leucine-prolineglutamate-threonine-glycine-tagged streptavidin (Stav-LPETG) was immobilized on the surface using streptavidin−biotin affinity, and GGGGG-tagged red fluorescent protein (Gly5-RFP) was conjugated with SrtA. Biotinylated fluorescein isothiocyanate (biotin−FITC) was then bound to residual biotin-binding sites in Stav-LPETG. The resulting particles had RFP and FITC immobilized on the surface via Stav-LPETG, and RFP- and FITC-associated fluorescence was observed using fluorescence microscopy. Finally, GGG-tagged glucose oxidase and biotinylated horseradish peroxidase were immobilized on the microparticle surface, resulting in a functional particle capable of detecting glucose. This particle can be repeatedly used and is more sensitive in detecting glucose than particles prepared using chemical modification. Our method provides a simple strategy for site-specific coimmobilization on molecular surfaces and expands the use of protein hybrid devices.

■

various bioconjugates.20−24 Although MTG is useful for bioconjugation, it may produce nonspecific reactions between some proteins due to its relatively low substrate specificity. As a result, the potential utility of a similar approach using the enzyme sortase (Srt) has recently attracted considerable attention. Sortase A (SrtA), produced by Staphylococcus aureus, is the most well-studied sortase. Sortase A recognizes the leucineproline-X-threonine-glycine (LPXTG) sequence in substrate proteins, cleaves between the T and G residues and subsequently links the T carboxyl group to an amino group of N-terminal G oligomers through a native peptide bond.25 This specific reaction has also been employed for site-specific ligation (e.g., protein−protein,26 protein−small molecule,27 and protein−microbead28,29) using a recombinant soluble SrtA. The advantages of the Srt reaction are its extremely highly selective substrate specificity and mild reaction conditions. A number of novel sortases with differing substrate specificities have been identified and utilized in bioconjugation applications, which has spurred development of Srt applications and associated products.27,29 Complex protein hybrid devices, such as bioelectrodes for use in biosensors or biofuel cells,30 require that more than two different proteins be immobilized on the device surface and that they retain a highly active form. Although chemical approaches for immobilization are simple, it is difficult to achieve site-specific immobilization that retains activity using these approaches

INTRODUCTION Site-specific protein immobilization is an important technique for creating protein hybrid devices. Proteins immobilized on particles can be used in the separation or purification of proteins of interest, and enzymes immobilized on electrodes can be used for detection of substrate molecules. In particular, highly functional protein hybrid devices require that the enzymes be immobilized in a highly active form. Chemical approaches involving cross-linking reagents are the most common and simple methods for protein immobilization; however, these approaches are residue-selective (e.g., lysine (K), glutamate (E), and cysteine (C)) rather than site-specific. Hence, chemical approaches often cause random modification that may result in degradation of function.1−3 To alleviate this problem, several chemical approaches involving site-specific immobilization have recently been proposed, including native chemical ligation,4,5 expressed protein ligation,6 Staudinger ligation,7 and various other sophisticated methods.8−10 Biological interactions have also been exploited for protein immobilization. The binding of biotin by streptavidin (Stav) is one of the strongest noncovalent interactions known, with a dissociation constant in the femtomolar range.11 The tight and specific interaction between biotin and Stav is thus widely used in biological research.12−18 In addition, enzymatic approaches for bioconjugation involving transglutaminase or sortases are emerging. Microbial transglutaminase (MTG) catalyzes an acyl transfer reaction to form a covalent bond between the γ-carboxyamide group of E residues and the ε-amino group of K residues.19 This unique property of MTG has been used not only for protein immobilization, but also in the design of © 2012 American Chemical Society

Received: December 5, 2011 Revised: January 24, 2012 Published: January 25, 2012 3553

dx.doi.org/10.1021/la2047933 | Langmuir 2012, 28, 3553−3557

Langmuir

Article

Sepharose 4 Fast Flow (GE Healthcare, Little Chalfont, U.K.) chromatography, and the cleaved thioredoxin moiety was also removed using TALON metal affinity resin. The concentration of purified Gly5-RFP was determined using a BCA protein assay kit. Preparation of Coimmobilized Microparticles Using Stav and SrtA. Biotin polystyrene particles (500 μg) were coated with Stav or Stav-LPETG (5.5 μM) by mixing for 30 min at ambient temperature using a WAKEN model 2280 tube mixer (WAKENYAKU Co., Ltd., Kyoto, Japan). After mixing, the particles were washed twice with phosphate-buffered saline (PBS) and resuspended in distilled water (20 μL). The reaction between Stav-coated (or Stav-LPETGcoated) particles and Gly5-RFP (0.65 μM) was initiated by addition of SrtA (2.1 μM) and CaCl2 (0.5 mM). After incubation for 2 h at 37 °C, the particles were washed twice with PBS and resuspended in distilled water (20 μL). Biotin−FITC (55 μM) was immobilized on the particles through a residual Stav-LPETG biotin-binding site by mixing in the WAKEN model 2280 tube mixer for 30 min at ambient temperature. The resulting particles were washed twice with PBS, resuspended in PBS (20 μL), and directly observed under a fluorescence microscope. Also, Gly3-GOx (0.65 μM) and biotin− HRP (5.5 μM) were immobilized on biotin polystyrene particles (500 μg), and the resulting particles were resuspended in distilled water (20 μL). Preparation of Coimmobilized Microparticles Using Chemical Modification. Biotin polystyrene particles (500 μg) were coated with Stav-LPETG (5.5 μM) by mixing for 30 min at ambient temperature using a WAKEN model 2280 tube mixer. After mixing, the particles were washed twice with PBS and resuspended in distilled water (20 μL). The reaction between Stav-LPETG-coated particles and Gly3-GOx (0.65 μM) was initiated by addition of 1-ethyl-3-[3(dimethylamino)propyl]carbodiimide hydrochloride (EDC; 0.2 M) and N-hydroxysuccinimide (NHS; 0.05 M), pH 7.5. After incubation for 2 h at ambient temperature, the particles were washed twice with PBS and resuspended in distilled water (20 μL). Biotin−HRP (5.5 μM) was immobilized on the particles through a residual Stav-LPETG biotin-binding site by mixing in the WAKEN model 2280 tube mixer for 30 min at ambient temperature. The resulting particles were washed twice with PBS and resuspended in distilled water (20 μL). Evaluation of the GOx Activity of Coimmobilized Microparticles. GOx activity was assayed by adding 100 μL of 50 mM glucose solution to the particles, after which the reaction was initiated by mixing with a tube mixer for 1 min. The particles were then centrifuged for 1.5 min, and the glucose concentration was determined using high-performance liquid chromatography (HPLC) (Shimadzu, Kyoto, Japan) with a Shim-pack SPR-Pb column (Shimadzu). Chromatography was carried out at 80 °C with water as the mobile phase at a flow rate of 0.6 mL/min. Glucose was detected using a Shimadzu RID-10A refractive index detector.27 Evaluation of the HRP Activity of Coimmobilized Microparticles. To assess the HRP activity of coimmobilized microparticles, 100 μL of ELISA TMB solution containing hydrogen peroxide (0.002 vol%) was added to a suspension of microparticles and the reaction was initiated by mixing with a tube mixer for 1 min. The microparticles were then centrifuged for 1.5 min, after which the supernatant was transferred to the wells of a polystyrene plate containing stop solution and the supernatant reaction was stopped. The absorbance of each well was measured at 450 nm with a plate reader (Wallac 1420 ARVOsx, PerkinElmer, Inc., Waltham, MA). Functional Evaluation of GOx and HRP Coimmobilized Microparticles. Microparticles were centrifuged, and the supernatant was removed. A 100 μL volume of glucose solution (0, 10, or 50 mM) and 100 μL of ELISA TMB solution were added to the particles, and the reaction was initiated by mixing with a tube mixer for 1 min. The samples were centrifuged for 1.5 min, the supernatant was added to the appropriate wells in a polystyrene plate already containing stop solution, and the supernatant reaction was stopped. The absorbance at 450 nm was then determined using a plate reader.

due to the potential for random modifications. Biological approaches are capable of site-specific immobilization that retains activity; however, it is difficult to immobilize multiple proteins on the same surface due to substrate specificity issues. We recently demonstrated site-specific streptavidin−protein conjugation using SrtA to expand the use of streptavidin conjugates.26 Because Stav has four biotin-binding sites, it is often utilized as a molecular spacer.12 We focused on this property and developed a novel strategy for site-specific coimmobilization of proteins that utilizes site-specific streptavidin−protein conjugation with SrtA. Streptavidin appended with an LPETG tag (Stav-LPETG) is immobilized on the surface of a biotin-coated particle using streptavidin−biotin affinity. Subsequently, GGGGG-tagged red fluorescent protein (Gly5-RFP) is conjugated with SrtA. Biotinylated fluorescein isothiocyanate (biotin−FITC) is then bound to the residual biotin pocket in Stav-LPETG. In addition, GGG-tagged glucose oxidase (Gly3-GOx) and biotinylated horseradish peroxidase (biotin−HRP) are immobilized on the particle, producing a functional particle capable of detecting glucose. This particle can be used at least 10 times by collecting it after each reaction. Our functional particle is more sensitive to glucose than are particles prepared using chemical modification.

■

EXPERIMENTAL SECTION

Materials. Biotin polystyrene particles (3.0−3.9 μm) were purchased from Spherotech Inc. (Lake Forest, IL). Bicinchoninic (BCA) protein assay kits, biotin−fluorescein, and biotinylated horseradish peroxidase were purchased from Thermo Fisher Scientific (Waltham, MA). TALON metal affinity resin was purchased from Clontech Laboratory Inc. (Mountain View, CA). KOD FX DNA polymerase was purchased from TOYOBO (Osaka, Japan). The enzyme-linked immunosorbent assay (ELISA) peroxidase (POD) substrate TMB (3,3′,5,5′-tetramethylbenzidine) kit (HYPER), streptavidin, and all other materials were purchased from Nacalai Tesque (Kyoto, Japan). Protein Expression and Purification. Stav-LPETG, Gly3-GOx, and SrtA were expressed and purified according to a previously reported method.4 Gly5-RFP was expressed and purified as follows. KOD FX DNA polymerase was used for polymerase chain reaction (PCR), and PCR-amplified sequences were verified by DNA sequencing. The gene encoding Gly5-RFP was obtained by PCR using pDsRed-Monomer-N1 (Clontech Laboratory Inc.) as a template with 5′-CGGGGTACCATTGAGGGTCGCGGCGGTGGAGGTGGTAGCGATTACAAGGATGACGACGATAAGAGCGACAACACCGAGGACGTCATCAAGGAGTTC-3′ as the 5′ primer and 5′GAGCTCCTAGCTAGCATAATCTGGAACATCATATGGATAGCTGGAGCCGGAGTGGCGGGCCTCGGCGTGCTC-3′ as the 3′ primer. The amplified fragment was subcloned into the KpnI/ SacI sites of the pET-32b(+) vector (Merck KGaA, Darmstadt, Germany) to yield pET32-Gly5-RFP, which was introduced into Escherichia coli BL21 (DE3) pLysS (Takara, Shiga, Japan). Cells were grown in Luria−Bertani (LB) medium at 37 °C to an optical density (OD; 600 nm) of 0.5, and then the cells were incubated for an additional 30 min at 25 °C. Protein expression was induced by adding isopropyl β-D-thiogalactopyranoside (IPTG) to a final concentration of 0.5 mM. After growth for an additional 24 h at 25 °C, the cells were harvested by centrifugation. The cell pellets were resuspended in 20 mM phosphate buffer (pH 8.0) containing 150 mM NaCl and then lysed using sonication. Gly5-RFP was purified from the soluble fraction using TALON metal affinity resin according to the manufacturer’s protocol and then dialyzed against 50 mM phosphate buffer (pH 8.0) containing 150 mM NaCl. The purified protein was thioredoxin-His6-Stag-factor Xa cleavage site-Gly5-RFP, and factor Xa (New England Biolabs, Ipswich, MA) cleavage was carried out according to the manufacturer’s protocol to expose the N-terminal glycine residue. After cleavage, factor Xa was removed using benzamidine 3554

dx.doi.org/10.1021/la2047933 | Langmuir 2012, 28, 3553−3557

Langmuir

Article

Figure 1. Schematic illustration of SrtA-catalyzed site-specific coimmobilization of fluorescent molecules on microparticles using Stav-LPETG.

■

RESULTS AND DISCUSSION Site-Specific Fluorescent Coimmobilization on Microparticles Using Stav and SrtA. Figure 1 shows a schematic illustration of coimmobilization on microparticles. To demonstrate the process of site-specific coimmobilization, particles were dual-colored with two fluorescent molecules. First, StavLPETG was immobilized on the microparticle surface using streptavidin−biotin affinity. Next, Gly5-RFP was tethered to the Stav-LPETG tag using SrtA. Because Stav is a tetrameric protein with one biotin-binding site per subunit, it is often utilized as a molecular spacer, providing two biotin-binding sites on each side face of the molecule.11,17 To exploit this property, biotin−FITC was bound to the residual biotin-binding sites in Stav-LPETG. The resulting particles had RFP and FITC immobilized on the surface via Stav, and the florescence of both RFP and FITC was observed under a fluorescence microscope (Figure 2A). In the case of immobilization using Stav lacking

These results clearly indicated that both fluorescent molecules were site-specifically coimmobilized on the microparticles using tagged Stav as a spacer with sortase A. Site-Specific Coimmobilization of Functional Enzymes on Microparticles. Complex protein hybrid devices require multiple enzymes immobilized on the device surfaces. Thus, we utilized our method to demonstrate site-specific coimmobilization of GOx and HRP on the surface of microparticles in such a manner that the enzymes maintain a highly active form. The enzyme GOx catalyzes the oxidation of glucose to hydrogen peroxide and D-glucono-δ-lactone. In the presence of hydrogen peroxide, the HRP reaction can be easily detected with high sensitivity using the reaction with TMB. In this experiment, GOx and HRP were site-specifically coimmobilized on the surface of microparticles as a model for glucose detection. Figure 3A shows the GOx activity (1 U = 1 μmol of glucose converted/min at 25 °C) associated with each type of particle

Figure 3. (A) GOx activity of microparticles prepared using only modified Stav (column 1), chemical modification (column 2), or SrtA (column 3). (B) HRP activity of microparticles prepared using only modified Stav (column 1), chemical modification (column 2), or SrtA (column 3).

examined. The advantage of SrtA-mediated protein immobilization is that it allows for site-specific immobilization without the loss of enzymatic function. Compared to particles prepared using chemical modification, particles prepared using SrtA modification showed higher GOx activity. Additionally, GGGGOx was labeled with DyLight 350 maleimide (Thermo Fisher Scientific, Waltham, MA) and immobilized on the particles via two routes (chemical modification or sortase) to investigate the level of GOx immobilization. Then the fluorescence of each particle was quantified. Although the GOx activity of particles prepared by SrtA modification was higher than that of particles prepared by chemical modification, the level of GOx immobilized on particles prepared by SrtA modification was

Figure 2. Fluorescence imaging of RFP and FITC coimmobilized microparticles. Panels A-1, A-2, and A-3 show reaction of particles with Gly5-RFP, biotin−FITC, and SrtA and Stav-LPETG. Panels B-1, B-2, and B-3 show reaction of particles with Gly5-RFP, biotin−FITC, and SrtA and Stav without the LPETG tag. Panels C-1 and C-2 show reaction of particles with biotin−FITC (scale bars 10 μm).

the LPETG tag, Gly5-RFP was not conjugated and no RFPassociated fluorescence was observed; only the fluorescence associated with FITC was observed (Figure 2B). In addition, biotin−FITC was not conjugated in the absence of Stav, and FITC-associated fluorescence was not observed (Figure 2C). 3555

dx.doi.org/10.1021/la2047933 | Langmuir 2012, 28, 3553−3557

Langmuir

Article

conjugation of Stav-LPETG and Gly3-GOx. The signal detected using the particles prepared with SrtA (column 6, Figure 4) was 3 times higher than that obtained with particles prepared using chemical modification. The lower activity of the particles prepared using chemical modification was most likely due to random modifications of the enzyme caused by the modification reagents that resulted in a degradation of GOx or Stav function because GOx and Stav have some target residue (K or E) for the cross-linking reagent.22 Our results indicate that GOx and HRP are coimmobilized on the microparticle surface in a highly active form when using a combination of Stav and SrtA. Glucose Detection Using GOx and HRP Coimmobilized Microparticles. The microparticles prepared using SrtA in this study retained the enzymes in a more highly active form than particles prepared using general chemical modification. Hence, we would expect that the detection sensitivity for glucose would be higher for the particles prepared using SrtA, so we compared the sensitivity of the particles in detecting glucose at various concentrations. Although microparticles prepared using chemical modification generated little detectable signal (data not shown), particles prepared using SrtA were capable of detecting glucose at a concentration as low as 10 mM (Figure 5A). However, less than 10 mM glucose was barely detected (date not shown). One possible explanation about low activity was the small amount of particles using glucose detection. The amount of particles used was only 500 μg, and the maximum amount of immobilized Stav was only 2.71 μg (manufacturer’s procedure). Therefore, the amount of GOx or HRP immobilization on particles was expected to be about less than 3 μg. It was hard to efficiently detect glucose at low concentration. Furthermore, these particles could be reused repeatedly simply by collecting them after each reaction. Microparticles prepared using SrtA retain the capability of detecting glucose for at least 10 reuses (Figure 5B). In addition, microparticles prepared using SrtA are more sensitive than those prepared using chemical modification. However, it seemed the responses were different between SrtA modification and chemical modification. In the case of using particles prepared by SrtA, GOx was immobilized in a highly active form. One possible consideration was that particles prepared by chemical modification barely detected glucose even though glucose was present at 50 mM; the loss of GOx activity contributed little to the detectable signals for glucose.

lower (approximately 40%) than that on particles prepared by chemical modification. This result suggests that random modification that often accompanies chemical modification may have caused a loss in GOx activity. The activity of HRP coimmobilized on microparticles using different methods was assayed by adding hydrogen peroxide solution to each microparticle preparation. The activity of HRP bound to particles prepared using SrtA modification was higher than that of HRP bound to particles prepared using chemical modification (Figure 3B). This result suggests that random modification resulting from chemical modification blocked the biotinbinding site for biotin−HRP. Thus, the activity of both GOx and HRP bound to microparticles using SrtA was higher than the activity of these enzymes bound to particles through chemical modification. We then examined the ability of each type of particle to detect glucose. The results of glucose detection experiments involving various microparticle preparations are shown in Figure 4. Microparticles lacking one or more components

Figure 4. Demonstration of site-specific coimmobilization of GOx and HRP. Successful coimmobilization was demonstrated by detection of glucose (vertical scale = detectable signal (absorbance at 450 nm)/ microparticle amount (mg)/reaction time (min)). Key: column 1, blank particles, containing only Stav-LPETG; column 2, particles containing Gly3-GOx, Stav-LPETG, and SrtA; column 3, particles containing Gly3-GOx, biotin−HRP, and Stav-LPETG; column 4, particles containing Gly3-GOx, biotin−HRP, Stav without the LPETG tag, and SrtA; column 5, particles containing Gly3-GOx, biotin−HRP, and Stav-LPETG, prepared using chemical modification with EDC and NHS; column 6, particles containing Gly3-GOx, biotin−HRP, StavLPETG, and SrtA.

(columns 1−4, Figure 4) could not retain the activity of both enzymes, resulting in a poor signal. This result indicates that GOx and HRP were site-specifically coimmobilized in a highly active form only on the microparticles prepared using SrtA. The microparticles prepared using chemical modification (column 5, Figure 4) contained Gly3-GOx, biotin−HRP, and Stav-LPETG, but EDC and NHS instead of SrtA were used for

Figure 5. (A) Demonstration of microparticle sensitivity for glucose. Microparticles were reacted with 0 mM glucose (open squares), 10 mM glucose (closed squares), and 50 mM glucose (closed tilted squares). (B) Demonstration of microparticle reusability. Microparticles prepared using chemical modification (open triangles) or SrtA modification (closed triangles). 3556

dx.doi.org/10.1021/la2047933 | Langmuir 2012, 28, 3553−3557

Langmuir

■

Article

(19) Ando, H.; Adachi, M.; Umeda, K.; Matsuura, A.; Nonaka, M.; Uchio, R.; Tanaka, H.; Motoki, M. Agric. Biol. Chem. 1989, 53, 2613− 2617. (20) Takazawa, T.; Kamiya, N.; Ueda, H.; Nagamune, T. Biotechnol. Bioeng. 2004, 86, 399−404. (21) Kamiya, N.; Doi, S.; Tominaga, J.; Ichinose, H.; Goto, M. Biomacromolecules 2005, 6, 35−38. (22) Abe, H.; Goto, M.; Kamiya, N. Chem. Commun. 2010, 46, 7160−7162. (23) Bode, F.; Silva, M. A.; Drake, A. F.; Ross-Murphy, S. B.; Dreiss, C. A. Biomacromolecules 2011, 12, 3741−3752. (24) Zong, Y.; Bice, T. W.; Ton-That, H.; Schneewind, O.; Narayana, S. V. L. J. Biol. Chem. 2004, 279, 31383−31389. (25) Matsumoto, T.; Sawamoto, S.; Sakamoto, T.; Tanaka, T.; Fukuda, H.; Kondo, A. J. Biotechnol. 2011, 152, 37−42. (26) Antos, J. M.; Chew, G.; Guimaraes, C. P.; Yoder, N. C.; Grotenbreg, G. M.; Popp, M. W.; Ploegh, H. L. J. Am. Chem. Soc. 2009, 131, 10800−10801. (27) Chan, L.; Cross, H. F.; She, J. K.; Cavalli, G.; Martins, H. F. P.; Neylon, C. PLoS ONE 2007, 11, e1164. (28) Matsumoto, T.; Takase, R.; Tanaka, T.; Fukuda, H.; Kondo, A. Biotechnol. J. 2012, in press. (29) Rasmussen, M.; West, R.; Burgess, J.; Lee, I.; Scherson, D. Anal. Chem. 2011, 83, 7408−7411. (30) Yamada, R.; Bito, Y.; Adachi, T.; Tanaka, T.; Ogino, C.; Fukuda, H.; Kondo, A. Enzyme Microb. Technol. 2009, 44, 344−349.

CONCLUSIONS We developed a new method of protein immobilization for sitespecific coimmobilization of enzymes on microparticles. First, two fluorescent molecules are coimmobilized on the particle surface. Two enzymes (GOx and HRP in our experiments) are then coimmobilized on the surface of microparticles in a sitespecific manner. Coimmobilization using our SrtA-based method does not disrupt the conformation of the enzymes as does general chemical modification, and therefore, enzymatic activity is retained to a greater degree with microparticles prepared using SrtA. The results presented in this study thus provide a simple and effective strategy for site-specific coimmobilization on molecular surfaces and expand the use of protein hybrid devices.

■

AUTHOR INFORMATION

Corresponding Author

*Phone/fax: +81-78-803-6202. E-mail: [email protected]. jp. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported in part by a Grant-in-Aid for Young Scientists B (21760638) from the Japan Society for the Promotion of Science (JSPS) and by Special Coordination Funds for Promoting Science and Technology, Creation of Innovation Centers for Advanced Interdisciplinary Research Areas (Innovative Bioproduction Kobe), MEXT, Japan.

■

REFERENCES

(1) Fernández-Lorente, G.; Palomo, J. M.; Mateo, C.; Munilla, R.; Ortiz, C.; Cabrera, Z.; Guisán, J. M.; Fernández-Lafuente, R. Biomacromolecules 2006, 7, 2610−2615. (2) Diao, J.; Ren, D.; Engstrom, J. R.; Lee, K. H. Anal. Biochem. 2005, 343, 322−328. (3) Yehezkeli, O.; Tel-Vered, R.; Raichlin, S.; Willner, I. ACS Nano 2011, 5, 2385−2391. (4) Yan, L. Z.; Dawson, P. E. J. Am. Chem. Soc. 2001, 123, 526−533. (5) Helms, B.; Baal, I.; Merkx, M.; Meijer, E. W. ChemBioChem 2007, 8, 1790−1794. (6) Muir, T. W. Pept. Sci. 2008, 90, 743−750. (7) Berkel, S. S.; Eldijk, M. B.; Hest, J. C. M. Angew. Chem., Int. Ed. 2011, 50, 8806−8827. (8) Dettin, M.; Muncan, N.; Bugatti, A.; Grezzo, F.; Danesin, R.; Rusnati, M. Bioconjugate Chem. 2011, 22, 1753−1757. (9) Chen, Z.; Popp, B. V.; Bovet, C. L.; Ball, Z. T. ACS Chem. Biol. 2011, 6, 920−925. (10) Algar, W. R.; Prasuhn, D. E.; Stewart, M. H.; Jennings, T. L.; Blanco-Canosa, J. B.; Dawson, P. E.; Medintz, I. Bioconjugate Chem. 2011, 22, 825−858. (11) Green, N. M. Methods Enzymol. 1990, 184, 51−67. (12) Ringler, M.; Schulz, G. E. Science 2003, 302, 106−109. (13) Ladd, J.; Boozer, C.; Yu, Q.; Chen, S.; Homola, J.; Jiang, S. Langmuir 2004, 20, 8090−8095. (14) Laitinen, O. H.; Nordlund, H. R.; Hyotönen, V. P.; Kulomaa, M. S. Trends Biotechnol. 2007, 25, 269−277. (15) Howarth, M.; Ting, A. Y. Nat. Protoc. 2008, 3, 534−545. (16) Li, S.; Liu, H.; He, N. J. Nanosci. Nanotechnol. 2010, 10, 4875− 4882. (17) Mori, Y.; Minamihata, K.; Abe, H.; Goto, M.; Kamya, N. Org. Biomol. Chem. 2011, 9, 5641−5644. (18) Lehnert, M.; Gorbahn, M.; Rosin, C.; Klein, M.; Köper, M.; Al-Nawas, B.; Knoll, W.; Veith, M. Langmuir 2011, 27, 7743−7751. 3557

dx.doi.org/10.1021/la2047933 | Langmuir 2012, 28, 3553−3557