Stem Cell Extracellular Matrix-Modified Decellularized Tendon Slices

Subscriber access provided by Nottingham Trent University

Tissue Engineering and Regenerative Medicine

Stem cell extracellular matrix-modified decellularized tendon slices facilitate the migration of bone marrow mesenchymal stem cells Xuan Yao, Liang-Ju Ning, Shu-Kun He, Jing Cui, Ruo-Nan Hu, Yi Zhang, Yan-Jing Zhang, Jing-Cong Luo, Wei Ding, and Ting-Wu Qin ACS Biomater. Sci. Eng., Just Accepted Manuscript • DOI: 10.1021/ acsbiomaterials.9b00064 • Publication Date (Web): 11 Jul 2019 Downloaded from pubs.acs.org on July 19, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 48 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Biomaterials Science & Engineering 1

Stem cell extracellular matrix-modified decellularized tendon slices facilitate the migration of bone marrow mesenchymal stem cells

Xuan Yao

a, #,

Liang-Ju Ning

a, #,

Shu-Kun He b, Jing Cui a, Ruo-Nan Hu a, Yi Zhang c,

Yan-Jing Zhang a, Jing-Cong Luo a, Wei Ding a, Ting-Wu Qin a, * a

Laboratory of Stem Cell and Tissue Engineering, State Key Laboratory of Biotherapy and

Cancer Center, West China Hospital, Sichuan, Chengdu, Sichuan 610041, P.R. China b

Department of Orthopedic Surgery, West China Hospital, Sichuan University, Chengdu,

Sichuan 610041, P.R. China c

Core Facility, West China Hospital, Sichuan University, Chengdu, Sichuan 610041, P.R.

China #

These authors contributed equally to this work.

*Corresponding Author: Ting-Wu Qin, Ph.D. Lab of Stem Cell and Tissue Engineering, State Key Laboratory of Biotherapy and Cancer Center, West China Hospital, Sichuan University, Chengdu, Sichuan 610041, China Tel: +86-28-85164090; Fax: +86-28-85164088 E-mail: [email protected]

ACS Paragon Plus Environment

ACS Biomaterials Science & Engineering 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 48 2

Abstract It is highly desirable to develop a novel scaffold that can induce stem cell migration in tendon tissue engineering and regeneration. The objective of this study is to assess the effect of stem cell extracellular matrix-modified decellularized tendon slices (ECM-DTSs) on bone marrow mesenchymal stem cells (BMSCs) migration and explore the possible molecular mechanisms. Native ECM produced by BMSCs and tendon-derived stem cells (TDSCs) was deposited on DTSs, denoted as bECM-DTSs and tECM-DTSs, respectively, and the migration of BMSCs treated with the extracts from ECM-DTSs was studied. Almost all the seeded stem cells were removed from the stem cell-DTS composites, while ECM produced by stem cells completely covered the surface of the DTSs. Significantly higher levels of chemokines, including stromal cell-derived factor-1 (SDF-1) and monocyte chemotactic protein-1 (MCP-1) were released by ECM-DTSs than by bare DTSs (p < 0.05), according to ELISA, and tECM-DTSs exhibited the highest release within 72 h. bECM-DTSs and tECM-DTSs markedly improved BMSCs migration compared to bare DTSs, with tECM-DTSs yielding the best recruitment effects. The ECM-DTSs led to early cytoskeletal changes compared to bare DTSs (p < 0.05). Migration-related gene and protein expression was significantly up-regulated in BMSCs treated with ECM-DTSs via the PI3K/AKT signaling pathway (p < 0.05), indicating that ECM-DTSs could enhance BMSCs migration via the PI3K/AKT signal pathway, and the effect of tECM-DTSs on BMSCs migration is superior to that of bECM-DTSs. This may provide the experimental and theoretical evidence for using stem cells-derived ECM-modified scaffold as a novel approach to recruit stem cells.


Page 3 of 48 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Keywords: stem cell extracellular matrix migration

decellularized tendon slices

chemokines

bone marrow mesenchymal stem cells

1. Introduction In the past few decades, tissue engineering strategies have offered great potential for tendon regeneration and repair. Cells from multiple sources have been employed for tendon repair, including embryonic stem cells (ESCs),1 tendon-derived stem cells (TDSCs),2 bone marrow mesenchymal stem cells (BMSCs),3 adipose-derived stem cells (ADSCs),4 tenocytes,5 and dermal fibroblasts.6 Although these exogenous seeding cells are expected to populate and differentiate when delivered in vivo, the present tissue engineering methods have been reported to have many drawbacks, such as being time consuming,7 having a low cell survival rate,8 donor site morbidity from harvesting of cells,9 possible contamination, and changes in the functions of the cells during cell passage and expansion.10 To overcome the drawbacks associated with using exogenous cells, a new strategy has been developed to repair injured tendons using endogenous cells.11,12 Recent progresses in implant materials provide an alternative of developing inductive scaffolds for recruiting endogenous cells.13–17 Chemokines, which are used in combination with biomaterials, including collagen,16 knitted silk-collagen sponges,13 and PEG/macromer films15 serve as a key element to endow the biomaterial with the ability to recruit the endogenous stem cells and facilitate tendon healing. Hence, developing a novel scaffold with the ability to recruit endogenous cells is highly desirable. Increasing evidence shows that chemotactic axes act an important part in recruiting



Page 4 of 48 4

endogenous cells. The chemokine stromal cell-derived factor-1 (SDF-1, also known as CXCL12) and its receptor C-X-C chemokine receptor type 4 (CXCR4) have been studied extensively, as the SDF-1/CXCR4 axis is crucial in cell migration and homing of host stem cells to injured tissue.18 Additionally, the monocyte chemotactic protein 1 (MCP-1)/CCR2 axis was also found to be required for the recruitment of BMSCs to injured cardiac tissue.19 BMSCs were found to be capable of secreting numerous chemokines, including SDF-1 and MCP-1.20,21 These chemokines were reported to regulate the homing of stem cells to a specific area by combining with their specific receptors.20 TDSCs have attracted increasing attention in recent years for use in tendon repair. Interestingly, TDSCs were demonstrated to possess higher proliferation and tenogenic differentiation potential than BMSCs, and showed higher expression of tendon-related proteins.22,23 Furthermore, TDSCs were found to have higher repairing potential in the injured Achilles tendons of rats compared to BMSCs.24 Therefore, TDSCs are believed to be a more appropriate cell type for tendon regeneration compared to BMSCs. However, no studies have been performed to evaluate whether TDSCs can secrete chemokines like BMSCs. Decellularized tendon extracellular matrix (ECM) is a promising tissue-specific bioscaffold for tendon regeneration.25 Our previous work demonstrated that decellularized tendon slices (DTSs) maintained the microenvironment cues of native tendon ECM, which promoted stem cell proliferation and tenogenic differentiation.

26,27

In this study, bovine

DTSs were modified using the ECM produced by BMSCs or TDSCs, and then the effects of stem cell-derived ECM-DTSs on the migration of rat BMSCs and the possible molecular mechanisms were investigated. It was hypothesized that stem cell-derived ECM-DTSs could


Page 5 of 48 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


secrete more chemokines and enhance BMSCs migration.

2. Materials and methods 2.1 Isolation and culture of BMSCs and TDSCs All experiments were carried out according to the approved guidelines made by the Sichuan University Animal Care and Use Committee. BMSCs and TDSCs of Sprague Dawley (SD) rats were isolated and cultured following our previously published method.27 To isolate the BMSCs, bone marrow was flushed out from femoral marrow cavities with low-glucose Dulbecco’s modified Eagle’s medium (L-DMEM), followed by filtration with a 70 μm cell strainer to remove bone debris and blood clots. After centrifuging at 1200 rpm for 5 min, the cells were resuspended in complete medium containing 20% FBS and cultured. TDSCs were isolated from Achilles tendons and flexor tendons of rats by digesting with 4 mg/mL dispase (Sigma) and 3 mg/mL collagenase type I (Worthington) in phosphate buffered saline (PBS) for 1.5 h at 37°C. The tissue enzyme solution was filtered with a 70 μm cell strainer. Single cells were collected from the filtrate. After washing with PBS, the single cells were resuspended in complete medium containing 20% FBS and cultured. Fresh medium was changed every 3 d. Cells at passage 3 were used for all experiments. 2.2 Fabrication of bovine-derived decellularized tendon slices (DTSs) Hind limbs were harvested from 4 newborn Chinese Simmental calves (New Hope Group, Sichuan, China). The Achilles tendons were obtained using transverse cutting distally at the osteotendinous junction and proximally at the musculotendinous junction. The excised Achilles tendons were immediately frozen at -80°C for further use.



Page 6 of 48 6

DTSs were prepared following a previously described protocol.26 Briefly, the excised Achilles tendons were trimmed into segments approximately 30 mm in length. Following washing three times in PBS for 30 min each, the tendon segments were subjected to five freeze/thaw cycles (liquid nitrogen for 2 min and then thawed in PBS at 37°C for 10 min). Then, each tendon segment was fixed on a cryostat (Leica CM3050S, Nussloch, Germany) and longitudinally cut into slices with a thickness of 600 μm. After washing in PBS (3 × 30 min), the tendon slices were incubated in a nuclease solution (100 μg/ml RNase and 150 IU/ml DNase) (Roche Diagnostic, Indianapolis, IN) for 12 h at 37°C. Then, the tendon slices were washed for 30 min in PBS at room temperature with gentle agitation, and the procedure was repeated three times. Finally, the prepared DTSs were lyophilized and sterilized with ethylene oxide gas. 2.3 Modification of DTSs using stem cell-derived ECM BMSCs and TDSCs were seeded on the DTSs at a density of 4 × 104 cells/cm2 and cultured for 15 d, respectively. The complete medium was replaced every 3 d, and 50 μM of L-ascorbic acid phosphate (Sigma, USA) was added during the final 8 d of culture.28 After washing with PBS, the cultured composites of BMSCs or TDSCs and DTSs substrate were decellularized in 0.5% Triton X-100 and 20 mM ammonium hydroxide (NH4OH) at 37°C for 20 min. Finally, the BMSC- or TDSC-derived ECM-DTSs, specifically bECM-DTSs or tECM-DTSs, were washed with PBS six times for 30 min per wash, lyophilized, and sterilized for subsequent experiments. 2.4 DNA quantification assays The DNA content in the seeded DTSs and stem cell-derived ECM-DTSs (n = 3) was


Page 7 of 48 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


measured as previously described.29 In brief, the samples were minced and digested with 1 mg/mL Proteinase K (Sigma) at 60°C for 24 h. Digested samples were centrifuged and the supernatants were purified by phenol/chloroform/isoamyl alcohol (25:24:1, v:v) extraction. After precipitating and discarding the protein, the remaining sample was collected and quantified using the Picogreen DNA assay (Invitrogen) according to the manufacturer’s protocols. 2.5 Histology and scanning electron microscopy (SEM) The seeded DTSs and stem cell-derived ECM-DTSs were examined using histology and SEM. For histology, the samples (n = 3) were fixed in 10% neutral formaldehyde, embedded in paraffin, and then longitudinally sectioned (5 μm thickness) with a microtome (Leica RM2245, German). The sections were deparaffinized in xylene, rehydrated, mounted on slides, and stained using hematoxylin and eosin (H&E, Sigma) as well as 4,6-diamidino-2-phenylindole (DAPI, Sigma). For the SEM, the samples (n = 3) were fixed in 2.5% glutaraldehyde for 2 h at 4°C and dehydrated in graded ethanol. The samples underwent critical point drying and gold sputter coating. SEM images were taken using a FEI Inspect F50-SEM (Netherlands) with a 20 kV acceleration voltage. 2.6 ELISA To evaluate the release profile of the chemokines (including SDF-1 and MCP-1) from the ECM-DTSs in vitro, an enzyme-linked immunosorbent assay (ELISA) was performed according to the manufacturer’s instruction (SDF-1, DL-develop, Canada; MCP-1, Raybiotech, USA). The release profile of the chemokines was measured in PBS (pH 7.4) with or without collagenase type I (145 U/mL, Worthington). 30 Briefly, each scaffold (30 mg,



Page 8 of 48 8

n=3) was soaked in a tube with 1 mL sterile solutions. All the tubes were incubated at 37°C in a continuous horizontal shaker. The supernatants were collected at 3, 6, 9, 12, 24, 36, and 72 h in PBS, and at 1, 3, 6, 9, 12, and 24 h in collagenase-containing PBS, and freezed at -80°C. The content of chemokines in the supernatant was assessed using the corresponding ELISA kits. 2.7 Preparation of extracts To avoid the impact of different scaffold surface microstructure on the cell behavior, the extracts from the sterilized DTSs and stem cell-derived ECM-DTSs were prepared by a modified protocol based on a previous publication.31 Briefly, the DTSs and stem cell-derived ECM-DTSs were minced and incubated in serum-free DMEM (10 mg/mL) for 72 h at 37°C with 5% CO2. The supernatants were collected as extracts for subsequent use. 2.8 Scratch wound healing assay BMSCs (3 × 105 cells/well) were seeded into 6-well plates and cultured with serum-starving for 12 h. A scratch wound was made with a sterile 200 μL pipette tip. After medium was removed, the wells were gently washed with PBS to eliminate dislodged cells. The cells were then exposed to the extract of DTSs, bECM-DTSs, tECM-DTSs, or L-DMEM, respectively. The images were taken at 0, 3, 6, 12, and 24 h after wounding. The area of the scratch wound was calculated with a computerized image analysis using ImageJ software. 2.9 Transwell migration assay A Transwell chemotactic migration model (pore size: 8 μm, Corning, USA) was used to evaluate the recruitment capacity of stem cell-derived ECM-DTSs. After serum-starving for 12 h, 200 μL of cell suspension (5 × 104 cells/mL) was placed within the upper chamber, and


Page 9 of 48 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1 mL extract from DTSs, bECM-DTSs, or tECM-DTSs was added to the lower chamber, with the L-DMEM alone used as the control. After incubation for 24 h at 37°C, the upper surface of the Transwell membrane was initially scraped with a cotton swab to remove the adherent cells and debris. The samples were fixed with 4% paraformaldehyde for 30 min, washed in PBS for three times, and stained using DAPI (Sigma, USA). The total number of BMSCs on the lower surface of the membrane was counted (N = 5 repeated measurements per sample) under a fluorescence microscope (Nikon Eclipse, Japan). 2.10

Cell spreading and morphology assays To test cell spreading and morphology, BMSCs were resuspended in the extract from

the DTSs, bECM-DTSs, tECM-DTSs, or L-DMEM and seeded on a coverslip at a density of 4 × 103 cells/cm2. After incubation for 3 h, the adhered cells were washed in PBS and fixed with 4% paraformaldehyde. The cells were first imaged with an inverted microscope (Olympus, TH4-200, Japan). Then, the cells were permeated in 0.1% Triton X-100 in PBS for 30 min, cultivated with fluorescein isothiocyanate (FITC)-phalloidin (Sigma) for labeling cytoskeletal actin filaments and with DAPI (Sigma) for labeling the cell nucleus, and finally photographed with a Laser scanning confocal microscope (NIKON, A1RMP, Japan). Images were taken from randomly selected fields of view (N = 5 repeated measurements per sample). The images were analyzed with ImageJ software by measuring the cellular perimeter (as defined by the actin labeling) manually, to calculate the projected area and circularity of the cells as previously described.17 2.11

Reverse transcription quantitative PCR (RT-qPCR) examination Total RNA was extracted by lysing the cells using TRIZOL reagent (Invitrogen,



Page 10 of 48 10

Carlsbad, CA, USA) following the manufacturer’s protocol at 1, 3, and 6 h. The mRNA was reverse transcribed using GoScript™ Reverse Transcription System (Promega, USA). The synthesized cDNA was amplified by Quantitative TaqMan® RT-qPCR. The rat-specific primers for migration-related genes, including CXCR4, CCR2, matrix metalloproteinase-2 (MMP2), matrix metalloproteinase-9 (MMP9), Vimentin, and the housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were synthesized by Sango Biotech (Shanghai, China). The sequences of the primers were listed in Table 1. The expression of target gene was normalized to that of GAPDH gene. The relevant expression level of the mRNA was reflected by the Ct value calculated by the 2-△△Ct method. Table 1 The primers used for RT-qPCR Genes

CXCR4

CCR2

MMP2

MMP9

Vimentin

GAPDH

Primer nucleotide sequence (5’ to 3’)

Forward

CGGTCATCCTTATCCTGGCT

Reverse

CTCTTGAATTTGGCCCCGAG

Forward

CATAGGGCTGTGAGGCTCATC

Reverse

CTGCATGGCCTGGTCTAAGTG

Forward

GCCATCCCTGATAACCTG

Reverse

TAAGCACCCTTGAAGAAATA

Forward

ACCATCCGAGCGACCTTT

Reverse

AACCCTGCGTATTTCCATT

Forward

CAGATGCGTGAAATGGAAGAG

Reverse

CAGGGAAGAAAAGTTTGGAAGAG

Forward

AAGCTCATTTCCTGGTATGACA

Reverse

TCTTACTCCTTGGAGGCCATGT


Production

Annealing

size (bp)

temperature (°C)

211

57

150

60

74

54

74

54

237

54

86

57

Page 11 of 48 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2.12

Western blot analysis BMSCs exposed to the extracts from DTSs, bECM-DTSs, tECM-DTSs, or L-DMEM

for 3 h were rinsed twice with ice-cold PBS, lysed with RIPA Lysis Buffer (Servicebio, China), and transferred into centrifuge tubes followed by centrifugation at 12,000 rpm for 10 min. The supernatant was collected and mixed with 4× sodium dodecyl sulfate, followed by heating at 100°C for 5 min. Proteins were loaded on 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, separated and transferred onto a PVDF membrane. The PVDF membrane was incubated with the corresponding antibody at 4°C overnight (10 mL of 1 × TBS and Tween-20 (TBST), 5% non-fat milk and antibody), followed by incubation with horseradish peroxidase-conjugated goat anti-rabbit secondary antibody at room temperature for 1 h. After washing in TBST, visualization was performed with an ECL kit (Servicebio, China), and semiquantification of band volume was performed with a gel image system. The following antibodies were used for immunoblotting: anti-CXCR4

(1:1500,

Abcam,

USA),

anti-CCR2

(1:1000,

Bioss,

China),

anti-phosphatidylinositol 3-kinase (anti-PI3K) (1:1000, CST, USA), anti-phosphorylated PI3K (anti-p-PI3K) (1:3000, Servicebio, China), anti-serine/threonine protein kinase (anti-AKT) (1:1000, Affinity, USA), anti-phosphorylated AKT (p-AKT) (1:1000, Affinity, USA), and anti-GAPDH (1:1000, Servicebio, China). The expression of target proteins was normalized to that of GAPDH. 2.13

Statistical analysis Unless otherwise stated, the quantitative data were expressed as mean ± standard

deviations (SD). A one-way analysis of variance (ANOVA) with a Dunnett’s T3 post hoc



Page 12 of 48 12

test was used to calculate the statistical differences. Data were analyzed using SPSS software ver.16.0 (SPSS, USA). p values < 0.05 were considered significant.

3. Results 3.1 Characterization of stem cell-derived ECM-DTSs The stem cell-derived ECM-DTSs were prepared as illustrated in Fig. 1. BMSCs and TDSCs cultured on the DTSs for 15 d were decellularized, and the removal of cellular components was affirmed by DNA quantification and H&E staining. The amount of DNA content

in

the

bECM-DTSs

and

tECM-DTSs

was

significantly

reduced

after

decellularization (p < 0.05, Fig. 2 A and B). Specifically, 31.10 ± 7.10 ng/mg and 9.77± 1.78 ng/mg of DNA was present in the decellularized bECM-DTSs and tECM-DTSs, respectively, whereas, 117.70 ± 11.42 ng/mg and 190.30 ± 2.83 ng/mg of DNA was present before decellularization (Fig. 2 A and B). After 15-day culture, dense cell sheets produced by BMSCs (Fig. 3 B) and TDSCs (Fig. 3 D) were formed on the surface of the DTSs (Fig. 3 A), as shown by imaging of H&E-stained sections. After decellularization, almost all the seeded stem cells were removed from the stem cells-DTS, and there was visible ECM on the surface of the ECM-DTSs (Fig. 3 C and E). Moreover, the surface topography analysis by SEM revealed changes in the surface morphology before and after modification with stem cell-derived ECM (Fig. 4). Before modification, the specific collagen fiber patterns of native tendon were quite distinct in the DTSs (Fig. 4 A). When seeded with BMSCs or TDSCs, the surfaces of the DTSs were completely covered by the stem cells and their ECM (Fig. 4 B and D). The stem cell-derived ECM was still preserved after the decellularization processing (Fig.


Page 13 of 48 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


4 C and E).

Fig. 1 Schematic illustration of the preparation of stem cell-derived ECM-DTSs.

Fig. 2 DNA content before and after the decellularization process as determined by the PicoGreen assay. (A) bECM-DTSs, (B) tECM-DTSs. *, indicates a p value of

Stem Cell Extracellular Matrix-Modified Decellularized Tendon Slices

Recommend Documents