Stereoselectivity-Tailored, Metal-Free Hydrolytic ... - ACS Publications

Subscriber access provided by Binghamton University | Libraries

Article

Stereoselectivity-Tailor-Made, Metal-Free Hydrolytic Dynamic Kinetic Resolution of Morita-Baylis-Hillman Acetates Using Engineered Lipase-Organic Base Cocatalyst Bo Xia, Jian Xu, Ziwei Xiang, Yixin Cen, Yujing Hu, Xianfu Lin, and Qi Wu ACS Catal., Just Accepted Manuscript • Publication Date (Web): 31 May 2017 Downloaded from http://pubs.acs.org on May 31, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Catalysis is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

Stereoselectivity-Tailor-Made, Metal-Free Hydrolytic Dynamic Kinetic Resolution of MoritaBaylis-Hillman Acetates Using Engineered LipaseOrganic Base Cocatalyst Bo Xia, †,§,‡ Jian Xu, †,‡ Zhiwei Xiang,†,‡ Yixin Cen,† Yujing Hu,† Xianfu Lin† and Qi Wu *,† † Department of Chemistry, Zhejiang University, Hangzhou 310027, P. R. China

ABSTRACT: Metal-free enantiocomplementary hydrolytic dynamic kinetic resolution of Morita-Baylis-Hillman (MBH) acetates was developed using triethylamine (TEA) as racemization catalyst and wild-type or engineered lipase B from Candida antarctica (CALB) as stereoselectivity-determining catalyst, leading to chiral MBH alcohols with tailor-made (R)- or (S)-configurations on an optional basis. In the TEA-WT CALB catalysis system, WT CALB displays excellent (S)-enantioselectivity for a series of MBH acetates tested (up to 96% ee and 98% conversion). Reversal of enantioselectivity in favor of (R)-MBH alcohols (95% ee; 95% conversion) was achieved by generating a focused site-specific mutagenesis library composed of less than 20 variants. Molecular modelling explains the origin of stereoselectivity.

ACS Paragon Plus Environment

1

ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 29

KEYWORDS: Dynamic kinetic resolution; Morita-Baylis-Hillman alcohols; Candida antarctica lipase B; Directed evolution; Organic base.

INTRODUCTION Morita–Baylis–Hillman alcohols (MBH alcohols) have aroused much attention in organic synthesis as valuable synthons and intermediates for the preparation of many important cyclic and acyclic compounds, their ready availability and condensed functional groups making them particularly attractive.1 In principle, efficient asymmetric MBH reaction constitutes a direct protocol for preparing chiral MBH alcohols, but this has remained a challenge to date.1-2 Notable developments toward this goal include the use of chiral catalysts such as cinchona alkaloid derivatives,2a chiral 4-dimethylaminopyridine-analogs,2b BINOL-derived Brønsted acids,2c chiral oxazaborolidinium salts,2d and bi-functional organocatalysts. All of these approaches have advantages and disadvantages. Enzymatic MBH reactions are characterized by low activity and poor stereoselectivity, as in the case of serum albumins (19% ee),3a protease (0% ee),3b esterase (0% ee),3c lipase (0% ee),3d and pepsin (38% ee)3e as well as Rosetta-designed enzymes (ee not reported).3f Kinetic resolution (KR) is another key tool in the synthesis of optically active MBH alcohols.45

Several approaches of nonenzymatic resolution have been reported, including enantioselective

hydrogenation,4a Sharpless epoxidation,4b chiral pyridine or phosphine-catalyzed acylation,4c-d chiral Pd-complexes or Rh(I)-catalyzed asymmetric 1,4-addition/β- hydroxyelimination4e-f.


2

Page 3 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

Compared with above approaches usually employing transition metal-complex chiral ligands catalysts, enzymatic resolution displayed many advantages in the aspects of environment, producing conditions and cost. Lipases are among the most used enzymes for industrial biocatalytic applications with high selectivity and broad substrate scope.6 However, to date, application in the KR of MBH alcohols has been less developed.5 To the best of our knowledge, only a few examples of lipase-catalyzed KR of MBH alcohols have been reported so far.5a-f However, high enantioselectivities are rare, and substrate scope remains limited. Moreover, an inherent disadvantage of KR as such is the fact that only a maximum of 50% conversion is possible. These serious limitations should be overcome. We have therefore explored an alternative approach based on the use of a lipase. In order to overcome this limitation, many efforts have been devoted to the evolution of KR into dynamic kinetic resolution (DKR) in which the KR step is combined with in situ racemization of the slow-reacting enantiomers leading to a theoretical yield of 100% based on the racemic substrate. Since the seminal development of DKR of sec-alcohols utilizing racemizing transition metal catalysts, reported by the groups of Williams7 and Bäckvall8 in 1997, many efficient and powerful applications of enzymatic DKR for the production of chiral secalcohols have been developed.9,6b However, the application of enzymatic DKR in the resolution of MBH alcohols has not yet been reported to date. Moreover, most chemo-enzymatic DKR were used in the acylation reaction of racemic sec-alcohols, and there are scarce examples via enzymatic hydrolytic DKR reaction to prepare chiral sec-alcohols because the racemization of ester substrates containing alcohols chiral center is difficult. To the best of our knowledge, only Williams and Kim reported two hydrolytic DKR of allylic acetates using a combination of Pd complexes/lipase as the catalyst, respectively (Scheme 1A).7,10 But the use of transition-metal


3

ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 29

complexes as racemization catalysts in these cases remains some environmental disadvantages. Here we report a metal-free chemo-enzymatic hydrolytic DKR of MBH acetates for the first time, which provides optionally either (R)- or (S)-configurated MBH alcohols. MBH adducts such as acetates and carbonates of MBH alcohols are known to undergo Michael additions with tertiary amines or phosphines, leading to intermediate quaternary ammonium or phosphonium salts, which can be exploited in transition metal catalyzed11 or organo-catalyzed substitution reactions with various O, N, and C nucleophiles (Scheme 1B).12,13 Inspired by these advances, we hypothesized that when suitable amines are used and no other nucleophiles are present, reversibility of addition and elimination would enable rapid enantiomerization of MBH acetates. DKR should then be possible by using (R)- and (S)-selective lipases, respectively (Scheme 1C).

Scheme 1. Different DKR Approaches of Racemic Allylic Acetates Previously Reported and MBH Acetates in This Work.


4

Page 5 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

RESULTS AND DISCUSSION In order to test the above hypothesis, several organic bases were selected as possible racemizing catalysts in the model reaction of (S)-1a with 93% ee (Table 1). It was found that two factors seem to influence racemization, the nucleophilicity of organic bases and their basicity. Some secondary amines such as imidazole and piperidine, or tertiary amines with high nucleophilicity such as 4-dimethylaminopyridine (DMAP) failed to provide the desired racemic MBH acetates


5

ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 29

(entries 1-3, Table 1). Moreover, some generally used bases in MBH reactions such as 1,8Diazabicyclo[5.4.0]-7-undecene (DBU) and 1,4-diazabicyclo[2,2,2]octane (DABCO) also failed to racemize the model compound (S)-1a (entries 4-5, Table 1). N-methylimidazole causes complete hydrolysis of the MBH acetates (entry 6, Table 1). Other amines were also inefficient (entries 10-11, Table 1). We are delighted to find three tertiary amines with similar pKa values which cause rapid racemization, including triethylamine (TEA), tri-n-propylamine and N-methyl pyrrolidine (entries 7-9, Table 1). TEA shows the best result, completely racemizing (S)-1a after 12 hours without any other byproducts (Figure S1). Table 1. Organic Base-catalyzed Racemization of Chiral MBH Acetate (S)-1a a

Entry

Bases

pKa

eei b

eet c

1

Imidazole

18.6

93

-- d

2

Piperidine

11.2

93

-- d

3

DMAP

9.7

93

-- d

4

DBU

13.5

93

-- d

5

DABCO

8.8

93

-- d

6

N-methylimidazole

7.0, 7.4

93

0e

7

TEA

10.8

93

0

8

tri-n-propylamine

10.7

93

31

9

N-methyl pyrrolidine

10.5

93

0f

10

Ethyldiisopropylamine

11.4

93

93

11

N, N-dimethylaniline

5.1

93

93

a

Reaction conditions: (S)-1a (0.040 mmol), base (0.1 mmol), toluene 1.0 mL, 50 oC, 12


6

Page 7 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

h, ee values were determined by chiral HPLC. b eei: the initiate ee value. c eet: the terminal ee value. d -- refer to no rac-1a was detected. e total hydrolysis, ee value of the obtained alcohol. f part hydrolysis with a small amount of alcohol as by product.

Before testing the TEA-lipase co-catalyzed DKR, we screened seven commonly used lipases for conventional hydrolytic KR without the addition of TEA (Table S1). It was found that only the lipase B from Candida antarctica (CALB) and subtilisin from Bacillus subtilis show notable stereoselectivity. CALB proved to be more active, and was therefore selected for all further work. Then we tested the TEA-CALB co-catalyzed DKR of MBH acetates. After optimizing some important reaction factors, including the dosage of TEA and enzyme, temperature and reaction time as shown in Figure S2, the best DKR result obtained for the model compound rac-1b was 96% ee value with 98% yield. Next the substrates scope of this TEA-CALB-cocatalyzed DKR was determined and the results were listed in Table 2. The DKR worked well for most rac-MBH acetates evaluated, and showed high stereoselectivity with ee values higher than 90% for five out of seven MBH acetates that can be accepted by this catalyst system (entries 1-5, Table 2). High to excellent yields were also obtained for these substrates. The position of sustituents of the phenyl moiety had important influence on the results. In the cases of different chlorine substituent positions, MBH acetates with meta- or para-chlorine substitution obtained good DKR results (entries 5, 6, Table 2), while the ortho-chloro derivative 1g was not accepted by CALB, probably due to the steric hindrance of ortho-substituent. Nitrile as the EWG in the MBH adduct frame was more suitable for CALB than the ester group considering the stereoselectivity obtained, and the reaction of compound 1h led to only 72% ee (entry 8, Table 2).

Table 2. TEA-CALB-cocatalyzed DKR of Rac-MBH Acetates Leading to (S)-Alcoholsa


7

ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 29

entry

R

EWG

yields (%) b

eep (%) b

1

p-Br (1a)

-CN

95

92

2

p-NO2 (1b)

-CN

98

96

3

p-Me (1c)

-CN

85

92

4

p-F (1d)

-CN

87

91

5

p-Cl (1e)

-CN

91

93

6

m-Cl (1f)

-CN

90

80

7

o-Cl (1g)

-CN

-- c

-- c

8

p-NO2 (1h)

-CO2Me

89

72

a

Reaction conditions: 40 mM MBH acetates, 100mM TEA and enzyme in toluene at 40 oC for 30 h. b Determined by chiral HPLC, mean value of 2−3 reactions. c -- refer to no reaction.

After the successful construction of the (S)-selective metal-free DKR process of racemic MBH acetates, we faced the challenge of reversing enantioselectivity, which meant inverting Kazlauskas’ rule.14 Directed evolution or site-specific mutagenesis of enzymes to improve their catalytic properties is now well established.15-17 There are several examples in which enzymes selectivity has been efficiently reversed by using this approach.16 We have previously demonstrated that CALB acid binding pocket can be modified through directed evolution to create enantiocomplementary mutants for the kinetic resolution of racemic acids.16f In order to reverse the stereoselectivity of CALB toward certain secondary alcohols, an important mutant of CALB, W104A, obtained by rational design and situated in the alcohol binding pocket, was


8

Page 9 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

reported by Hult and co-workers, showing moderate (S)-selectivity in the acylation of 1phenylethanol with vinyl butanoate (E = 6.6).18

A

B

Figure 1. (A) Structure of the active site of WT CALB (PDB: 1TCA)19 where tetrahedral intermediates (TI) of (R)- and (S)-1b are built on the catalytic S105 by YASARA software.20 Important amino acid residues surrounding (R)- or (S)-TI are shown as spheres. (B) Strategy for the construction of sharply focused CALB library, amino acid residues in WT CALB are shown in khaki.


9

ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 29

We first tested the W104A mutant in the hydrolytic KR of rac-1b, moderately reversed (R)enantioselectivity being observed (51% ee at 40% conversion). In order to further improve (R)selectivity of CALB mutants for the MBH acetates, a sharply focused library of CALB mutants was constructed under the guidance of molecular modeling by YASARA software (Figure 1A).20 Accordingly, four important amino acid residues (W104, A281, A282, L278) surrounding the alcohol binding pocket were selected for amino acid exchanges. In order to investigate the effect of the W104 residue on the reversed stereoselectivity of alcohols, we also performed a "subsaturation" mutagenesis at hot spot W104 in which W was mutated into some amino acids with small side chains including G, A, G, L and so on. Based on the best hit obtained from these mutagenesis experiments, three other amino acid residues were varied iteratively to A, L, K, and W to create a CALB library containing only 16 variants (Figure 1B, Table S3). This process is related to iterative saturation mutagenesis (ISM) at CAST sites proposed by Reetz and coworkers,15e while in the present case extremely small libraries were created requiring notably less screening. Positions A, L and W were selected as representative residues with small to large side chains, and K as functional residues with the longest carbon chain. All of them were used to modify the space available in the alcohol pocket of CALB. For screening, the hydrolytic KR of rac-1b in buffer was selected as the model reaction. The results are listed in Table 3 and S3, showing moderate to good E-values. As expected, most of W104 variants with small side chains showed reversed selectivity, and in fact the best hit among W104 variants is not W104A, but W104V showing reversed 61% ee value for (R)-selectivity (entry 7 in Table S3). In the whole library, the best variant was found to be WB13 with the sequence W104V/A281L/A282K providing reversed 80% ee of MBH alcohol (R)-2b under 42% conversion (E(R)= 16.1) (entry 5 in Table 3).


10

Page 11 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

In order to explore the effect of each mutation in the W104V/A281L/A282K variant on the reversed (R)-selectivity in the model reaction, deconvolution was performed by applying sitedirected mutagenesis to create three single point mutations and three double point mutants.17c The screening results revealed that the W104V mutation is crucial for reversing stereoselectivity (entries 7, 21-23, Table S3). Both W104V/A281L (E(R)= 7.3) and W104V/A282K (E(R)= 8.7) exert synergistic effects in the best variant (W104V/A281L/A282K, E(R)=16.1), which is an interesting case of cooperative non-additivity (entries 9, 20, Table S3).17c

Table 3. CAL-B Mutants Catalyzed KR of (Rac)-1b a

entry

mutants

sequence

eep b (%)

conv. b (%)

E

selectivity

1

WT

--

93

49

83

S

2

WB2

W104A

51

40

4.3

R

3

WB7

W104V

61

38

6.0

R

4

WB10

W104V/A281L

67

36

7.3

R

5

WB13

W104V/A281L/A282K

80

42

16.1

R

a

Reaction conditions: rac-1b (180mM in acetonitrile, 50 µL), 250 µL phosphate buffer (50 mM potassium phosphate, pH 7.5) and 200 µL enzyme supernatant, 37 oC, 48 h. b Determined by chiral HPLC.

Although a selectivity factor of E = 16 (mutant WB13) in a KR is only moderate, we speculated that it could suffice in DKR. Consequently, the best variant WB13 was used for the (R)-selective metal-free DKR of various MBH acetates, which indeed proved to be successful


11

ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 29

(Table 4). For the DKR of rac-1b, WB13 showed a stereoselectivity similar to that of the hydrolytic KR screening process. Other MBH acetates as substrates show truly excellent stereoselectivity (91-95% ee) (entries 1, 3-4, Table 4).

Table 4. (R)-selective WB13 Mutant-TEA-cocatalyzed DKR of MBH Estersa

entry

R

yields (%) b

eep (%) b

1

p -Br (1a)

92

91

2

p-NO2 (1b)

95

77

3

p -Me (1c)

70

95

4

p -F (1d)

71

95

a

Reaction conditions: 40 mM MBH acetates, 100 mM TEA and enzyme in toluene at 20 oC for 72 h. b Determined by chiral HPLC, mean value of 2−3 reactions.

Having in hand stereoselectivity tailor-made TEA-CALB (WT/Mutant) DKR approaches for MBH acetates, we then considered scale-up experiments for practical applications. Accordingly, the scales of 1.4g and 0.7g (rac)-1a were tested with the TEA-WT CALB and TEA-WB13 cocatalyzed DKR approaches, respectively. (S)- and (R)-MBH alcohols were successfully obtained in similar steroselectivity in the case of the screening reaction (Table 5), documenting the synthetic utility of these stereoselectivity tailor-made metal-free DKR.


12

Page 13 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

Table 5. Scaling-up DKR of Substrate (Rac)-1a Catalyzed by TEA-WT CALB or WB13

entry

enzyme

selectivity

eep (%) c

isolated yields (%)

1a

WT

S

93

85

2b

WB13

R

90

75

a

The reaction scale of rac-1a was 1.4 g. b The reaction scale of rac-1a was 0.7g. c Determined by chiral HPLC.

In order to shed light on the mechanism of TEA-mediated racemization, several experiments were designed (Scheme 2). Parallel to the departure of OAc-, the deprotonation of chiral carbon in MBH acetates may also cause racemization, as in base-catalyzed deprotonation at the αcarbon of α-haloarylacetic acids or thioesters,21-22 although they are different because of the weaker acidity of the α-proton in our substrates. We prepared labeled rac-1b with 95% deuterium isotopic content at the α-position (Scheme S1, Figure S4), and used it as the substrate for TEA-CALB co-catalyzed DKR reaction. The MBH alcohol was obtained with similar deuterated ratio, implying that the α-proton of MBH acetates was not deprotonated during the racemization process. Moreover, we added phenol, which is a stronger nucleophile than OAc-, into the TEA-CALB co-catalyzed DKR reaction system. This resulted in the allylic nucleophilic substitution product of MBH acetate with phenol in 90% yield after 8 hours. These results are in line with the postulate that racemization of MBH acetates occurs through the TEA-catalyzed allylic nucleophilic substitution SN2'-SN2' mechanism (Scheme 1B-C).


13

ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 29

Scheme 2. Deuterium Labeling Study and Nucleophilic Substitution of (Rac)-1b with Phenol Corroborate Proposed SN2'-SN2' Mechanism

The source of tailor-made stereoselectivity from WT CALB and variants WB13 was further explored by molecular modeling (MM) and molecular dynamics (MD) computations. The amino acid mutations were introduced using the modeling suite YASARA,20 followed by energy minimizations, and then the substrates (R)- and (S)-1b were introduced as tetrahedral intermediates (TI) covalently bound to catalytic active S105. 10 ns MD simulations were carried out for WT CALB and the best mutant WB13, respectively, and MD trajectories were sampled every 100 ps, resulting in 100 simulation frames per run. The energy of the bound tetrahedral intermediate was calculated for every simulation frame, and the distances for catalytic hydrogen bonds were also computed.


14

Page 15 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

A

B

C

D

Figure 2.

Comparison of the optimized poses and hydrogen bonds network in tetrahedral

intermediates (TI) of (R)- and (S)-1b built on the side-chain O atom of the catalytic S105 in WT CALB and enantio-complementary mutant WB13. (A) the productive (S)-TI-CALB complex; (B) the nonproductive (R)-TI-CALB; (C) the productive (R)-TI-WB13 complex; (D) the nonproductive (S)-TI-WB13. S105, H224 and D187 are catalytic triad.

From the energy-minimized average structure of the bound TI with favored (S)-1b in the active site of WT CALB as shown in Figure 2A, all the hydrogen bonds required for catalysis can occur readily. In contrast, one important hydrogen bond between H224 (HE2 atom) and the bound (R)-TI oxygen (O2 atom) was lost in the case of the slow-reacting enantiomer (R)-1b (Figure 2B) having longer distance between these two atoms (3.856Å vs. 1.931 Å) and smaller


15

ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 29

bond-angles of NE2--HE2--O2 (120.730° vs. 150.961°) (Table S4). Moreover, the calculated stabilization energy of bound (S)-pose TI in (S)-selective WT CALB is lower than that of bound (R)-pose TI. The average potential energy of bound (S)-1b TI in WT is -449.46±21.69 KJ/mol, and that for (R)-1b tetrahedral intermediate is -436.33±24.21 KJ/mol. The calculated difference in stabilization energy of the two enantiomers amounts to 13.13 KJ/mol (3.1kcal/mol) (Figure S5A). These results clearly explain high (S)-selectivity of WT CALB toward these racemic MBH acetates. In the case of (R)-selective variant WB13, the important hydrogen bonds network required for nucleophilic attack between the (R)- or (S)-TIs and His 224 was basically similar (Figure 2C and 2D), except for the clearly reduced length (1.847 Å) between H224 (HE2 atom) and the bound (R)-TI oxygen (O2 atom) and the corresponding increased bond angles (156.818°) compared with that of (S)-TI (1.924 Å and 154.150°) (Table S4). Another difference was observed because the (R)-pose TI is favorably stabilized by forming two H-bonds with Q106 and T40, respectively, and the (S)-pose TI only with T40. Similar difference in stabilization energy of the (R)- or (S)TIs in variant WB13 was also observed as in WT CALB (Figure S5B). The average potential energy of bound (R)-1b tetrahedral intermediate in WB13 is -448.30±25.30 KJ/mol, and that for (S)-1b tetrahedral intermediate is -442.06±22.65 KJ/mol. Thus the calculated difference in stabilization energy of the two enantiomers in (R)-selective WB13 mutant amounts to 6.24 KJ/mol (1.5kcal/mol). These molecular modeling results are consistent with the experimentally observed stereoselectivity of WT CALB and variants.

CONCLUSIONS


16

Page 17 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

In conclusion, this work demonstrates that the DKR of MBH acetates can be achieved under metal-free co-catalysis of TEA and one lipase for the first time, wild-type CALB and an engineered mutant to provide important chiral MBH alcohols with tailor-made (R)- or (S)configurations. WT CALB shows high preference for (S)-MBH alcohols, the best results amounting to 96% ee and 98% yield. The best variant (W104V/A281L/A282K) with synthetically valuable reversed enantio-selectivity for (R)-MBH alcohols was successfully obtained from a highly focused rationally designed library composed of less than 20 variants. The enantio-complementary variant showed good to excellent (R)-selectivity (77-95% ee) for the tested substrates, which was explained by MM and MD computations. We believe that the metalfree lipase-catalyzed hydrolytic DKR methodology with tailor-made stereoselectivity developed in this work will contribute to the future development of enzymatic DKR research and the asymmetric synthesis of important MBH products.

EXPERIMENTAL SECTION General Procedure for DKR Catalyzed by (S)-selective WT CALB and (R)-selective CALB Mutant WB13. A solution of rac-MBH acetates (1a-1h for WT CALB, 1a-1d for WB13, 40 mM) in 1.0 mL toluene was added TEA (100 mM) and enzyme (25% weight of substrates). Then this mixture was shaken at 200 rpm for about 30 hours (40 oC for WT CALB) or 72 hours (20 oC for WB13) under the monitoring of TLC. The reaction mixture was filtered and the filtrate was concentrated in vacuum. The residue was diluted with n-hexane/ isopropanol solution (75:25) and determined by chiral HPLC using specific conditions as shown in the section of HPLC chromatograms in Supporting Information.


17

ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 29

Library Generation. PCR reactions were performed using WT-CAL B plasmid (pETM11CALB) as the template DNA, and forward primers (see Table S2) and a silent reverse primer (GATGCCGGGAGCAGACAAGCCCGTCAGGGCGC). The reaction (50 µL final volume) contained: ddH2O (29 µL), Pfu 10X buffer (5 µL), dNTP (4 µL, 2 .5 mM each), forward primers (5 µL, 2.5 µM each), silent reverse primer (5 µL, 2.5 µM), template plasmid (1.0 µL, 100 ng/µL) and 1 µL of Pfu polymerase. PCR conditions used were 94 oC, 5 min; 30 cycles of (94 oC, 1 min; 60 oC, 1 min; 72 oC, 14 min) and final extension at 72 oC, 10 min. To ensure elimination of the circular polymethylated template plasmid, 25 µL of PCR reaction mixture were mixed with 1 µL Dpn I (10 U/µL) and incubated overnight at 37 oC, followed by an additional 1 µL of Dpn I for 3.0 h. Upon purification of the Dpn I-digested product with an Omega PCR purification spin column, an aliquot of 20 µL was used to transform 80 µL of E. coli Origami2 cells (containing chaperone plasmid pGro7, Takara, Japan) electrocompetent cells. The transformation mixture was incubated with 1 mL of LB medium at 37 oC with shaking and spread on LB-agar plates containing Kanamycin (34 µg/mL) and Chloramphenicol (34 µg/mL). Expression of CALB Mutants and Screening Process. Colonies appeared after cultivation for 24−36 h at 37 oC and were picked by sterilized toothpicks into 5.0 mL LB media with Kanamycin (34 µg/mL) and Chloramphenicol (34 µg/mL), and then incubated at 37 oC under shaking of 200 rpm overnight. An aliquot of 100 µL of preculture was used for glycerol stock tubes and stored at −80 °C. A fresh 2.0 mL of TB media in 5.0 mL EP tube supplemented with 1.0 mg/mL L-arabinose as the inducer for expression of chaperone pGro7, Kanamycin (34 µg/mL) and Chloramphenicol (34 µg/mL), was inoculated from 100 µL preculture. The cultures were allowed to grow at 37 °C for 4 h, and then cooled in the 4°C fridge for 1h. Then 1.0 mM isopropyl β-thiogalactopyranoside (IPTG) was added to induce CALB expression. The cultures


18

Page 19 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

were allowed to express lipase for 48 h at 18 oC. The tubes were centrifuged at 4000 rpm and 4 o

C for 25 min, and then the supernatants were discarded. The cell pellet of each tube was

resuspended in 1mL of 50 mM Tris-HCl (pH 7.4) containing 1.0 mg/mL lysozyme and 2 units/mL Dnase I. Lysis were performed at 37 oC and 800 rpm for 1.0 h. Cell debris was precipitated by centrifugation at 4000 rpm and 4 oC for 25 min. 800 µL of each cleared supernatant was transferred into a 5.0 mL EP tube. 50 µL solution of substrate rac-1b (180mM in acetonitrile) was added into EP tubes containing 250 µL phosphate buffer (50 mM potassium phosphate, pH 7.5) and 200 µL enzyme supernatant. The hydrolytic reaction was performed at 37 °C for the appropriate time. Then the reaction mixture was filtered and the filtrate was concentrated in vacuum. The residue was diluted with nhexane/ isopropanol solution (80:20) and determined by chiral HPLC (Daicel AS-H, n-hexane/ isopropanol=75:25, 0.5 mL/min, λ: 220 nm, 254 nm). Purification and Immobilization of the Best CALB Mutant WB13. An overnight culture of the WB13 over-expression strain grown in LB media was diluted 1:100 into 200 mL of TB media with 1mg/mL L-arabinose as inducer and 34 µg/mL Kanamycin and 34 µg/mL Chloramphenicol in 1.0 L flask. The culture was shaken at 37 oC for about 4h and then cooled in 4°C fridge for 1h. IPTG was added to a final concentration of 1.0 mM and the culture was shaken for additional 24 h at 18 oC. Cells were harvested by centrifugation at 4000 rpm for 25 min at 4 oC. The cell pellets were resuspended in 5.0 mL 50 mM Tris-HCl buffer (pH 7.4) and lysed by sonification (Bandelin, 15×10 sec with 10 sec interval, 40% pulse, on water-ice bath). The cell debris was removed by centrifugation at 10,000 rpm for 30 min at 4.0 oC. The supernatant was filtered and loaded on a GE Healthcare HisTrap FF Crude column (5 mL) preequilibrated with 50 mM Tris-HCl buffer containing 0.5 M NaCl and 5 mM imidazole. Impurity


19

ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 29

was removed by imidazole at the concentration of about 40 mM and the enzyme was eluted by 50 mM Tris-HCl buffer with 0.5 M NaCl and 200 mM imidazole. The enzyme fraction was desalted and concentrated by using an ultrafiltration centrifugal filter (10 kD cut-off membrane, Amicon), then another ultrafiltration centrifugal filter with 50 kD cut-off membrane was used to cut off the small amount of chaperone pGro7 that remained in the enzyme fraction. The purified enzymes were dissolved by 50 mM Tris-HCl buffer (pH 8.0) and stored at -80 °C. The purity of the enzyme was tested by SDS−PAGE (Figure S3), and the concentration of the purified enzyme was estimated by the Bradford method (Bio-Rad protein assay kit). The purified enzyme solution was mixed with acrylic resin in 50 mL EP tube and stirred end-over-end rotation at 20 oC, overnight. The resin was filtered and dried in vacuum. Then the immobilized enzyme was used for the DKR in organic phase. Scaling-up DKR Reactions. The scale-up DKR of rac-1a was performed as follows: A solution of rac-1a (1.4 g, 5 mmol for WT CALB; 0.7 g, 2.5 mmol for WB13) in 10 mL toluene was added TEA (12.5 mmol for WT CALB and 6.25 mmol for WB13) and enzymes (25% weight of substrates). The reaction mixture was shaken at 200 rpm for 72 hours (40 oC for WT CALB) or 96 hours (20 oC for WB13), respectively. The process was monitored by TLC and chiral HPLC. Then the reaction mixture was filtered and the filtrate was concentrated in vacuum. The obtained crude product was further separated and purified using flash column chromatography with an eluent consisting of petrolether/ethyl acetate (8/1 v/v). Molecular Modeling and MD Simulation. The molecular modeling and MD simulation were performed using YASARA structure (version 15.5.31)23, the AMBER03 force field24 with default settings was used for the protein and AutoSMILES force field assignment for the substrates and the tetrahedral intermediates.25 The substrates (R)- and (S)-1b were introduced as


20

Page 21 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

tetrahedral intermediates (oxyanions) covalently bound to the catalytically active Ser105 in the crystal structure of WT-CALB (PDB 1tca). All mutations were introduced by swapping the specific amino acid residues. Energy minimization was performed using steepest descent and simulated annealing simulations. The MD simulation was performed at 298 K using a time step of 1.25 fs for inter- and intramolecular forces over 10 ns in an NPT ensemble using PME.26 All simulations were performed individually for both enantiomers using various starting geometries and rotamers for the mutated residues. The 10 ns MD trajectories were sampled every 100 ps, resulting in 100 simulation frames per run, which were evaluated and additionally minimized to derive statistical averages and properties of the corresponding local minima. Finally, the force field-based potential energies of the bound tetrahedral intermediate were calculated for every simulation frame (Figure S5), and the distances for all hydrogen bonds stabilizing the oxyanion were also computed (Table S4). Moreover, the average structures of the bound TI (R or S-pose) during 10 ns MD process were also energy-minimized for the analysis of hydrogen bonds network, and the different poses of substrate (R)-1b and (S)-1b in (S)-selective WT CALB and (R)-selective mutant WB13, respectively, were shown in Figure 2.

ASSOCIATED CONTENT Supporting Information. The following files are available free of charge. Materials and analysis methods, synthesis and characterization data of MBH acetates and MBH alcohols, synthesis of deuterated MBH acetate (d-rac-1b) and MBH alcohol (d-rac-2b) (Scheme S1), nucleophilic substitution of rac-1b with phenol, TEA-catalyzed racemization process (Figure S1), data of the enzymes screening for the KR of rac-MBH acetate (Table S1),


21

ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 29

optimization of reaction conditions for the DKR of rac-1b (Figure S2), primers used in this work (Table S2), screening results of CAL-B mutants (Table S3), SDS-PAGE of pure WB13 (Figure S3), NMR spectra of deuterated MBH alcohol (Figure S4), the hydrogen bond distances and the corresponding bond angles of the (R)- or (S)-tetrahedral intermediate in WT CALB and WB13 (Table S4), force field based potential energies of the bound (R)- or (S)-tetrahedral intermediate in WT CALB and WB13 mutant (Figure S5), all chiral HPLC data of enantiocomplementary DKR of MBH acetates. (PDF) AUTHOR INFORMATION Corresponding Author *Email: [email protected], or [email protected] Present Addresses § Department of Biological Environment, Jiyang College of Zhejiang A&F University, Zhuji 311800 P. R. China. Author Contributions The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript. ‡These authors contributed equally. Notes The authors declare no competing financial interest. ACKNOWLEDGMENT


22

Page 23 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

The financial support from National Natural Science Foundation of China (21472169, 21574113) and the Fundamental Research Funds for the Central Universities (2016QNA3012) is gratefully acknowledged.

REFERENCES (1) For reviews of MBH reactions, see (a) Declerck, V.; Martinez, J.; Lamaty, F. Chem. Rev. 2009, 109, 1-48. (b) Basavaiah, D.; Reddy, B. S.; Badsara, S. S. Chem. Rev. 2010, 110, 54475674. (c) Basavaiah, D.; Veeraraghavaiah, G. Chem. Soc. Rev. 2012, 41, 68-78. (d) Wei, Y.; Shi, M. Chem. Rev. 2013 113, 6659-6690. (e) Lumbroso, A.; Cooke, M. L.; Breit, B. Angew. Chem. Int. Ed. 2013, 52, 1890-1932. (2) (a) Iwabuchi, Y.; Nakatani, M.; Yokoyama, N.; Hatakeyama, S. J. Am. Chem. Soc. 1999, 121, 10219−10220. (b) Bugarin, A.; Connell, B. T. Chem. Commun. 2010, 46, 2644-2646. (c) McDougal, N. T.; Schaus, S. E. J. Am. Chem. Soc. 2003, 125, 12094-12095. (d) Senapati, B. K.; Hwang, G. S.; Lee, S.; Ryu, D. H. Angew. Chem. Int. Ed. 2009, 48, 4398-4401. (e) Číhalová, S.; Dziedzic, P.; Córdova, A.; Veselý, J. Adv. Synth. Catal. 2011, 353, 1096-1108. (f) Nakamoto, Y.; Urabe, F.; Takahashi, K.; Ishihara, J.; Hatakeyama, S. Chem. -Eur. J. 2013, 19, 12653-12656. (g) Hu, F. L.; Shi, M. Org. Chem. Front. 2014, 1, 587-595. (h) Shairgojray, B. A.; Dar, A. A.; Bhat, B. A. Catal. Comm. 2016, 83, 58-61. (3) (a) Reetz, M. T.; Mondiere, R.; Carballeira, J. D. Tetrahedron. Lett. 2007, 48, 1679-1681. (b) López-Iglesias, M.; Busto, E.; Gotor, V.; Gotor-Fernández, V. Adv. Synth. Catal. 2011, 353, 2345-2353. (c) Jiang, L.; Yu, H. W. Biotechnol. Lett. 2014, 36, 99-103. (d) Tian, X.; Zhang, S.; Zheng, L. Enzyme Microb. Technol. 2016, 84, 32-40. (e) Xue, J. W.; Song, J.; Manion, I. C. K.;


23

ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 29

He, Y. H.; Guan, Z. J. Mol. Catal. B. Enzym. 2016, 124, 62-69. (f) Bjelic, S.; Nivón, L. G.; Çelebi-Ölçüm, N.; Kiss, G.; Rosewall, C. F.; Lovick, H. M.; Ingalls, E. L.; Gallaher, J. L.; Seetharaman, J.; Lew, S.; Montelione, G. T.; Hunt, J. F.; Michael, F. E.; Houk, K. N.; Baker, D. ACS Chem. Biol. 2013, 8, 749-757. (4) (a) Kitamura, M.; Kasahara, I.; Manabe, K.; Noyori, R.; Takaya, H. J. Org. Chem. 1988, 53, 708-710. (b) Bailey, M.; Staton, I.; Ashton, P. R.; Markó, I. E.; Ollis, W. D. Tetrahedron: Asymmetry 1991, 2, 495-509. (c) Dálaigh, C.; Connon, S. J. J. Org. Chem. 2007, 72, 7066-7069. (d) Jiang, S. S.; Xu, Q. C.; Zhu, M. Y.; Yu, X.; Deng, W. P. J. Org. Chem. 2015, 80, 3159-3169. (e) Wang, F.; Li, S.; Qu, M.; Zhao, M.; Liu, L. J.; Shi, M. Chem. Commun. 2011, 47, 1281312815. (f) Wang, Y.; Feng, X.; Du, H. Org. Lett. 2011, 13, 4954–4957. (5) (a) Burgess, K.; Jennings, L. D. J. Org. Chem. 1990, 55, 1138-1139. (b) Basavaiah, D.; Dharma Rao, P. Synth. Commun. 1994, 24, 917-923. (c) Hayashi, H.; Yanagihara, K.; Tsuboi, S. Tetrahedron: Asymmetry 1998, 9, 3825-3830. (d) Bhuniya, D.; Narayanan, S.; Lamba, T. S.; Krishna Reddy, K.V.S.R. Synth. Commun. 2003, 33, 3717–3726. (e) Nascimento, M. G.; Zanotto, S. P.; Melegari, S. P.; Fernandes, L.; Mandolesi Sá, M. Tetrahedron: Asymmetry 2003, 14, 3111–3115. (f) Xaviera, F. J. S.; Netoa, J. S. S.; Néris, P. L. N.; Oliveira, M. R.; Vale, J. A.; Vasconcellos, M. L. A. A. J. Mol. Catal. B: Enzym. 2014, 108, 7-12. (g) Adam, W.; Hoch, U.; Saha-Möller, C. R.; Schreier, P. Angew. Chem., Int. Ed. 1993, 32, 1737-1739. (h) Bornscheuer, U.; Schapöhler, S.; Scheper, Th.; Schügerl, K. J. Chromatogr. 1992, 606, 288-290. (i) Wang, M. X.; Wu, Y. Org. Biomol. Chem. 2003, 1, 535–540.


24

Page 25 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

(6) (a) Jaeger, K.-E.; Eggert, T. Curr. Opin. Biotechnol. 2002, 13, 390–397. (b) de Miranda, A. S.; Miranda, L. S. M.; de Souza, R. O. M. A. Biotechnol. Adv. 2015, 33, 372-393. (c) Busto, E.; Gotor-Fernández, V.; Gotor, V. Chem. Rev. 2011, 111, 3998–4035. (7) Allen, J. V.; Williams, J. M. J. Tetrahedron Lett. 1996, 37, 1859-1862. (8) (a) Larsson, A. L. E.; Persson, B. A.; Bäckvall, J.-E. Angew. Chem., Int. Ed. 1997, 36, 1211-1212. (b) Persson, B. A.; Larsson, A. L. E.; Le Ray, M.; Bäckvall, J.-E. J. Am. Chem. Soc. 1999, 121, 1645-1650. (9) For reviews of enzymatic DKR, see: (a) Ahn, Y.; Ko, S.-B.; Kim, M.-J.; Park, J. Coord. Chem. Rev. 2008, 252, 647−658. (b) Gruber, C. C.; Lavandera, I.; Faber, K.; Kroutil, W. Adv. Synth. Catal. 2006, 348, 1789-1805. (c) Parvulescu, A.; Janssens, J.; Vanderleyden, J.; De Vos, D. Top. Catal. 2010, 53, 931–941. (d) Lee, J. H.; Han, K.; Kim, M.-J.; Park, J. Eur. J. Org. Chem., 2010, 999-1015. (e) Warner, M. C.; Bäckvall, J.-E. Acc. Chem. Res. 2013, 46, 2545– 2555. (f) Denard, C. A.; Hartwig, J. F.; Zhao, H. ACS Catal. 2013, 3, 2856–2864. (g) Akai, S. Chem. Lett. 2014, 43, 746-754. (h) Grçger, H.; Hummel, W. Curr. Opin. Chem. Biol. 2014, 19, 171-179. (i) Verho, O.; Bäckvall, J.-E. J. Am. Chem. Soc. 2015, 137, 3996−4009. (j) Långvik, O.; Saloranta, T.; Murzin, D. Y.; Leino, R. ChemCatChem 2015, 7, 4004-4015. (10) Choi, Y. K.; Suh, J. H.; Lee, D.; Lim, I. T.; Jung, J. Y.; Kim, M.-J. J. Org. Chem. 1999, 64, 8423-8424. (11) (a) Trost, B. M.; Tsui, H. C.; Toste, F. D. J. Am. Chem. Soc. 2000, 122, 3534-3535. (b) Trost, B. M.; Thiel, O. R.; Tsui, H. C. J. Am. Chem. Soc. 2002, 124, 11616-11617. (c) Wang, X.; Meng, F.; Wang, Y.; Han, Z.; Chen, Y. J.; Liu, L.; Wang, Z.; Ding, K. Angew. Chem. Int. Ed. 2012, 51, 9276-9282. (d) Wang, X.; Guo, P.; Han, Z.; Wang, X.; Wang, Z.; Ding, K. J. Am.


25

ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 29

Chem. Soc. 2014, 136, 405-411. (e) Yan, L.; Xu, J. K.; Huang, C. F.; He, Z. Y.; Xu, Y. N.; Tian, S. K. Chem. -Eur. J. 2016, 22, 13041-13045. (12) (a) Cho, C. W.; Kong, J. R.; Krische, M. J. Org. Lett. 2004, 6, 1337-1339. (b) Ma, G. N.; Cao, S. H.; Shi, M. Tetrahedron: Asymmetry 2009, 20, 1086-1092. (13) (a) Kim, J. N.; Lee, H. J.; Gong, J. H. Tetrahedron Lett. 2002, 43, 9141-9146. (b) Qiao, Z.; Shafiq, Z.; Liu, L.; Yu, Z. B.; Zheng, Q. Y.; Wang, D.; Chen, Y. J. Angew. Chem. Int. Ed. 2010, 49, 7294-7298. (c) Kamlar, M.; Hybelbauerová, S.; Císařová, I.; Veselý, J. Org. Biomol. Chem. 2014, 12, 5071-5076. (d) Liu, H. L.; Xie, M. S.; Qu, G. R.; Guo, H. M. J. Org. Chem. 2016, 81, 10035-10042. (14) Kazlauskas, R. J.; Weissfloch, A. N. E.; Rappaport, A. T.; Cuccia, L. A. J. Org. Chem. 1991, 56, 2656-2665. (15) For reviews of directed evolution, see: (a) Reetz, M. T. Directed Evolution of Selective Enzymes: Catalysts for Organic Chemistry and Biotechnology; Wiley-VCH: Weinheim, Germany, 2016; pp 167-205. (b) Bommarius, A. S. Annu. Rev. Chem. Biomol. Eng. 2015, 6, 319345. (c) Renata, H.; Wang, Z. J.; Arnold, F. H. Angew. Chem. Int. Ed. 2015, 54, 3351-3367. (d) Denard, C. A.; Ren, H. Q.; Zhao, H. Curr. Opin. Chem. Biol. 2015, 25, 55-64. (e) Reetz, M. T. Angew. Chem. Int. Ed., 2011, 50, 138-174. (f) Brustad, E. M.; Arnold, F. H. Curr. Opin. Chem. Biol. 2011, 15, 201-210. (g) Jäckel, C.; Hilvert, D. Curr. Opin. Biotechnol. 2010, 21, 753-759. (h) Turner, N. J. Nat. Chem. Biol. 2009, 5, 568-574. (i) Kazlauskas, R.J.; Bornscheuer, U.T. Nat. Chem. Biol. 2009, 5, 526-529. (j) Romero, P. A.; Arnold, F. H. Nat. Rev. Mol. Cell Biol. 2009, 10, 866-876.


26

Page 27 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

(16) (a) Mugford, P. F.; Wagner, U. G.; Jiang, Y.; Faber, K.; Kazlauskas, R. J. Angew. Chem. Int. Ed. 2008, 47, 8782-8793. (b) Padhi, S. K.; Bougioukou, D. J.; Stewart, J. D. J. Am. Chem. Soc. 2009, 131, 3271-3280. (c) Zheng, H. B.; Reetz, M. T. J. Am. Chem. Soc. 2010, 132, 15744– 15751. (d) Humble, M. S.; Cassimjee, K. E.; Abedi, V.; Federsel, H.-J.; Berglund, P. ChemCatChem 2012, 4, 1167-1172. (e) Baker, P.; Seah, S.Y.K. J. Am. Chem. Soc. 2012, 134, 507-513. (f) Wu, Q.; Soni, P.; Reetz, M. T. J. Am. Chem. Soc. 2013, 135, 1872-1881. (g) Zhang, Z.; Lonsdale, R.; Sanchis, J.; Reetz, M. T. J. Am. Chem. Soc. 2014, 136, 17262-17272. (h) Walton, A. Z.; Sullivan, B.; Patterson-Orazem, A.C.; Stewart, J. D. ACS Catal. 2014, 4, 23072318. (i) Bajaj, P.; Sreenilayam, G.; Tyagi, V.; Fasan, R. Angew. Chem. Int. Ed. 2016, 55, 52, 16110-16114. (17) (a) Wikmark, Y.; Humble, M. S.; Bäckvall, J.-E. Angew. Chem. Int. Ed. 2015, 54, 42844288. (b) Kong, X.D.; Yuan, S.G.; Li, L.; Chen, S.; Xu, J. H.; Zhou, J. Proc. Natl. Acad. Sci. USA 2014, 111, 15717–15722. (c) Reetz, M.T. Angew. Chem. Int. Ed. 2013, 52, 2658-2666. (d) Sandström, A. G., Wikmark, Y., Engström, K., Nyhlén, J., & Bäckvall, J.-E. Proc. Natl. Acad. Sci. USA 2012, 109, 78-83. (e) Engström, K.; Nyhlén, J.; Sandström, A. G.; Bäckvall, J.-E. J. Am. Chem. Soc. 2010, 132, 7038-7042. (f) Sun, Z.; Lonsdale, R.; Wu, L.; Li, G.; Wang, J.; Zhou, J.; Reetz, M. T. ACS Catal. 2016, 6, 1590-1597. (g) Sun, Z.; Lonsdale, R.; Ilie, A.; Li, G.; Zhou, J.; Reetz, M. T. ACS Catal. 2016, 6, 1598-1605. (18) Magnusson, A. O.; Takwa, M.; Hamberg, A.; Hult, K. Angew. Chem. Int. Ed. 2005, 44, 4582-4585. (19) Uppenberg, J.; Hansen, M. T.; Patkar, S.; Jones, T. A. Structure 1994, 2, 293−308.


27

ACS Catalysis

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 29

(20) Krieger, E.; Koraimann, G.; Vriend, G. Proteins: Struct., Funct., Bioinf. 2002, 47, 393402. (21) Um, P. J.; Drueckhammer, D. G. J. Am. Chem. Soc. 1998, 120, 5605-5610. (22) Wen, W. Y.; Ng, I.; Tsai, S. W. J. Chem. Technol. Biotechnol. 2006, 81, 1715-1721. (23) Krieger, E.; Darden, T.; Nabuurs, S. B.; Finkelstein, A.; Vriend, G. Proteins: Struct., Funct., Bioinf. 2004, 57, 678–683. (24) Duan, Y.; Wu, C.; Chowdhury, S.; Lee, M. C.; Xiong, G.; Zhang, W.; Yang, R.; Cieplak, P.; Luo, R.; Lee, T.; Caldwell, J.; Wang, J.; Kollman, P. J. Comput. Chem. 2003, 24, 1999-2012. (25) Jakalian, A.; Jack, D. B.; Bayly, C. I. J. Comput. Chem. 2002, 23, 1623-1641. (26) Essmann, U.; Perera, L.; Berkowitz, M. L. J. Chem. Phys. 1995, 103, 8577-8593.


28

Page 29 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

Table of Contents


29

Stereoselectivity-Tailored, Metal-Free Hydrolytic ... - ACS Publications

Recommend Documents