Stereochemistry-Guided DNA Probe for Single Nucleotide

Subscriber access provided by UNIV OF NEBRASKA - LINCOLN

Article

Stereochemistry-guided DNA probe for single nucleotide polymorphisms analysis Benmei Wei, Tianchi Zhang, Xiaowen Ou, Xinchun Li, Xiaoding Lou, and Fan Xia ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.6b03896 • Publication Date (Web): 01 Jun 2016 Downloaded from http://pubs.acs.org on June 12, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Stereochemistry-guided DNA Probe for Single Nucleotide Polymorphisms Analysis Benmei Wei, Tianchi Zhang, Xiaowen Ou, Xinchun Li, Xiaoding Lou and Fan Xia* Hubei Key Laboratory of Bioinorganic Chemistry & Materia Medica, School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan 430074, China KEYWORDS: Chirality, Single nucleotide polymorphism, Tryptophan, Electrochemical DNA sensor, Supersandwich

ABSTRACT: Single nucleotide polymorphisms (SNPs) are the most abundant genetic polymorphisms, and responsible for many genetic diseases and cancers. In general, SNPs detection is performed by single probe system (SPS), in which a single probe specifically hybridizes to one target. However, this method is hard to improve the hybridization specificity and single mismatched discrimination factors (DF). In addition, the multi-probe system (MPS) requires complex probe designs and introduces at least one auxiliary probe except for the probe complementary to the target, resulting in complicated detection system. Faced with these difficulties, we perform the SNP detection using D/L-Tryptophan (Trp) guided DNA probe and regulate the DF of electrochemical DNA (E-DNA) sensors by molecular chirality. We show that the DF of D-Trp incubated E-DNA sensor (D-sensor) is larger than that of L-sensor. More importantly, we achieve the high specificity by coupling D-Trp and L-Trp incubated E-DNA

ACS Paragon Plus Environment

1


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 20

sensors, and the median DF is 7.21. Furthermore, the specificity of SNP detection can be further improved by supersandwich assay and the median DF is enlarged to 37.23, which comparable to that of obtained with multi-probe detection system.

INTRODUCTION

Single nucleotide polymorphisms (SNPs) are the most abundant type of DNA variation in the human genome, which can act as an important indicator for genetic diseases1-3 and confer drug resistance to pathogenic bacteria or viruses.4-5 As a result, a variety of methods and technologies have been developed for the fast, simple and quantitative SNPs analysis such as electrophoresis,6-8 optical methods9-13 and electrochemical technologies.14-18 Commonly, SNPs detection is performed by single probe system (SPS), in which a single probe captures either one target molecule of complementary or single mismatched sequence, and the span of Gibbs free energy (∆G) is only 1.4 kJ/mol/base pair.19 In this circumstance, the hybridization specificity is hard to enhance and the single mismatched discrimination factors (DF, the ratio of the net signal gain obtained with the perfectly matched target to that obtained with the single mismatched counterpart) are usually less than 3.20-21 In order to enhance the DF of SNPs detection, Xiao et al. developed the single probe detection system and designed a triple-stem structure probe for SNPs analysis using fluorescent12 and electrochemical14 methods, and the median DFs are 13.3 and 6.2 respectively. Recently, Zhang et al. presented toehold exchange probes for SNPs analysis.22-23 They show effective single-base change discrimination using the multi-probe system (MPS), in which at least one auxiliary probe is introduced except for the probe complementary to target. They produce the median discrimination factor (the ratio of the hybridization yield obtained with the correct target to that obtained with spurious target) of 43. Unfortunately, these methods are


2

Page 3 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


very complicated for SNPs analysis. In general, SPS requires complex probe designs. On the other hand, the MPS is more complicated because other auxiliary probes are introduced. Chirality is an enduring topic, and it plays a very important role in life science,24-29 pharmaceutical industry30-32 and material field.33-35 Recently, we regulate the DNA self-assembly and DNA hybridization by molecular chirality, and successfully edit the sensitivity and detection limit.36 Herein, we perform the SNP detection using D/L-Tryptophan (Trp) guided DNA probe, and regulate the DF of electrochemical DNA (E-DNA) sensors by molecular chirality. We show that the DF of D-Trp incubated E-DNA sensor (D-sensor) is larger than that of L-sensor, and the average ratio of DF (DFD/DFL) is 1.19. Moreover, we achieve the high specificity by coupling DTrp and L-Trp incubated E-DNA sensors, and the median DF is 7.21. More importantly, the different of DF and specificity of sensors can be further improved by supersandwich assay, the average ratio of DF is enlarged to 1.64 and the median DF is increased to 37.23.

EXPERIMENTAL SECTION

Materials and Reagents. All oligonucleotides are synthesized and purified by Sangon Biotechnology Co. Ltd. (Shanghai, China), and the sequences are shown in Table S1. L-Trp, DTrp, D/L-Tyrosine (Tyr) and D/L-Alanine (Ala), Tris-(2-carboxyethyl) phosphine hydrochloride (TCEP), and 6-mercaptohexanol (MCH) are obtained from Sigma. All other chemicals are of analytical grade, and all chemicals are used without further purification. All solutions are prepared with ultrapure water (resistivity=18.2 MΩ•cm) from a Millipore system. Fabrication of the D/L-Trp incubated sensors. The gold electrode (2 mm diameter) is first immersed in freshly prepared piranha solution for 30 min and rinsed with ultrapure water. Then, the electrode is successively polished to a mirror-like surface with 1.5, 0.5 and 0.05 µm alumina


3


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 20

slurries. After this treatment, the electrode is washed in an ultrasonic cleaner with ethanol and ultrapure water for 5 min respectively. Finally, the electrode is electrochemically cleaned (a series of oxidation and reduction cycles in 0.5 M NaOH, 0.5 M H2SO4, 0.01 M KCl/0.1 M H2SO4, and 0.05 M H2SO4) as previously described.37 Prior to immobilization onto the gold electrode, the thiolated methylene blue labeled probe is dissolved in 10 mM TCEP and incubated for 1 h to reduce disulfide bonds in the dark. Firstly, the gold electrode is immersed in 50 µM MCH solution for 10 min, and rinsed with ultrapure water and dried under nitrogen gas. Secondly, the solution of probe (1 µM) is dropped onto the gold electrode surface to assemble for 2 h by Au-S bonds. After rinsed with binding buffer (137 mM NaCl, 0.5 mM MgCl2, 2.7 mM KCl, 2 mM KH2PO4, 10 mM Na2HPO4, pH 7.4) and dried with nitrogen gas, the gold electrodes are incubated with L-Trp and D-Trp respectively, rinsed thoroughly with buffer and dried with nitrogen gas to obtained D/L-Trp incubated sensors. Electrochemical measurements. The measurements are performed on a CHI 660D electrochemical workstation (CHI Instruments Co., Shanghai, China) at a room temperature. A conventional three-electrode system is involved, which is consisted of a modified gold electrode as the working electrode, a platinum wire as the counter electrode, and a calomel electrode as the reference electrode. The electrochemical performance is investigated by square-wave voltammetry (SWV) with a potential window from -0.1 to -0.5 V, a potential step of 0.004V, an amplitude of 0.025 V and a frequency of 60 Hz. The electrolyte and hybridization buffer used in this study is binding buffer (137 mM NaCl, 0.5 mM MgCl2, 2.7 mM KCl, 2 mM KH2PO4, 10 mM Na2HPO4, pH 7.4). Supersandwich assays. The cleaned gold electrode is immersed in 50 µM MCH for 10 min, rinsed with ultrapure water and dried under nitrogen gas.38 Then, the solution of capture probe (1


4

Page 5 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


µM) is dropped onto the gold electrode surface to assemble 2 h, and incubated with L-Trp and DTrp respectively. After rinsed with Tris-HCl buffer (10 mM Tris, 500 mM NaCl, 1 mM MgCl2, pH 7.40) and dried with nitrogen gas, target is further dropped onto the electrode surface and washed with Tris-HCl buffer. Finally, signal probe (1 µM) is dropped onto the electrode surface to hybridization for 1 h. The electrolyte and hybridization buffer used in this study is Tris-HCl buffer.

RESULTS AND DISCUSSION

Fabrication of the D/L-Trp incubated sensors. First of all, we choose a thiolated methlyene blue (MB)-modified L-Trp aptamer39 as sensing probe, which is covalently attach to a gold electrode by Au-S bond (Figure 1a). We observe a reduction peak at -0.27 V potential expected for MB (Figure S1). However, the peak currents are almost invariant after the incubation of LTrp (Figure S1a) and D-Trp (Figure S1b), which is attributed to stable probe configuration (Gquadruplex conformation) no matter whether D/L-Trp is present or not.40 That is to say, the distance of MB and gold electrode is unchanged even if the probe interacts with L-Trp or D-Trp. In addition, we investigate the interaction between probe and D/L-Trp using electrochemical impedance spectroscopy (EIS) method, which is a powerful technique that can be used to elicit information about an electrode interface. The addition of the diameter of the semicircle indicates the increase of the interfacial charge-transfer resistance (Rct).41 The Rct are almost same in the absence of D/L-Trp (Figure S2, curve b), but the Rct of the L-Trp incubated gold electrode is larger than that of D-Trp treated one (Figure S2, curve c). This result confirms that the probe has a stronger interaction with L-Trp than D-Trp. At the same time, we fabricate the chiral sensors using D/L-Trp incubated probes.


5


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 20

Figure 1. a) Fabrication of D/L-Trp incubated sensors and their application in SNP analysis. The difference of signal gain is distinct when L-Trp (b) and D-Trp (d) incubated sensors are challenged with perfectly matched (PM) target. However, this difference is not significant when L-Trp (c) and D-Trp (e) incubated sensors are challenged with 1-mismatched (1-MM) target. Regulation of the DFs by molecular chirality. We perform the SNP analysis using D/L-Trp incubated sensors. Upon addition of 1250 nM perfectly matched (PM) target, the peak currents decrease is observed (Figure S3), presumably because the hybridization with a target molecule reduces the collision efficiency between MB and gold electrode. Moreover, the signal gain is distinguishing on chiral sensors. For L-Trp incubated sensor, the current is suppressed by 33.0±0.7% (Figure 1b, Figure S3a), which is lower than the value (43.1±0.4%) of D-Trp treated


6

Page 7 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


sensor (Figure 1d, Figure S3b). In order to hybridize with the probe, the target should overcome the interaction between the probe and chiral molecules. L-Trp has a stronger interaction with probe because of specific aptamer-small molecule interaction, resulting in lower signal gain. DTrp, in contrast, has a weaker interaction with probe, resulting in higher signal gain. In addition, we also attempt to regualte the signal gain using other natural amino acids (Tyr and Ala) as the chiral sources. The signal gains of other amino acids incubated sensors are higher than the values of Trp incubated sensors because of the weaker interaction between the probe and other amino acids.39 However, the signal gains of chiral sensors are almost same when Tyr or Ala is used as the chiral sources (Figure S4). Meanwhile, the biggest difference of signal gain is obtained by optmizing the experimental conditions such as Trp concentration and target length. For L-Trp incubated sensor, we observe that the signal gain decreases along with the concentration addition of L-Trp (red column in Figure S5), which is caused by the enhancement of interaction between probe and L-Trp. The higher of L-Trp concentration is, the more probe can interacts with L-Trp. Thus, the target hybridizing with probe needs to overcome the stronger interactions when the L-Trp concentration increases, resulting in the decrease in signal gain. D-Trp incubated sensor, the signal gain decreases when the concentration of D-Trp is added from 0.01 to 0.1 mM. However, the signal gain is almost unchanged when the concentration of D-Trp exceed 0.1 mM (blue column in Figure S5). We deduce that no more probe interacts with D-Trp when the D-Trp concentration exceed 0.1 mM because of the weaker interaction between probe and D-Trp, namely, the number of probe that links with D-Trp is saturated when the D-Trp concentration is 0.1 mM. Therefore, the target hybridizing with probe need overcome the similar interaction froce when D-Trp concentration is varied form 0.1 to 10 mM, which results in similar signal gain.


7


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 20

Target length is another important factor for signal gain. We observe that the signal gain increases along with the addition of target length (7-11 bases) on D/L-Trp incubated sensors (Figure S6), and the difference of signal gain on chiral sensors gradually increased (Figure S7). This is because the H-bond interactions between probe and target strengthens along with the addition of target length. We also attempt to broaden the difference of signal gain using a longer target. Unfortunately, the difference is tiny when the chiral sensors are challenged with 34-base target (Figure S8). Under this circumstance, the probe-target interaction is much stronger than probe-Trp interaction, namely, the probe-Trp interaction is negligible in contrast to the interaction between probe and 34-base target. On the basis of the difference of signal gain on chiral sensors, we successfully program the detection limit, the detection limit on D-Trp incubated sensor is 10 nM and lower than the value on L-Trp incubated sensor by about 5 times (Figure 2a-c). This result shows that molecular chirality has the ability to regulate DNA hybridization, and verifies our previous observation.36 In addition, we investigate the specificity of D/L-Trp incubated sensors. The chiral sensors are capable of discriminating between PM and 1-mismatched (1-MM) target (Figure 2d). For the LTrp incubated sensor, the current is suppressed by 33.0± 0.7% in the presence of 1250 nM PM target (11 bases); the signal is decreased by only 8.5±1% for 1MM target (C-C mismatch) in the same conditions. Similarly, for the D-Trp treated sensor, the current is suppressed by 43.1±0.4% and 9.9±1.5% in the presence of PM target and 1-MM target respectively. In order to


8

Page 9 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. (a) Dose-response curves of the L-Trp and D-Trp incubated sensors. (b) The concentrations are (from a to e) 0 nM, 50 nM, 250 nM, 1250 nM, 5000 nM. (c) The concentrations are (from a to f) 0 nM, 10 nM, 50 nM, 250 nM, 1250 nM, 5000 nM. (d) Signal gains of chiral sensors in the presence of PM and 1-MM targets. quantitatively characterize the general specificity of chiral sensors, we used five single-base mismatches at different positions across the 11-base target by defining the discrimination factor as the ratio of signal gain obtained with PM target to that obtained with 1-MM target (PM gain/1-MM gain). Among these variants, the best discrimination is observed for C-C mismatch, which consistent with previous observation that cytosine mismatches are the most destabilizing.42 Furthermore, the discrimination factors of chiral sensors are distinguishing, the discrimination factors of D-Trp incubated sensor are larger than that of L-Trp incubated sensor (Table S2), and the average ratio of DF (DFD/DFL) is about 1.19. In addition, we also attempt to investigate the specificity of supersandwich assay by using L-Trp aptamer as capture probe and signal probe (Figure 3). For this assay, a signal probe hybridized to complementary regions on


9


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 20

each of two target molecules, thus creates long DNA concatamers containing repeated units of signal probes and targets, and achieves efficient signal ampliﬁcation.43-46 The formation of proposed supersandwich structures is confirmed firstly by gel electrophoresis (Figure S9). The analysis shows a ladder of different lengths of the supersandwich structure, the maximum length is much more than 500 base pairs. After the addition of PM target, we observe that the difference of detection limit is amplified, the detection limit of D-Trp incubated supersandwich is 1 pM and lower than the value on L-Trp treated supersandwich about 1 order of magnitude (Figure S10a). In addition, supersandwich assay can readily discriminates between PM and 1MM target (Figure S10b). More importantly, supersandwich assay has the ability for amplifying the difference of DF, and the average value of DFD/DFL is enlarged to about 1.64 (Table 1).

Figure 3. Fabrication of D/L-Trp incubated supersandwich assay and their application in the SNP detection.


10

Page 11 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 1. Discrimination Factors (DFs) of the L/D-Trp incubated supersandwich for 1MM targets differing from PM target (mismatches marked in Red) DFs DNA Target Sequence 1MM (D/L-Trp incubated (5’-3’) Base-Pair supersandwich) ACCTAACCAACGTGCTAGCACGAAACCCAAACCT ACCTAACCAACGTCCTAGCACGAAACCCAAACCT C-C 5.68/3.53 ACCTAACCAACGTGGTAGCACGAAACCCAAACCT G-G 5.62/3.41 ACCTAACCAACGTGATAGCACGAAACCCAAACCT G-A 5.65/3.45 ACCTAACCAACGTGTTAGCACGAAACCCAAACCT G-T 5.32/3.25 ACCTAACCAACGTGCAAGCACGAAACCCAAACCT A-A 5.49/3.27

Ultraspecific SNP detection by coupling L/D-incubated E-DNA sensor. Chiral molecules incubated sensors can discriminate PM and 1-MM target. However, the difference (the signal gain of D-Trp incubated sensor subtract the signal gain of L-Trp incubated sensor) is distinct when the sensors challenge with PM and 1-MM target. The difference is about 10.1% when chiral molecules incubated sensors are challenged with PM target, however, the difference is only approximately 1.5% in the presence of 1MM target, which is caused by weaker H-bond interaction between probe and 1-MM target. We obtain the high discrimination factor by coupling D/L-Trp incubated sensors and define the new single-base mismatch discrimination factor as the ratio of the difference of signal gain obtained with the PM target to that obtained with the 1-MM target (Formula 1). For example, we obtained a average difference of 1.4% in siganl gain for 1-MM traget (C-C mismatch), and achieved a discrimination factor of 7.21 in the analysis of C-C mismatch target at concentration of 1250 nM (Formula S1). Discrimination Factor =

PM gainD - PM gainL 1MM gainD - 1MM gainL

(1)

In order to demonstrate the generality of the sensor, we test the capacity of sensor to discriminate against 1-MM bases at different positions within the PM target. We observe discrimination factors ranging from 3.88 to 14.43 (Table S3). Larger discrimination factors are


11


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 20

thus indicative of high speciﬁcity. Furthermore, we achieve the ultraspecific SNP detection using supersandwich assay, which consists of a repeating sequence of probe and target molecules, resulting in perfroming nucleic acid analysis with single probe system. The discrimination factor of SNPs analysis are ranging from 29.39 to 53.19 (median = 38.71) (Table 2), which comparable to the values obtained with the multi-probe detection system (Table S4).

Table 2. Ultraspecific SNP detection by coupling L/D-Trp incubated supersandwich (mismatches marked in Red) DNA Target Sequence 1-MM Discrimination (5’-3’) Base-Pair Factors ACCTAACCAACGTGCTAGCACGAAACCCAAACCT ACCTAACCAACGTCCTAGCACGAAACCCAAACCT C-C 29.39 ACCTAACCAACGTGGTAGCACGAAACCCAAACCT G-G 33.85 ACCTAACCAACGTGATAGCACGAAACCCAAACCT G-A 37.23 ACCTAACCAACGTGTTAGCACGAAACCCAAACCT G-T 39.89 ACCTAACCAACGTGCAAGCACGAAACCCAAACCT A-A 53.19 CONCLUSION

In summary, we report a stereochemistry guided probe for SNPs detection and regulate the discrimination factor of electrochemical DNA (E-DNA) sensors by molecular chirality. We find that the signal gain of L-Trp incubated sensor is lower than corresponding D-Trp treated one in the presence of PM target. Moreover, we also observe that the discrimination factor of D-Trp incubated E-DNA sensor is larger than that of L-Trp incubated sensor, and the average ratio of discrimination factor is 1.19. Furthermore, the ratio of discrimination factor can be amplified to 1.64 by supersandwich assay. More importantly, we quantitate the specificity of sensor by coupling D/L-Trp incubated sensors, and define the ratio of difference of signal gain in PM target to that value in 1-MM target as new discrimination factor, and obtain a high median discrimination factor of 7.21. In addition, we further enhance the specificity using supersandwich


12

Page 13 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


assay, and the median discrimination factor is enlarged to 38.71. Chirality is one of the fundamental biochemical properties in the living world, thus this result is helpful for developing new biodevices, and provides a useful method toward highly multiplexed clinical diagnostics at the point-of-care.

ASSOCIATED CONTENT

Supporting Information. DNA sequences, additional figures, formula and tables. The materials is available free of charge via the Internet at http://pubs.acs.org. AUTHOR INFORMATION Corresponding Author * Phone: +86-27-87559484. E-mail: [email protected] Notes The authors declare no competing financial interest.

ACKNOWLEDGMENT

This work was supported by National Basic Research Program of China (973 program, 2015CB932600, 2013CB933000), the National Natural Science Foundation of China (21525523, 21375042, 21574048, 21405054) and 1000 Young Talent (to Fan Xia).


13


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 20

REFERENCES

(1) Gunderson, K. L.; Steemers, F. J.; Lee, G.; Mendoza, L. G.; Chee, M. S. A Genome-wide Scalable SNP Genotyping Assay Using Microarray Technology. Nat. Genet. 2005, 37, 549-554. (2) Kim, S.; Misra, A. SNP Genotyping: Technologies and Biomedical Applications. Annu. Rev. Biomed. Eng. 2007, 9, 289-320. (3) McCarthy, J. J.; Hilfiker, R. The Use of Single-nucleotide Polymorphism Maps in Pharmacogenomics. Nat. Biotechnol. 2000, 18, 505-508. (4) Bang, H.; Park, S.; Hwang, J.; Jin, H.; Cho, E.; Kim, D. Y.; Song, T.; Shamputa, I. C.; Via, L. E.; Barry, C. E.; Cho, S.; Lee, H. Improved Rapid Molecular Diagnosis of Multidrug-resistant Tuberculosis Using a New Reverse Hybridization Assay, REBA MTB-MDR. J. Med. Microbiol. 2011, 60, 1447-1454. (5) Schena, M.; Shalon, D.; Davis, R. W.; Brown, P. O. Quantitative Monitoring of Gene Expression Patterns with a Complementary DNA Microarray. Science 1995, 270, 467-470. (6) Brazill, S.; Hebert, N. E.; Kuhr, W. G. Use of an Electrochemically Labeled Nucleotide Terminator for Known Point Mutation Analysis. Electrophoresis 2003, 24, 2749-2757. (7) Andersen, P. S.; Jespersgaard, C.; Vuust, J.; Christiansen, M.; Larsen, L. A. Capillary Electrophoresis-based Single Strand DNA Conformation Analysis in High-throughput Mutation Screening. Hum. Mutat. 2003, 21, 455-465. (8) Gaunt, T. R.; Hinks, L. J.; Rassoulian, H.; Day, I. N. Manual 768 or 384 Well Microplate Gel ‘Dry’ Electrophoresis for PCR Checking and SNP Genotyping. Nucleic Acids Res. 2003, 31, e48. (9) Grimes, J.; Gerasimova, Y. V.; Kolpashchikov, D. M. Real-time SNP Analysis in Secondary-structure-folded Nucleic Acids. Angew. Chem. Int. Ed. 2010, 49, 8950-8953.


14

Page 15 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(10) Jia, X.; Li, J.; Han, L.; Ren, J.; Yang, X.; Wang, E. DNA-hosted Copper Nanoclusters for Fluorescent Identification of Single Nucleotide Polymorphisms. ACS Nano 2012, 6, 3311-3317. (11) Wang, H. Q.; Liu, W. Y.; Wu, Z.; Tang, L. J.; Xu, X. M.; Yu, R. Q.; Jiang, J. H. Homogeneous Label-Free Genotyping of Single Nucleotide Polymorphism Using Ligationmediated Strand Displacement Amplification with DNAzyme-based Chemiluminescence Detection. Anal. Chem. 2011, 83, 1883-1889. (12) Xiao, Y.; Plakos, K. J. I.; Lou, X.; White, R. J.; Qian, J.; Plaxco, K. W.; Soh, H. T. Fluorescence Detection of Single-nucleotide Polymorphisms with a Single, Self-complementary, Triple-stem DNA Probe. Angew. Chem. 2009, 121, 4418-4422. (13) Yeh, H. C.; Sharma, J.; Shih, I. M.; Vu, D. M.; Martinez, J. S.; Werner, J. H. A Fluorescence Light-up Ag Nanocluster Probe That Discriminates Single-nucleotide Variants by Emission Color. J. Am. Chem. Soc. 2012, 134, 11550-11558. (14) Xiao, Y.; Lou, X.; Uzawa, T.; Plakos, K. J.; Plaxco, K. W.; Soh, H. T. An Electrochemical Sensor for Single Nucleotide Polymorphism Detection in Serum Based on a Triple-stem DNA Probe. J. Am. Chem. Soc. 2009, 131, 15311-15316. (15) Liu, G.; Lin, Y. Electrochemical Quantification of Single-nucleotide Polymorphisms Using Nanoparticle Probes. J. Am. Chem. Soc. 2007, 129, 10394-10401. (16) Liu, G.; Lee, T. M.; Wang, J. Nanocrystal-based Bioelectronic Coding of Single Nucleotide Polymorphisms. J. Am. Chem. Soc. 2005, 127, 38-39. (17) Kato, D.; Sekioka, N.; Ueda A.; Kurita, R.; Hirono, S.; Suzuki, K.;

Niwa, O.

Nanohybrid Carbon Film for Electrochemical Detection of SNPs without Hybridization or Labeling. Angew. Chem. Int. Ed. 2008, 47, 6681-6684.


15


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 20

(18) Hsieh, K.; White, R. J.; Ferguson, B. S.; Plaxco, K. W.; Xiao, Y.; Soh, H. T. Polarityswitching Electrochemical Sensor for Specific Detection of Single-nucleotide Mismatches. Angew. Chem. Int. Ed. 2011, 50, 11176-11180. (19) SantaLucia, J.; Hicks, D. The Thermodynamics of DNA Structural Motifs. Annu. Rev. Biophys. Biomol. Struct. 2004, 33, 415-440. (20) Bonanni, A.; Chua, C. K.; Zhao, G.; Sofer, Z.; Pumera, M. Inherently Electroactive Graphene Oxide Nanoplatelets as Labels for Single Nucleotide Polymorphism Detection. ACS Nano 2012, 6, 8546-8551. (21) Du, Y.; Lim, B. J.; Li, B.; Jiang, Y. S.; Sessler, J. L.; Ellington, A. D. Reagentless, Ratiometric Electrochemical DNA Sensors with Improved Robustness and Reproducibility. Anal. Chem. 2014, 86, 8010-8016. (22) Zhang, D. Y.; Chen, S. X.; Yin, P. Optimizing the Specificity of Nucleic Acid Hybridization. Nat. Chem. 2012, 4, 208-214. (23) Chen, S. X.; Zhang, D. Y.; Seelig, G. Conditionally Fluorescent Molecular Probes for Detecting Single Base Changes in Double-stranded DNA. Nat. Chem. 2013, 5, 782-789. (24) Hazen, R. M.; Sholl, D. S. Chiral Selection on Inorganic Crystalline Surfaces. Nat. Mater. 2003, 2, 367-374. (25) Bentley, R. Role of Sulfur Chirality in the Chemical Processes of Biology. Chem. Soc. Rev. 2005, 34, 609-624. (26) Zerrouki, D.; Baudry, J.; Pine, D.; Chaikin, P.; Bibette, J. Chiral Colloidal Clusters. Nature 2008, 455, 380-382. (27) Castilla, A. M.; Ramsay, W. J.; Nitschke, J. R. Stereochemistry in Subcomponent SelfAssembly. Acc. Chem. Res. 2014, 47, 2063-2073.


16

Page 17 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(28) Zhang, M. X.; Qing, G. Y.; Sun, T. L. Chiral Biointerface Materials. Chem. Soc. Rev. 2012, 41, 1972-1984. (29) Hanein, D.; Geiger, B.; Addadi, L. Differential Adhesion of Cells to Enantiomorphous Crystal Surfaces. Science 1994, 263, 1413-1416. (30) Pollard, D. J.; Woodley, J. M. Biocatalysis for Pharmaceutical Intermediates: the Future is Now. Trends Biotechnol. 2007, 25, 66-73. (31) Hawkins, J. M.; Watson, T. J. N. Asymmetric Catalysis in the Pharmaceutical Industry. Angew. Chem. Int. Ed. 2004, 43, 3224-3228. (32) Federsel, H. J. Drug Chirality-scale-up, Manufacturing, and Control. Chemtech, 1993, 23, 24-33. (33) Tour, J. M. Layered Materials: Scaling up Exfoliation. Nat. Mater. 2014, 13, 545-546. (34) Tkachenko, G.; Brasselet, E. Optofluidic Sorting of Material Chirality by Chiral Light. Nat. Commun. 2014, 5, 3577. (35) Bradshaw, D.; Claridge, J. B.; Cussen, E. J.; Prior, T. J.; Rosseinsky, M. J. Design, Chirality, and Flexibility in Nanoporous Molecule-based Materials. Acc. Chem. Res. 2005, 38, 273-282. (36) Wei, B.; Liu, N.; Zhang, J.; Ou, X.; Duan, R.; Yang, Z.; Lou, X.; Xia, F. Regulation of DNA Self-assembly and DNA Hybridization by Chiral Molecules with Corresponding Biosensor Applications. Anal. Chem. 2015, 87, 2058-2062. (37) Xiao, Y.; Lai, R.; Plaxco, K. W. Preparation of Electrode-immobilized, Redox-modified Oligonucleotides for Electrochemical DNA and Aptamer-based Sensing. Nat. Protoc. 2007, 2, 2875-2880.


17


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 20

(38) Yang, X.; Zhang, C. H.; Jiang, H.; Li, G. J.; Wang, J. H.; Wang, E. K. Insertion Approach: Bolstering the Reproducibility of Electrochemical Signal Amplification via DNA Superstructures. Anal. Chem. 2014, 86, 4657-4662. (39) Yang, L.; Bing, T.; Mei, H.; Fang, C.; Cao, Z.; Shangguan, D. Characterization and Application of a DNA Aptamer Binding to L-tryptophan. Analyst 2011, 136, 577-585. (40) Yang, X.; Han, Q.; Zhang, Y.; Wu, J.; Tang, X.; Dong, C.; Liu, W. Determination of Free Tryptophan in Serum with Aptamer-comparison of Two Aptasensors. Talanta 2015, 131, 672-677. (41) Cao, Y.; Zhu, S.; Yu, J. C.; Zhu, X. J.; Yin, Y. M.; Li, G. X. Protein Detection Based on Small Molecule-linked DNA. Anal. Chem. 2012, 84, 4314-4320. (42) Frutos, A. G.; Pal, S.; Quesada, M.; Lahiri, J. Method for Detection of Single-base Mismatches Using Bimolecular Beacons. J. Am. Chem. Soc. 2002, 124, 2396-2397. (43) Liu, N.; Jiang, Y.; Zhou, Y.; Xia, F.; Guo, W.; Jiang, L. Two-way Nanopore Sensing of Sequence-specific Oligonucleotides and Small-molecule Targets in Complex Matrices Using Integrated DNA Supersandwich Structures. Angew. Chem. Int. Ed. 2013, 52, 2007-2011. (44) Xia, F.; White, R. J.; Zuo, X. L.; Patterson, A.; Xiao, Y.; Kang, D.; Gong, X.; Plaxco, K. W.; Heeger, A. J. An Electrochemical Supersandwich Assay for Sensitive and Selective DNA Detection in Complex Matrices. J. Am. Chem. Soc. 2010, 132, 14346-14348. (45) Jiang, Y.; Liu, N.; Guo, W.; Xia, F.; Jiang, L. Highly-efficient Gating of Solid-state Nanochannels by DNA Supersandwich Structure Containing ATP Aptamers: a Nanofluidic IMPLICATION Logic Device. J. Am. Chem. Soc. 2012, 134, 15395-15401.


18

Page 19 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(46) Shen, J.; Li, Y.; Gu, H.; Xia, F.; Zuo, X. Recent Development of Sandwich Assay Based on the Nanobiotechnologies for Proteins, Nucleic Acids, Small Molecules, and Ions. Chem. Rev. 2014, 114, 7631-7677.


19


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 20

TOC graphic


20

Stereochemistry-Guided DNA Probe for Single Nucleotide

Recommend Documents