Steroidogenic Acute Regulatory (StAR) Protein and Cholesterol Side

Chem. Res. Toxicol. 2007, 20, 1811–1819

1811

Steroidogenic Acute Regulatory (StAR) Protein and Cholesterol Side-Chain Cleavage (P450scc) as Molecular and Cellular Targets for 17r-Ethynylestradiol in Salmon Previtellogenic Oocytes Siv-Hege Vang, Trond M. Kortner, and Augustine Arukwe* Department of Biology, Norwegian UniVersity of Science and Technology (NTNU), Høgskoleringen 5, 7491 Trondheim, Norway ReceiVed June 23, 2007

Gonadal steroids are known to modulate both the synthesis and the release of gonadotropins by the pituitary and influence several brain functions that are apparently responsible for gender-specific differences in the regulation of the hypothalamus–pituitary–gonadal (HPG) axis. It is believed that the true ratelimiting step in acute steroid production is the movement of cholesterol across the mitochondrial membrane by the steroidogenic acute regulatory (StAR) protein and subsequent conversion to pregnenolone by P450-mediated cholesterol side chain cleavage (P450scc). In the present study, we have evaluated the effects of 17R-ethynylestradiol (EE2) on salmon previtellogenic oocytes using an in vitro culture system and molecular, histological, and physiological methods. The in vitro culture technique was based on an agarose floating method recently validated for xenoestrogens in our laboratory. Tissue was cultured in a humidified incubator at 10 °C for 3, 7, and 14 days with different concentrations of EE2 [0 (control), 0.01, 0.1, and 1 µM] dissolved in ethanol (0.1%). The StAR, P450scc, P450arom isoforms, and insulinlike growth factor 2 (IGF-2) mRNA expressions were performed using validated real-time polymerase chain reaction (PCR) with specific primers, and immunohistochemistry of the StAR and P450scc proteins was performed using antisera prepared against synthetic peptide for both proteins and estradiol-17β (E2); testosterone (T) and 11-ketotestosterone (11-KT) tissue levels were performed using enzyme immunoassay (EIA). Our data show that EE2 produced time- and concentration-specific effects on the StAR protein, P450scc, P450arom isoforms, and IGF-2 gene expressions in salmon gonadal tissues. Cellular expression of the StAR and P450scc proteins was mainly demonstrated in follicular cells of the oocyte membrane, showing time- and EE2 concentration-dependent differences in staining intensities. Tissue levels of E2, T, and 11-KT in salmon were differentially modulated by EE2 in a time- and concentration-specific manner. Although an apparent negative relationship between E2 and T that reflected aromatization of T to E2 was observed at day 3 postexposure, T and 11-KT showed an apparent concentration-dependent effect after EE2 exposure at day 14. The consistencies between our data at day 14 postexposure suggest that the EE2 modulates steroidogenesis by targeting the initial and rate-limiting step that involves the StAR protein. In general, these findings show that the synthetic pharmaceutical endocrine disruptor and ubiquitous environmental pollutant also produce variations in key gonadal steroidogenic and growthregulating pathways. These effects and the hormonal imbalance reported in the present study may have potential consequences for the vitellogenic process and overt fecundity in teleosts. Introduction Steroidogenesis is the process by which specialized cells in specific tissues, such as the gonad, brain, and kidney, synthesize steroid hormones. Considerable diversity in specific steroids produced by different vertebrate groups or within classes of animals exists, but some generalization still applies (1). There is a general belief that the rate-limiting step in acute steroid production is the movement of cholesterol across the mitochondrial membrane by the steroidogenic acute regulatory (StAR) protein, with subsequent conversion to pregnenolone by cytochrome P450-mediated side-chain cleavage enzyme (P450scc) (1–3). Regardless of steroidogenic organ or tissue, the StAR protein and P450scc are rapidly synthesized in response to acute tropic hormone stimulation. Early mammalian studies showed that the StAR protein is a 30 kDa protein that is first synthesized in the cytosol as a 37 kDa precursor in response to the activation * To whom correspondence should be addressed. Tel: +47 73 596265. Fax: +47 73 591309. E-mail: [email protected].

of cAMP protein kinase-A intracellular signaling pathways (4). Newly synthesized StAR was recently shown as the effective mediator of cholesterol transfer protein, and this is often present in low levels with very high estimated effectivity in the excess of 400 cholesterol molecules for each StAR molecule (4, 5). Brook trout (SalVelinus fontinalis) ovarian StAR was shown by Kusakabe and co-worker (6) to peak in association with oocyte maturation and ovulation, coinciding with the production peaks for maturational steroid hormones. Gonadal steroids are known to modulate both the synthesis and the release of gonadotropin by the pituitary and influence several brain functions that are apparently responsible for gender-specific differences in the regulation of hypothalamic– pituitary–adrenal (HPA) secretions and hypothalamus–pituitary– gonadal–liver (HPGL) axis. Although the StAR and P450scc are the main proteins involved in the early steroidogenic pathway, other proteins such as cytochrome P450 aromatase (CYP19), 17R-hydroxylase, 3β-hydroxysteroid dehydrogenase (3β-HSD), and 21- and 11β-hydroxylases (CYP11β) (7) are also

10.1021/tx700228g CCC: $37.00  2007 American Chemical Society Published on Web 11/15/2007

1812 Chem. Res. Toxicol., Vol. 20, No. 12, 2007

key enzymes in steroidogenesis. In vertebrates, the CYP19 is a crucial steroidogenic enzyme catalyzing the final step in the conversion of androgens to estrogens (8, 9). Teleost species have two structurally distinct CYP19 isoforms, namely, P450aromA and P450aromB. The P450aromA is predominantly expressed in the ovary and plays important roles in sex differentiation and oocyte growth, while P450aromB is expressed in neural tissues such as brain and retina and is involved in the development of the central nervous system and sex behaviors (8, 9). Research on wildlife species show that the reproductive system, together with the associated endocrine and neural controls, can be very susceptible to alterations by environmental exposures to a variety of chemicals, including pharmaceuticals and physical agents (10, 11). Chemical compounds known to mimic the effects of endogenous estrogens in laboratory and field studies include synthetic steroids such as those used in contraceptive pills (12) and alkylphenol polyethoxylates (APEs) (13, 14). Ethynylestradiol (EE2) is a pharmaceutical used in birth control pills and a potent endocrine modulator known to be present in the aquatic environment at biologically active concentrations (12). In sewage treatment work (STW) effluents, steroidal estrogens are believed to be responsible for, at least in part, the feminized responses in some wild fish species in reports from the United Kingdom (15, 16). The concentration of EE2 reported in effluents and surface waters from Europe ranges between 0.5 and 7 ng/L (16, 17) and concentrations of up to 50 ng/L have been reported by Aherne and Briggs (18). In the United States, a survey of 139 streams showed that several rivers had concentrations >5 ng/L (19) with an extreme EE2 concentration up to 273 ng/L reported at some riverine sites (19). Endocrine-disrupting chemicals may alter the reproductive system of organisms through receptor and nonreceptor or nongenomic-mediated pathways. Research on endocrine toxicology has mainly focused on estrogenicity that involves direct estrogen receptor (ER)-mediated effects. Mechanisms of endocrine disruptions mediated through nonreceptor or nongenomic pathways that involve regulatory proteins and/or enzymes are not well-studied. These pathways have recently become subject for systematic investigations in our laboratory (20–22). Therefore, the present study was designed to investigate the effects of EE2 on gonadosteroidogenic pathways using the rate-limiting responses and aromatase gene isoforms and factors that regulate oocyte growth and development as model end points, in addition to steroid hormone levels. Our hypothesis is that exposure of salmon previtellogenic oocytes to EE2 concentrations will produce differential gene expression (and hormone) patterns, whose functional products may modulate steroidogenesis with a significant effect on early oocyte growth and development. These responses will be prognostic, diagnostic, and indicative of the effects of pharmaceuticals and chemical endocrine disruptors on the growth and development of previtellogenic oocyte in teleosts with potential implication for overt fecundity.

Experimental Procedures Chemicals and Reagents. Trizol reagent for RNA purification, TA cloning kit, and Leibovitz L-15 medium were purchased from Gibco-Invitrogen life technologies (Carlsbad, CA). 17R-Ethynylestradiol, bovine serum albumin (BSA), and N-[2-hydroxyethyl]piperazine-N′-[2-ethanesulfonic acid] (HEPES) were purchased from Sigma Chemical (St. Louis, MO). Iscript cDNA synthesis kit and iTaqSybr Green supermix with ROX were purchased from Biorad Laboratories (Hercules, CA). Generuler 100bp DNA ladder and dNTPs were from Fermentas

Vang et al.

GmbH (Germany). Superpicture polymer detection kit for immunohistochemistry (catalog no. 87-9263) was purchased from Zymed (San Francisco, CA), and Tissue-clear and Tissuemount were purchased from Sakura Finetek Europe (Zoeterwoude, The Netherlands). E2, T, and 11-KT enzyme immunoassay (EIA) kits (catalog nos. 582251, 582701, and 582751) were purchased from Cayman Chemical Co. (Ann Arbor, MI). All other chemicals were of the highest commercially available grade. Animals and Floating Agarose in Vitro Culture Method. Juvenile female Atlantic salmon, 190–310 g in body weight, were purchased from Lundamo Hacheries (Trondheim, Norway) and kept in circulating water at 10 °C and a 12 h light and 12 h dark photoperiod. The in vitro organ culture technique used in this study was based on the agarose floating method (22, 23). Briefly, juvenile female cod were anesthetized, sacrificed, and washed in 70% ethanol. Ovaries were removed, cut into small pieces (1 × 1 × 1 mm3) and grown in six-well dishes on a floating agarose substrate covered with a nitrocellulose membrane in basal culture media. The basal culture medium consisted of Leibovitz L-15 medium supplemented with 0.1 mM Lglutamic acid, 0.1 mM L-aspartic acid, 1.7 mM L-proline, 0.5% BSA, and 10 mM HEPES (pH 7.4). The gonadal tissue was cultured randomly in triplicate (n ) 3) for 3, 7, and 14 days with different concentrations of EE2 [0 (control), 0.01, 0.1, and 1 µM] in a humidified incubator at 10 °C. The control group received ethanol (carrier vehicle for EE2), and the final concentration of ethanol in all exposure groups never exceeded 0.3% (v/v). The medium was changed every sampling period at 3, 7, and 14 days of exposure with fresh EE2 at the respective concentrations. When toxicity and biological factors such as bioaccumulation, bioconcentration, biotransformation, and rapid adhesion to solid materials are considered, the EE2 concentrations used in the present in vitro study represent physiologically relevant concentrations. In addition, it should also be noted that only a fraction that is apparent comparable to physiological steroid hormone levels reached the tissues in cultures using the floating agarose method (unpublished results). After cultivation, tissues for RNA purification and steroid analyses were snapfrozen in liquid nitrogen and thereafter stored at -80 °C until further processing. Tissues for immunohistochemical analyses were placed in tissue cassettes with a nylon mesh and fixed in 4% paraformaldehyde. RNA Purification and cDNA Synthesis. Total RNA was purified from tissues homogenized in Trizol reagent according to established procedures (24, 25), and RNA concentrations were determined using a NanoDrop ND-1000 UV–visible spectrophotometer (NanoDrop Technologies, Wilmington, DE). Total cDNA for the real-time polymerase chain reaction (PCR) were generated from 1 µg of total RNA from all samples using a mixture of poly T and random primers from iScript cDNA synthesis kit as described by the manufacturer (Bio-Rad). The StAR and P450scc Proteins Antisera Production and Purification. Polyclonal antisera for the StAR protein and P450scc were produced by immunization of rabbits with synthetic peptides for both proteins (Eurogentec, Searing, Belgium). The peptide sequences were as follows: (StAR) H2NMPE QRG VVR AEN GPT C-CONH2 and (P450scc) H2NCLL KNG EDW RSN RVI L-CONH2 with respective molecular masses of 1743.97 and 1916.2 (Da) and respective isoelectric points (pI) of 6.45 and 9.45. Rabbits were immunized once a week with the synthetic peptides and were bled after the fourth boost. The resulting sera were purified using Hitrap rProtein A affinity column (Amersham, Uppsala, Sweden).

StAR Protein and Cholesterol Side-Chain CleaVage

Chem. Res. Toxicol., Vol. 20, No. 12, 2007 1813

Table 1. Primer Pair Sequences, Accession Numbers, Amplicon Size, and Annealing Temperature Conditions for Genes Quantified with Real-Time PCR primer sequencea target gene

forward

reverse

amplicon size (nucleotides)

annealing temperature (°C)

Genbank accession number

StAR P450scc P450aromA P450aromB IGF-2

AGGATGGATGGACCACTGAG TGGAGTCCTGCTCAAGAATG GGGCACTGTCTGATGATGTC CTGACCCCTCTGGACACG ATTGCGCTGGCACTTACTCT

GTCTCCCATCTGCTCCATGT TTATGTACTCGGGCCACAAA GGGCTTGAGGAAGAACTCTG TCTCGTTGAGAGGCACCC TCCAAACTCGTTGTCTGTGC

163 141 104 96 168

63 63 60 55 55

DQ415678 DQ361039 DQ361037 DQ361038 M95184

a

Sequences are given in the 5′–3′ order.

Briefly, serum was diluted 1:4 in binding buffer (20 mM sodium phosphate, pH 7.0) after filtration through a 0.45 µm filter. The column was washed with 5× column volume of 20% ethanol and binding buffer. Thereafter, the diluted serum was applied with a flow rate of 1 mL/min. The column was then washed with 5× column volume of binding buffer, and the purified antibody was eluted with 0.1 M sodium citrate buffer (pH 3.5) into tubes containing 80 µL of 1 M Tris-HCl (pH 9.0). Protein concentrations were determined using a NanoDrop ND-1000 UV–visible spectrophotometer. Primer Optimization, Cloning, and Sequencing. PCR primers for amplification of 96–168 basepairs (bps) gene-specific PCR products were designed from conserved regions of the studied genes. The primer sequences, their amplicon size, and the optimal annealing temperatures are shown in Table 1. Prior to PCR reactions, all primer pairs were used in titration reactions to determine optimal primer pair concentrations and their optimal annealing temperatures. All chosen primer pair concentrations used at the selected annealing temperatures gave a single band pattern for the expected amplicon size in all reactions. PCR products from the genes to be investigated were cloned into pCRII vector in INVRF′ Escherichia coli (Invitrogen). Each plasmid was sequenced using ABI-prism 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA) at the Department of Biology, NTNU (Norway). Sequences were confirmed using NCBI nucleotide BLAST software (http:// www.ncbi.nlm.nih.gov/BLAST). Quantitative (Real-Time) PCR. Quantitative (real-time) PCR was used for evaluating gene expression profiles. For each treatment, the expression of individual gene targets was analyzed using the Mx3000P real-time PCR system (Stratagene, La Jolla, CA). The following concentrations of forward and reverse primers were used for each 25 µL real-time PCR reaction: StAR, P450scc, P450arom isoforms, and IGF-2 at 200 nM each. Each 25 µL DNA amplification reaction also contained 12.5 µL of iTAQSYBRGreen mlx with ROX (BioRad) and 1 µL of cDNA. The real-time PCR program included an enzyme activation step at 95 °C (3 min) and 40 cycles of 95 °C (30 s), 55–62 °C, depending on the transcript target as shown in Table 1 (30 s), and 72 °C (30 s). Controls lacking cDNA template or Taq DNA polymerase were included to determine the specificity of target cDNA amplification. Cycle threshold (Ct) values obtained were converted into copy number using standard plots of Ct vs log copy number. Standard plots for each target sequence were generated using known amounts of plasmid containing the amplicon of interest, and only the concentration of the amplicon was used in this calculation. The criterion for using the standard curve was based on equal amplification efficiency with unknown samples, and this was checked prior to extrapolating unknown samples to the standard curve. Data obtained from triplicate runs for individual target cDNA amplification were averaged and expressed as ng/µg of initial total RNA used for reverse transcriptase (cDNA) reaction and thereafter transformed as percentage of control. This absolute quantification method was

a well-validated procedure in our laboratory, as we do not use the so-called housekeeping genes because of their parallel modulation pattern with experimental samples both in our laboratory (26) and elsewhere (27). Immunohistochemical Analysis and Previtellogenic Oocyte Histology. Cultured previtellogenic gonadal tissues were fixed in 4% paraformaldehyde in 0.1 mM sodium phosphate buffer (pH 7.4) for 24 h. After fixation, the tissues were washed twice in 70% ethanol, dehydrated in a graded series of ethanol baths using an automatic tissue processor (Leica Microsystems, Nussloch, Germany), cleared in Tissue-Clear, embedded in paraffin blocks, and sectioned at 5 µm. Immunohistochemical analysis was preformed using SuperPicTure polymer detection kit (Zymed, catalog no. 87-9263) according to the manufacturer’s protocol. In brief, sections were deparaffinized, rehydrated in graded series of ethanol, and incubated for 4 h with rabbit polyclonal antibody against the StAR protein and P450scc diluted 1:50. After subsequent washing in PBS, sections were incubated with a horseradish peroxidase (HRP) polymerconjugated antirabbit secondary antibody for 10 min. Color visualizations were performed by incubation with 3,3′-diaminobenzidine (DAB) chromogen for 5 min, and hematoxylin was used as a counterstain. Control stains were performed by omission of the primary antibody. Sections were mounted using Tissue-Mount, and relative intensity and localization of the StAR protein and P450scc staining were evaluated using light microscopy. Steroid Hormone Analysis. Estradiol-17β (E2), 11-ketotestosterone (11-KT), and testosterone (T) concentrations were measured in cultured gonad tissue using enzyme immunoassay (EIA) kits from Cayman Chemical Co. Tissues cultured for 3, 7, and 14 days were used for steroid hormone determinations. Tissues stored at -80 °C were thawed on ice, homogenized in a 1:4 volume of 0.1 M Na-phosphate buffer, and centrifuged at 14000g for 15 min. The supernatants were purified by extraction using organic solvent to prevent the interference of lipids and proteins in the analysis. Briefly, the supernatant was mixed with 4 mL of diethyl ether using a vortex mixer. After phase separation, the aqueous portion was frozen in an ethanol/dry ice bath. The lipophilic phase was decanted into a clean tube, and the ether phase was evaporated by heating to 30 °C. The dry extract was reconstituted in 1:1 volume of initial weight of sample and EIA buffer by vortexing. Enzyme immunoassays were run as recommended by Cayman with development times of 1 h (E2), 2 h on a orbital shaker (T) and 18 h at 4 degrees (11-KT). Data were quantified against a standard curve that was linearized using a logit transformation of B/B0 (bound sample/maximum bound). Statistical Analysis. Statistical analysis was performed with GraphPad Prism, version 2.1 (GraphPad Software Inc. 1996). Significant differences between control and EE2 concentration exposure groups at the different time intervals were performed using one-way ANOVA. Statistical differences between different time intervals for each EE2 concentration exposure group were


Figure 1. Modulation of the StAR protein (upper panel) and P450scc (lower panel) mRNA levels in cultured previtellogenic oocytes of Atlantic salmon exposed to ethynylestradiol (EE2) at 0 (control), 0.01, 0.1, and 1 µM. Previtellogenic oocytes were sampled at days 3, 7, and 14 after exposure. Messenger RNA (mRNA) levels were quantified using real-time PCR with specific primer pairs. Data are given as means expressed as percentage (%) of control (n ) 3) ( standard errors of the mean (SEM). Different letters denote exposure groups that are significantly different (p < 0.05), analyzed using ANOVA followed by Tukey’s multiple comparison test.

Vang et al.

Figure 2. Expression of the P450aromA (upper panel) and P450aromB (lower panel) mRNA levels in cultured previtellogenic oocytes of Atlantic salmon exposed to ethynylestradiol (EE2) at 0 (control), 0.01, 0.1, and 1 µM. Previtellogenic oocytes were sampled at days 3, 7, and 14 after exposure. Messenger RNA (mRNA) levels were quantified using real-time PCR with specific primer pairs. Data are given as means expressed as percentage (%) of control (n ) 3) ( standard errors of the mean (SEM). Different letters denote exposure groups that are significantly different (p < 0.05), analyzed using ANOVA followed by Tukey’s multiple comparison test.

analyzed using the Tukey’s multiple comparison test after checking for normality and variance homogeneity. The level of significance was set at p ) 0.05 unless otherwise stated.

Results Modulation of the StAR and P450scc Expressions. The expression of the StAR protein mRNA level was significantly decreased after day 3 of exposure to 0.01 µM EE2 at day 3 after exposure, as compared to control (Figure 1A). Thereafter, an apparent nonsignificant concentration-dependent increase (still below control level) was observed. While no EE2 effect was observed at day 7 postexposure, a significant concentrationdependent increase of the StAR protein mRNA was observed at day 14 postexposure (Figure 1A). For P450scc mRNA expression, a comparable effect of EE2 on the StAR was also observed at day 3 postexposure (Figure 1B), showing a significant decrease at 0.01 µM EE2 and thereafter an apparent concentration-dependent increase that equalled the control level at 1 µM EE2 (Figure 1B). At days 7 and 14 postexposure, EE2 produced an apparent concentration-dependent increase of P450scc mRNA (Figure 1B). Modulation of P450arom Isoforms Expression. The expression of P450aromA was significantly decreased after exposure to 0.01 µM EE2 at day 3 postexposure, as compared to control, and thereafter, an apparent concentration-specific increase was observed (Figure 2A). At day 7, EE2 produced an apparent concentration-specific increase of P450aromA mRNA, as compared to control, and the EE2 effect at day 14 resembled that of day 3 (Figure 2A). For P450aromB mRNA, EE2 produced a decrease and increase as compared to control at 0.01 and 0.1 µM at day 3 postexposure (Figure 2B). At days 7 and 14 postexposure, EE2 produced an apparent concentration-dependent increase of P450aromB mRNA, as compared to control (Figure 2B).

Figure 3. Modulation of insulin-like growth factor 2 (IGF-2) mRNA levels in cultured previtellogenic oocytes of Atlantic salmon exposed to ethynylestradiol (EE2) at 0 (control), 0.01, 0.1, and 1 µM. Previtellogenic oocytes were sampled at days 3, 7, and 14 after exposure. Messenger RNA (mRNA) levels were quantified using realtime PCR with specific primer pairs. Data are given as means expressed as percentage (%) of control (n ) 3) ( standard errors of the mean (SEM). Different letters denote exposure groups that are significantly different (p < 0.05), analyzed using ANOVA followed by Tukey’s multiple comparison test.

Modulation of IGF-2 Expression. Tissue levels of IGF-2 showed a variable but EE2 concentration- and time-specific expression patterns. At day 3 postexposure, IGF-2 mRNA expression significantly decreased and increased after exposure to 0.01 and 0.1 µM EE2, respectively, as compared to control (Figure 3). Otherwise, no significant changes were observed at days 7 and 14 in any of the EE2 concentrations (Figure 3). For IGF-receptor 1 (IGF-R1), the levels in previtellogenic oocytes were only quantifiable at day 3 postexposure with very high individual variation due to low expression levels (data not shown). Modulation of Tissue Steroid Hormone Levels. Tissue levels of E2 were not significantly affected by EE2 exposure at after day 3 of exposure (Figure 4A). At day 7, a significant


Figure 4. Tissue levels 17β-estradiol (E2, upper panel), testosterone (T, middle panel), and 11-ketotestosterone (11-KT, lower panel) in Atlantic salmon previtellogenic oocytes exposed to different concentrations of ethynylestradiol (EE2) at 0 (control), 0.01, 0.1, and 1 µM. Previtellogenic oocytes were sampled at days 3, 7, and 14 after exposure. Steroid hormone levels were determined using enzyme immunoassay method. Data are given as mean values and expressed as pg/mL of n ) 3 ( standard errors of the mean (SEM). Different letters denote exposure groups that are significantly different (p < 0.05), analyzed using ANOVA followed by Tukey’s multiple comparison test.

increase was observed only in the group exposed to 1 µM EE2 (Figure 4A). In contrast, a significant decrease of E2 levels was observed at day 14 postexposure only in the group exposed to 0.1 µM EE2 (Figure 4A). For the androgens (T and 11-KT), a similar effect of EE2 was observed during the exposure periods. In general, these effects could be described as a decrease below control level at day 3, a concentration-specific increase and decrease at day 7, and an apparent concentration-specific increase at day 14 postexposure (Figure 4B,C, respectively). Histology and Immunohistochemical Analysis of StAR and P450scc Proteins. The cellular localization of the StAR and P450scc proteins in cultured previtellogenic oocytes of salmon sampled at day 14 of exposure is shown in Figure 5 and Figure 6, respectively, and a summary of the detection of these proteins at days 3, 7, and 14 of exposure is shown in Table 2. Using rabbit polyclonal antisera prepared against synthetic peptide sequences, the cellular localization of StAR and P450scc was mainly observed in follicular cells of the oocyte boundary layer in both control and exposed tissues. The relative intensity of both proteins showed concentration- and time-specific differences between control and EE2 exposure groups. Evaluation of oocyte morphology and size revealed that previtellogenic oocytes had a diameter of approximately 150 µm, and all tissue sections displayed normal morphology.

Discussion Research on endocrine toxicology has focused little attention on estrogenicity that does not involve direct estrogen receptormediated effects (i.e., nonreceptor or nongenomic effects). In addition to estrogenicity, there is more to endocrine disruption that may be subject to chemical disruption with equally or more


severe consequences for organismal fitness. Surprisingly, little is known about the effects and mechanisms of endocrine modulators on gonadal, neural, and interrenal steroid-mediated effects. Recently, it was shown that nonylphenol and EE2, two documented xenoestrogens, altered brain StAR, P450scc, aromatase, and CYP11β-hydroxylase (20, 21, 28) Herein, we report the effects of EE2 on key steroidogenic genes (StAR, P450scc, and P450arom isoforms) in parallel with steroid hormone (E2, T, and 11-KT) levels and a growth factor (IGF-2) in previtellogenic oocytes of salmon using an in vitro agarose floating method. Our data show that EE2 produced time- and concentration-specific effects on the StAR, P450scc, P450arom, and IGF-2 gene expressions in the salmon gonadal tissues. Cellular expression of the StAR and P450scc proteins was mainly demonstrated in follicular cells of oocyte membrane, showing time- and EE2 concentration-dependent differences in staining intensities. In general, these findings show that the synthetic pharmaceutical endocrine disruptor and ubiquitous environmental pollutant also produce variations in key gonadal steroidogenic and growth-regulating pathways. These effects and the hormonal imbalance reported in the present study may have potential consequences for the vitellogenic process and overt fecundity in teleosts. Modulation of StAR and P450scc Expression. The previtellogenic gonadal StAR protein and P450scc expression were modulated by EE2 in a time- and concentration-specific manner. The unique changes in the levels of mRNA reported in the present study suggest that the experimental samples are experiencing impaired acute steroidogenesis. In teleosts, the endocrine response to reproduction is controlled by the HPG axis (29), leading to changes in gonadal steroid levels that are produced in the follicular cells of the ovary. The linkage between the effects demonstrated in the present study lies on the fact that reproductive steroids, like all steroids (including 11oxygenated androgens), are generated from the precursor cholesterol (30) and the first step in the cholesterol–steroid hormone pathway is the cleavage of a six-carbon side chain to form pregnenolone (a C21 steroid) by P450scc, whose biological substrate (cholesterol) is supplied by the StAR protein. A transient increase in the StAR and P450scc mRNA and protein levels in response to trophic hormone stimulation provided evidence of acute steroid regulation in steroidogenic tissues (1). In the present study, immunostaining of protein levels for the StAR and P450scc showed apparently a corresponding increase with the respective mRNA transcripts at day 14 postexposure. The absolute underlying mechanism for the present findings is not fully characterized or understood and that this was performed using an in vitro gonadal culture system. When this in vitro study is extrapolated to the whole organism level, it is possible that EE2 may alter the entire negative feedback control of steroid hormone synthesis that involve the gonadotropins (GtHs) and their receptor in the brain (31), making the entire HPG axis susceptible to chemical impact (32, 33). Early mammalian studies showed that the StAR protein is a 30 kDa protein that is first synthesized in the cytosol as a 37 kDa precursor in response to the activation of cAMP protein kinase A intracellular signaling pathways (4). Newly synthesized StAR was recently shown as the effective mediator of cholesterol transfer protein, and this is often present in low levels with high transport effectivity in the excess of 400 cholesterol molecules for each StAR molecule (4). In our study, the fold change of the StAR mRNA was very high (15–20-fold) at day 14 postexposure due to loss of two control samples. Nevertheless, the significant increases of the StAR at this time interval


Vang et al.

Figure 5. Cellular localization of the StAR protein in Atlantic salmon previtellogenic oocytes exposed to 0 (ethanol control), 0.01, 0.1, and 1 µM (panels A, B, C, and D, respectively) of ethynylestradiol (EE2) and sampled at day 14 after exposure. The figures are representative histological and immunostained tissue sections for the study period, as there were consistent differences between the control and the exposure groups at all sampling days. Positive StAR protein staining was observed mainly in follicular cells of the oocyte boundary. Bar equals 50 µm. Abbreviations: cyt, cytoplasma; fc, follicular cells; nl, nucleoli; and nu, nucleus.

Table 2. Summary of Immunohistochemical Expression of the StAR and P450scc Proteins in Follicular Cells of Salmon Previtellogenic Oocytes Exposed in Vitro to Ethynylestradiol (EE2)a day 3

day 7

day 14

EE2 (µM)

control

0.01

0.1

1

control

0.01

0.1

1

control

0.01

0.1

1

StAR P450scc

+ ++

++ ++

++ +++

+++ ++++

+ +

++ ++

++ +++

++++ ++++

+ +

++ +++

+++ +++

++++ ++++

a

++++, Very strong positive reaction; +++, strong positive reaction; ++, moderate positive reaction; +, weak reaction; and –, no reaction.

were confirmed by the protein levels detected with immunohistochemistry. In brook trout (SalVelinus fontinalis), ovarian StAR was shown by Kusakabe and co-worker (6) to peak in association with oocyte maturation and ovulation, coinciding with the production peaks for maturational steroid hormones. Gonadal steroids are known to modulate both the synthesis and the release of gonadotropin by the pituitary and influence several brain functions that are apparently responsible for genderspecific differences in the regulation of HPA and HPG secretions (29). Therefore, modulation of acute steroid hormone regulation by targeting the StAR protein and P450scc may have severe consequences for the entire reproduction process including oocyte maturation and development (see the later discussion). Modulation of P450arom Isoforms Expression. In the present study, salmon previtellogenic oocyte P450arom gene isoforms showed a parallel expression pattern after exposure to EE2, with unique expression pattern that was dependent on concentration and time of exposure. An inverse relationship between E2 (increased) and T (decreased) levels was observed at day 3 of exposure, and these coincided with elevated P450arom mRNA at the same time interval. Otherwise, EE2 produced a concentration- and time-specific modulation of E2, T, and 11-KT (also P450arom isoforms) during the study period. P450arom cDNAs derive from separate gene loci that are differentially expressed in brain with higher P450aromB as

compared P450aromA and ovary with higher P450aromA, as compared to P450aromB. P450arom isoforms have been shown to have different developmental programming and response to estrogen upregulation (8). In adult fathead minnow (Pimephales promelas) ovaries, the highest levels of P450aromB mRNA occurred in fish exposed to high E2 concentration (34), and this was suggested to represent a possible indication of response to initiate new cycle of oocyte development. Kazeto and coworkers (35) reported that P450aromA mRNA levels in whole body samples of zebrafish (Danio rerio) juveniles did not show any alterations after short-term exposure to environmental concentrations of EE2, except at high (100 nM) concentrations, while significant EE2 concentration-dependent inductions in P450aromB mRNA levels were observed. Similarly, continuous exposure of zebrafish fry to 170 nM of EE2 for a period of up to 10 days postfertilization significantly elevated the expression of P450aromB gene in whole body tissue, and the expression of the P450aromA gene was not affected by the exposure (36). The similarity and differences of EE2 effects on steroidogenic gene expressions further support the complexity in the prediction of biological effects of interferences with steroidogenic enzymes in intact organisms (37). For example, the induction of steroidogenic enzymes is highly tissue- and cell type-specific and is controlled by different promoters and second messenger



Figure 6. Cellular localization of the P450scc protein in Atlantic salmon previtellogenic oocytes exposed to 0 (control), 0.01, 0.1, and 1 µM (panels A, B, C, and D, respectively) of ethynylestradiol (EE2) and sampled at day 14 after exposure. The figures are representative histological and immunostained tissue sections for the study period, as there were consistent differences between the control and the exposure groups at all sampling days. Positive P450scc protein staining was observed mainly in follicular cells of the oocyte boundary. Bar equals 50 µm. Abbreviations: cyt, cytoplasma; fc, follicular cells; nl, nucleoli; and nu, nucleus.

pathways. These pathways provide various targets for interaction with xenobiotics. Modulation of Cellular Hormone Levels. An interesting aspect of the present study is that tissue levels of E2, T, and 11-KT in salmon previtellogenic oocytes were differentially modulated by EE2 in a time- and concentration-specific manner. Although an apparent negative relationship between E2 and T that reflected aromatization of T to E2 was observed at day 3 postexposure, T and 11-KT showed an apparent concentrationdependent effect after EE2 exposure at day 14. The consistencies between our data at day 14 postexposure suggest that EE2 modulates steroidogenesis by targeting the initial and ratelimiting step that involves the StAR protein. Recently, in our laboratory, we showed that nonylphenol (a documented xenoestrogen) reduced levels of both E2 and 11-KT in Atlantic cod (Gadus morhua) previtellogenic oocyte cultures exposed to 50 and 100 µM at day 14 postexposure and that these effects paralleled the StAR protein and P450scc expression (22). In other studies, it was reported that two pesticides, the organochlorine insecticide lindane and the organophosphate insecticide dimethoate, which lower serum T levels in animals, block steroid hormone biosynthesis in leydig cells by reducing StAR protein expression (38). These findings and the present study raise the possibility that other environmental estrogens may also inhibit or enhance steroidogenesis by targeting StAR protein expression and/or other steroidogenic enzymes. For example, it has been shown that plasma E2 levels were significantly elevated in relation to gonadal development and time of reproduction in several female species (39, 40). Thus, our data are in accordance with these observations, suggesting that EE2 may enhance the developmental process of previtellogenic oocytes. When mRNA expression data are viewed in combination with tissue hormone levels, several aspects of the present study can be compared with other studies where impaired

steroidogenesis was reported in fish species after treatment with estrogenic substances. For example, it was shown that exposure of male fathead minnow to methoxychlor produced significant reduction of plasma 11-KT concentrations (41). In another study by Loomis and Thomas (42), the effects of xenoestrogens on testicular androgens production were investigated in an in Vitro assay with testicular tissues from Atlantic croaker (Micropogonias undulates) showing that several of the studied xenoestrogen chemicals induced concentration-dependent decreases in 11-KT production. 11-KT is considered the main androgen in teleosts (43), and the effects of xenoestrogens on 11-KT are not wellstudied. Androgens may increase oocyte diameter and modify growth factor receptors (44, 45), but the underlying molecular mechanism(s) involved in possible gene regulation in the growth of previtellogenic oocytes have not been investigated and will be put in the context of the present data below. The relationship between the StAR protein, the P450scc, and the androgens (T and 11-KT) represents a potentially novel aspect on the role of androgens on the growth of previtellogenic oocytes. Recently, we have observed that aromatizable (T) and nonaromatizable (11-KT and methyltestosterone, MT) androgens produce differential gene expression patterns, whose functional products modulate previtellogenic oocyte growth in cod (46). The role of androgens in previtellogenic oocyte development is supported by the observation that the early ovarian growth of species-specific critical stage progressed in hypophysectomized freshwater turtle, Chrysemys picta, indicating that gonadotropins (GtHs) were not necessary (47). Furthermore, Bieniarz and Kime (48) were unable to demonstrate specific binding of radiolabeled GtH (125I-GtH) to previtellogenic common carp (Cyprinus carpio) ovaries. Recently, it was demonstrated that 11-KT induces an increase in the diameter and development of previtellogenic eel (Anguilla australis) (44) and cod oocytes (46). In mammals, androgens also modify the


intraovarian gene expression in the rhesus monkey, as demonstrated by increased mRNA abundance of insulin-like growth factor-1 (IGF-1) and IGF-1-receptor (45) in follicles up to early antral stage. In the present study, we were not able to quantify IGF-1-receptor mRNA expression, due to low abundance levels. However, EE2 exposure produced a concentration-specific modulation of IGF-2 mRNA at day 3 postexposure. On the basis of these studies, androgens appear to play a pivotal role in stimulating the growth of small ovarian follicles in vertebrates, at least in mammals and fish. Given that this happens despite the diversity in follicular development in these two species, the findings in the present study suggest a generalized effect of EDCs in vertebrates, at least with the methods applied in our studies. Addition to the pool of developing oocytes through oogonial proliferation in fish is a lifetime continuous process (49), whereas oocyte numbers in mammals are fixed at birth. Therefore, the effects of EDCs on early follicular growth in fish will provide an understanding on the role of xenoandrogens in the control of fecundity through modification of gene expression patterns.

Conclusions EE2 is a pharmaceutical endocrine disruptor known to (i) induce receptor-mediated endocrine responses, such as vitellogenin (Vtg) (50), (ii) produce reproductive failure (12), and (iii) decrease fertility (51) in fish species. The present findings on the effects of EE2 on key gonadal endocrine responses are novel and in accordance with previous studies, demonstrating the sensitivity of the StAR protein and P450scc to pollutantmediated impairments of steroidogenesis (52–54). Given the important role of the StAR protein and P450scc in acute steroid hormone synthesis, they may prove to be effective molecular and cellular targets for and useful biomarkers to evaluate endocrine system function in wildlife species. These responses may be very useful in acute and short-term exposure scenarios. Several adverse effects including decreased fertility in wildlife species and decreased hatching success in fish, birds, and reptiles were reportedly attributed to environmental contaminant exposure (11, 55–57). Some of these studies reported abnormal steroid hormone levels particular in alligators, indicating the possibility that these toxicants may block steroid hormone synthesis (58, 59). In these regards, the floating agarose method used in the present study represents a unique and promising in vitro system. Specifically, a disruption of StAR protein and P450scc expression may represent the first step in the sequence of related event cascades underlying xenoestrogen-induced molecular and cellular toxicity and transmittable disturbances at the whole organism level. Acknowledgment. This study was financed by the Norwegian Research Council (NFR) contract number 165073/V40. We thank Anne S. Mortensen and John Arne Sødahl for technical help during sampling and analysis.

References (1) Stocco, D. M. (2000) The role of the StAR protein in steroidogenesis: Challenges for the future. J. Endocrinol. 164, 247–253. (2) Sierra, A. (2004) Neurosteroids: The StAR protein in the brain. J. Neuroendocrinol. 16, 787–793. (3) Geslin, M., and Auperin, B. (2004) Relationship between changes in mRNAs of the genes encoding steroidogenic acute regulatory protein and P450 cholesterol side chain cleavage in head kidney and plasma levels of cortisol in response to different kinds of acute stress in the rainbow trout (Oncorhynchus mykiss). Gen. Comp. Endrocrinol. 135, 70–80.

Vang et al. (4) Artemenko, I. P., Zhao, D., Hales, D. B., Hales, K. H., and Jefcoate, C. R. (2001) Mitochondrial processing of newly synthesized steroidogenic acute regulatory protein (StAR), but not total StAR, mediates cholesterol transfer to cytochrome P450 side chain cleavage enzyme in adrenal cells. J. Biol. Chem. 276, 46583–46596. (5) Jefcoate, C. R., Artemenko, I. P., and Zhao, D. (2000) Relationship of StAR expression to mitochondrial cholesterol transfer and metabolism. Endocr. Res. 26, 663–680. (6) Kusakabe, M., Todo, T., McQuillan, H. J., Goetz, F. W., and Young, G. (2002) Characterization and expression of steroidogenic acute regulatory protein and MLN64 cDNAs in trout. Endocrinology 143, 2062–2070. (7) Miller, W. L. (1988) Molecular biology of steroid hormone synthesis. Endocr. ReV. 9, 295–318. (8) Callard, G. V., Tchoudakova, A. V., Kishida, M., and Wood, E. (2001) Differential tissue distribution, developmental programming, estrogen regulation and promoter characteristics of cyp19 genes in teleost fish. J. Steroid Biochem. Mol. Biol. 79, 305–314. (9) Kishida, M., and Callard, G. V. (2001) Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development. Endocrinology 142, 740–750. (10) Arukwe, A., and Goksoyr, A. (2003) Eggshell and egg yolk proteins in fish: hepatic proteins for the next generation: Oogenetic, population, and evolutionary implications of endocrine disruption. Comp. Hepatol. 2, 4. (11) Arukwe, A., and Goksøyr, A. (1998) Xenobiotics, xenoestrogens and reproduction disturbancecs in fish. Sarsia 83, 225–241. (12) Nash, J. P., Kime, D. E., Van der Ven, L. T., Wester, P. W., Brion, F., Maack, G., Stahlschmidt-Allner, P., and Tyler, C. R. (2004) Longterm exposure to environmental concentrations of the pharmaceutical ethynylestradiol causes reproductive failure in fish. EnViron. Health Perspect. 112, 1725–1733. (13) Meucci, V., and Arukwe, A. (2005) Detection of vitellogenin and zona radiata protein expressions in surface mucus of immature juvenile Atlantic salmon (Salmo salar) exposed to waterborne nonylphenol. Aquat. Toxicol. 73 (1), 1–10. (14) Kwak, H. I., Bae, M. O., Lee, M. H., Lee, Y. S., Lee, B. J., Kang, K. S., Chae, C. H., Sung, H. J., Shin, J. S., Kim, J. H., Mar, W. C., Sheen, Y. Y., and Cho, M. H. (2001) Effects of nonylphenol, bisphenol A, and their mixture on the viviparous swordtail fish (Xiphophorus helleri). EnViron. Toxicol. Chem. 20, 787–795. (15) Jobling, S., Beresford, N., Nolan, M., Rodgers-Gray, T., Brighty, G. C., Sumpter, J. P., and Tyler, C. R. (2002) Altered sexual maturation and gamete production in wild roach (Rutilus rutilus) living in rivers that receive treated sewage effluents. Biol. Reprod. 66, 272–281. (16) Desbrow, C., Routledge, E. J., Brighty, G., Sumpter, J. P., and Waldock, M. J. (1998) Indentification of estrogenic chemicals in STW effluent. 1. Chemical fractionation and in vitrobiological screening. EnViron. Sci. Technol. 32, 1559–1565. (17) Larsson, D. G. J., Adolfsson-Erici, M., Parkkonen, J., Pettersson, M., Berg, A. H., Olsson, P. E., and Förlin, L. (1999) Ethinyloestradiol an undesired fish contraceptive. Aquat. Toxicol. 45, 91–97. (18) Aherne, G. W., and Briggs, R. (1989) The relevance of the presence of certain synthetic steroids in the aquatic environment. J. Pharm. Pharmacol. 41, 735–736. (19) Kolpin, D. W., Furlong, E. T., Meyer, M. T., Thurman, E. M., Zaugg, S. D., Barber, L. B., and Buxton, H. T. (2002) Pharmaceuticals, hormones, and other organic wastewater contaminants in U.S. streams, 1999–2000: A national reconnaissance. EnViron. Sci. Technol. 36, 1202–1211. (20) Arukwe, A. (2005) Modulation of brain steroidogenesis by affecting transcriptional changes of steroidogenic acute regulatory (StAR) protein and cholesterol side chain cleavage (P450scc) in juvenile Atlantic salmon (Salmo salar) is a novel aspect of nonylphenol toxicity. EnViron. Sci. Technol. 39, 9791–9798. (21) Lyssimachou, A., and Arukwe, A. (2007) Alteration of brain and interrenal StAR protein, P450scc, and Cyp11beta mRNA levels in atlantic salmon after nominal waterborne exposure to the synthetic pharmaceutical estrogen ethynylestradiol. J. Toxicol. EnViron. Health A 70, 606–613. (22) Kortner, T. M., and Arukwe, A. (2007) The xenoestrogen, 4-nonylphenol, impaired steroidogenesis in previtellogenic oocyte culture of Atlantic cod (Gadus morhua) by targeting the StAR protein and P450scc expressions. Gen. Comp. Endrocrinol. 150, 419–429. (23) Nader, M. R., Miura, T., Ando, N., Miura, C., and Yamauchi, K. (1999) Recombinant human insulin-like growth factor I stimulates all stages of 11-ketotestosterone-induced spermatogenesis in the Japanese eel, Anguilla japonica, in vitro. Biol. Reprod. 61, 944–947. (24) Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter, W. J. (1979) Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18, 5294–5299.

StAR Protein and Cholesterol Side-Chain CleaVage (25) Chomczynski, P., and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159. (26) Arukwe, A. (2006) Toxicological housekeeping genes: Do they really keep the house? EnViron. Sci. Technol. 40, 7944–7949. (27) Steele, B. K., Meyers, C., and Ozbun, M. A. (2002) Variable expression of some “housekeeping” genes during human keratinocyte differentiation. Anal. Biochem. 307, 341–347. (28) Lyssimachou, A., Jenssen, B. M., and Arukwe, A. (2006) Brain cytochrome P450 aromatase gene isoforms and activity levels in atlantic salmon after waterborne exposure to nominal environmental concentrations of the pharmaceutical ethynylestradiol and antifoulant tributyltin. Toxicol. Sci. 91, 82–92. (29) Barannikova, I. A., Dyubin, V. P., Bayunova, L. V., and Semenkova, T. B. (2002) Steroids in the control of reproductive function in fish. Neurosci. BehaV. Physiol. 32, 141–148. (30) Jiang, J. Q., Young, G., Kobayashi, T., and Nagahama, Y. (1998) Eel (Anguilla japonica) testis 11beta-hydroxylase gene is expressed in interrenal tissue and its product lacks aldosterone synthesizing activity. Mol. Cell. Endocrinol. 146, 207–211. (31) Bieniarz, K., and Epler, P. (1992) Advances in reproductive endocrinology of fish. J. Physiol. Pharmacol. 43, 215–222. (32) Yadetie, F., and Male, R. (2002) Effects of 4-nonylphenol on gene expression of pituitary hormones in juvenile Atlantic salmon (Salmo salar). Aquat. Toxicol. 58, 113–129. (33) Hutchinson, T. H., and Pickford, D. B. (2002) Ecological risk assessment and testing for endocrine disruption in the aquatic environment. Toxicology 181–182, 383–387. (34) Halm, S., Pounds, N., Maddix, S., Rand-Weaver, M., Sumpter, J. P., Hutchinson, T. H., and Tyler, C. R. (2002) Exposure to exogenous 17beta-oestradiol disrupts p450aromB mRNA expression in the brain and gonad of adult fathead minnows (Pimephales promelas). Aquat. Toxicol. 60, 285–299. (35) Kazeto, Y., Place, A. R., and Trant, J. M. (2004) Effects of endocrine disrupting chemicals on the expression of CYP19 genes in zebrafish (Danio rerio) juveniles. Aquat. Toxicol. 69, 25–34. (36) Trant, J. M., Gavasso, S., Ackers, J., Chung, B. C., and Place, A. R. (2001) Developmental expression of cytochrome P450 aromatase genes (CYP19a and CYP19b) in zebrafish fry (Danio rerio). J. Exp. Zool. 290, 475–483. (37) Hilscherova, K., Jones, P. D., Gracia, T., Newsted, J. L., Zhang, X., Sanderson, J. T., Yu, R. M., Wu, R. S., and Giesy, J. P. (2004) Assessment of the effects of chemicals on the expression of ten steroidogenic genes in the H295R cell line using real-time PCR. Toxicol. Sci. 81, 78–89. (38) Walsh, L. P., Webster, D. R., and Stocco, D. M. (2000) Dimethoate inhibits steroidogenesis by disrupting transcription of the steroidogenic acute regulatory (StAR) gene. J. Endocrinol. 167, 253–263. (39) Comeau, L. A., Campana, S. E., Chouinard, G. A., and Hanson, J. M. (2001) Timing of Atlantic cod Gadus morhua seasonal migrations in relation to serum levels of gonadal and thyroidal hormones. Marine Ecol. Prog. Ser. 221, 245–253. (40) Dahle, R., Taranger, G. L., Karlsen, O., Kjesbu, O. S., and Norberg, B. (2003) Gonadal development and associated changes in liver size and sexual steroids during the reproductive cycle of captive male and female Atlantic cod (Gadus morhua L.). Comp. Biochem. Physiol., Part A: Mol. Integr. Physiol. 136, 641–653. (41) Ankley, G. T., Jensen, K. M., Kahl, M. D., Korte, J. J., and Makynen, E. A. (2001) Description and evaluation of a short-term reproduction test with the fathead minnow (Pimephales promelas). EnViron. Toxicol. Chem. 20, 1276–1290. (42) Loomis, A. K., and Thomas, P. (2000) Effects of estrogens and xenoestrogens on androgen production by Atlantic croaker testes in


(43) (44)

(45)

(46)

(47)

(48) (49) (50)

(51)

(52)

(53)

(54)

(55) (56) (57) (58)

(59)

vitro: Evidence for a nongenomic action mediated by an estrogen membrane receptor. Biol. Reprod. 62, 995–1004. Borg, B. (1994) Androgens in teleosts fishes. Comp. Biochem. Physiol., Part C: Toxicol. Pharmacol. 109, 219–245. Rohr, D. H., Lokman, P. M., Davie, P. S., and Young, G. (2001) 11Ketotestosterone induces silvering-related changes in immature female short-finned eels, Anguilla australis. Comp. Biochem. Physiol., Part A: Mol. Integr. Physiol. 130, 701–714. Vendola, K., Zhou, J., Wang, J., Famuyiwa, O. A., Bievre, M., and Bondy, C. A. (1999) Androgens promote oocyte insulin-like growth factor I expression and initiation of follicle development in the primate ovary. Biol. Reprod. 61, 353–357. Kortner, T. M., Rocha, E., Silva, P., Castro, F., and Arukwe, A. (2007) Genomic approach in evaluating the role of androgens on the growth of Atlantic cod (Gadus morhua) previtellogenic oocytes. BMC Genomics, submitted for publication. Ho, S. M., Taylor, S., and Callard, I. P. (1982) Effect of hypophysectomy and growth hormone on estrogen-induced vitellogenesis in the freshwater turtle, Chrysemys picta. Gen. Comp. Endrocrinol. 48, 254–260. Bieniarz, K., and Kime, D. E. (1986) Autoradiographic localization of gonadotrophin receptors in ovaries of the common carp, Cyprinus carpio L. Gen. Comp. Endrocrinol. 64, 151–156. Tyler, C. R., and Sumpter, J. P. (1996) Oocyte growth and development in teleost. ReV. Fish Biol. Fish. 6, 287–318. Van den Belt, K., Verheyen, R., and Witters, H. (2003) Comparison of vitellogenin responses in zebrafish and rainbow trout following exposure to environmental estrogens. Ecotoxicol. EnViron. Saf. 56, 271–281. Schultz, I. R., Skillman, A., Nicolas, J. M., Cyr, D. G., and Nagler, J. J. (2003) Short-term exposure to 17 alpha-ethynylestradiol decreases the fertility of sexually maturing male rainbow trout (Oncorhynchus mykiss). EnViron. Toxicol. Chem. 22, 1272–1280. Walsh, L. P., McCormick, C., Martin, C., and Stocco, D. M. (2000) Roundup inhibits steroidogenesis by disrupting steroidogenic acute regulatory (StAR) protein expression. EnViron. Health Perspect. 108, 769–776. Fukuzawa, N. H., Ohsako, S., Wu, Q., Sakaue, M., Fujii-Kuriyama, Y., Baba, T., and Tohyama, C. (2004) Testicular cytochrome P450scc and LHR as possible targets of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in the mouse. Mol. Cell. Endocrinol. 221, 87–96. Fukuzawa, N. H., Ohsako, S., Nagano, R., Sakaue, M., Baba, T., Aoki, Y., and Tohyama, C. (2003) Effects of 3,3′,4,4′,5-pentachlorobiphenyl, a coplanar polychlorinated biphenyl congener, on cultured neonatal mouse testis. Toxicol. in Vitro 17, 259–269. Fairbrother, A., Smits, J., and Grasman, K. (2004) Avian immunotoxicology. J. Toxicol. EnViron. Health, Part B 7, 105–137. Rotchell, J. M., and Ostrander, G. K. (2003) Molecular markers of endocrine disruption in aquatic organisms. J. Toxicol. EnViron. Health, Part B 6, 453–496. Colborn, T., vom Saal, F. S., and Soto, A. M. (1993) Developmental effects of endocrine-disrupting chemicals in wildlife and humans. EnViron. Health Perspect. 101, 378–384. Guillette, L. J. J., Gross, T. S., Masson, G. R., Matter, J. M., Percival, H. F., and Woodward, A. R. (1994) Developmental abnormalities of the gonad and abnormal sex hormone concentrations in juvenile alligators from contaminated and control lakes in Florida. EnViron. Health Perspect. 102, 680–688. Orlando, E. F., Davis, W. P., and Guillette, L. J., Jr. (2002) Aromatase activity in the ovary and brain of the eastern mosquitofish (Gambusia holbrooki) exposed to paper mill effluent. EnViron. Health Perspect. 110 (Suppl. 3), 429–433.

TX700228G

Steroidogenic Acute Regulatory (StAR) Protein and Cholesterol Side

Recommend Documents