Strand Displacement-Induced Enzyme-Free Amplification for Label

Subscriber access provided by Universiteit Utrecht

Article

Strand Displacement-Induced Enzyme-Free Amplification for Label-Free and Separation-Free Ultrasensitive AFS Detection of Nucleic Acids and Proteins Piaopiao Chen, Peng Wu, Yuxiang Zhang, Junbo Chen, Xiaoming Jiang, Chengbin Zheng, and Xiandeng Hou Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.6b03633 • Publication Date (Web): 14 Nov 2016 Downloaded from http://pubs.acs.org on November 16, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Analytical Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 21

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Strand Displacement-Induced Enzyme-Free Amplification for Label-Free and Separation-Free Ultrasensitive AFS Detection of Nucleic Acids and Proteins

Piaopiao Chen,† Peng Wu,‡ Yuxiang Zhang,† Junbo Chen,‡ Xiaoming Jiang,‡ Chengbin Zheng,† Xiandeng Hou*,†,‡

†

College of Chemistry, and ‡Analytical & Testing Center, Sichuan University,

Chengdu, Sichuan 610064, China

*Corresponding authors. E-mail: [email protected]. Tel: +86-28-85470818

1 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract In previous work, we have developed a simple strategy for a label-free and separation-free bioassay for target DNA and protein, with the limit of detection at the nM level only. Herein, taking advantage of atomic fluorescence spectrometric detection of metal ions and amplification of DNA, a label-free and separation-free ultrasensitive homogeneous DNA analytical platform for target DNA and protein detection was developed on the basis of an enzyme-free strand displacement signal amplification strategy for dramatically improved detectability. Using the T-Hg2+-T hairpin structure as the probe, the target DNA binds with HP (T-Hg2+-T-hairpin structure) and released the Hg2+ first; then, the P4 (help DNA) hybridizes with target-P3 complex and free the target DNA, which is used to trigger another reaction cycle. The cycling use of the target amplifies the mercury atomic fluorescence intensity for ultrasensitive DNA detection. Moreover, the enzyme-free strand displacement signal amplification analytical system was further extended for protein detection by introducing an aptamer-P2 arched structure with thrombin as a model analyte. The current homogeneous strategy provides an ultrasensitive AFS detection of DNA and thrombin down to the 0.25 aM and 0.1 aM level, respectively, with a high selectivity. This strategy could be a promising unique alternative for nucleic acid and protein assay.


Page 2 of 21

Page 3 of 21

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction The development of sensitive and selective biosensors is important in clinical diagnostics, biological studies and life science. It has been generally recognized that, in the early stage of diseases, the concentrations of relevant biomarkers are usually at a relatively low level. Hence, development of highly sensitive and selective analytical methods to detect a unique target analyte has been a major goal of bioanalysis. Until now, various signal amplification strategies have been pursued to explore the extreme detection capability towards target analytes based on enzyme-free ways such as supersandwich,1 hybridization chain reaction,2-3 strand displacement amplification,4 and the catalysis by nucleases such as nicking endonucleases,5-6 exonuclease7-8 and DNA polymerase.9 Despite these target cycling methods via nucleases are highly sensitive and selective, they greatly increase the detection cost and may limit their application. Therefore, the enzyme-free signal amplification has received increasing interest, due to the simplicity of these sensing approaches without the involvement of any enzymes. Atomic spectrometric techniques, i.e., atomic absorption spectrometry (AAS), atomic emission spectroscopy (AES), atomic fluorescence spectrometry (AFS) and inductively coupled plasma mass spectrometry (ICP-MS), have been extensively applied in biological and environmental analysis, because of the excellent specificity and sensitivity for elemental detection.10-12 Therefore, atomic spectrometric techniques are expected to be useful in sensitive bioassay via elemental detection. Zhang et al.13 firstly proposed an ICP-MS-based approach for highly sensitive 3 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 21

immunoassay assay of proteins using Au NPs as a tag. Subsequently, AFS and AES-based sandwich immunoassay were also developed by labeling with HgS or Si nanoparticles, respectively.14-15 By replacing the antibody with DNA/aptamers, several atomic spectrometric methods have been used for DNA/aptamer-linked bioassays with the limit of detection (LOD) down to the fM or even the aM level.16-18 Taking the advantages of atomic spectrometry (especially ICP-AES and ICP-MS), multiplex analysis can also be achieved.19-21 Although increasing attention has been attracted for the atomic spectrometry-based bioassays, the detection schemes usually use metal ions or nanoparticles as tags, thus requiring the tedious labeling, immobilization and separation processes. Therefore, attributed to the fact that the cold vapor generation (CVG) efficiency of Hg2+ from the SnCl2-HCl system is obviously decreased in the presence of T-rich DNA because of the decrease of free Hg2+, we have developed a simple strategy for a label-free and separation-free bioassay.22 However, the achieved LOD was only at the nM level, albeit high selectivity. Herein,

a

simple

and

cost-efficient

enzyme-free

strand

displacement

reaction-aided autocatalytic target recycling strategy was proposed and integrated with the homogeneous label-free and separation-free CVG-AFS method for ultrasensitive assay of DNA and protein for improved sensitivity of our previously reported work. In this scheme, two types of hairpin structures, P3-Hg2+ (T-Hg2+-T) and P4 were used. The thymine (T)-rich DNA (P3) is ingeniously designed, which could interact with Hg2+ to form the stable T-Hg2+-T hairpin structure (HP) in solution. The target DNA binds with P3-Hg2+ and releases the captured Hg2+, and the atomic 4 ACS Paragon Plus Environment

Page 5 of 21

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


mercury fluorescence signal increases; P4 hybridizes with P3 and liberates the target DNA, which becomes available for next cycle of T-Hg2+-T-target hybridization. The cycling use of the target DNA continuously destroys T-Hg2+-T hairpin structure and releases more Hg2+, which amplifies the AFS signal. It was further extended for protein detection with the introduction of an aptamer-P2 arched structure with thrombin as a model analyte. This approach does not require expensive protein enzymes and complex thermal-cycling procedures. Moreover, the CVG-AFS-based method avoids the separation and washing steps.

EXPERIMENTAL SECTION Reagents. The oligonucleotide sequences were purchased from Sangon Biotech Co., Ltd. (Shanghai, China) and listed in Table 1. A 1000 mg L-1 inorganic Hg2+ stock solution was purchased from the National Research Center for Standard Materials (NRCSM) of China (Beijing, China). High purity chemicals SnCl2, HCl and NaOH (for adjusting the pH of the diluted solutions) were purchased from Kelong Reagent Co. (Chengdu, China). Bovine serum albumin (BSA), human serum albumin (HSA), trypsin, transferrin, lysozyme and thrombin were ordered from Sigma-Aldrich (St. Louis, MO, USA). All working solutions were prepared with phosphate buffered saline (PBS, 10 mM, pH 7.4). Table 1 Sequence of oligonucleotides for this work Name

Sequence (5′-3′)

P1 (aptamer)

AGTCCGTGGTAGGGCAGGTTGGGGTGACT

P2 (target DNA)

AGTCATTTTTTACGGACC

P3 (HP)

CTTTTTTGGTCCGTAAAAAATGACTTTTTTG 5 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

P4 (help probe)

CAAAAAAGTCATTTTTTACGGACCAAAAAAG

Single-base mismatched

AGTCATTTCTTACGGACC

Two-base mismatched

AGTCCTTTTTTAAGGACC

Non-complementary

GGTCGCTAGAGAGTGACT

Instrumentation. An AFS-2202 (Beijing Haiguang Instrument Co., Beijing) was used for the detection of the mercury atomic fluorescence and the instrumental optimal parameters are listed in Table S1, among which, carrier gas flow rate, shield gas flow rate and negative high voltage for the photomultiplier tube were carefully optimized (Figure S1). The pH was measured with a model FE20 pH meter (Mettler Toledo, Shanghai). Analytical Procedure. As shown in Scheme 1 for the sensing assay of DNA, the P3 (1 μM, 40 μL) and Hg2+ (2.5 μM, 80 μL) were mixed with PBS (280 μL, pH 7.4, 10 mM) at room temperature (RT) for 2 h to form the T-Hg2+-T hairpin structure; then, the P2 (target DNA) of different concentration (40 μL) and 40 μL P4 (help DNA, 1 μM) were added to the solution and incubated at RT for 2h. The same reaction mixtures without the target DNA were used as the negative control. Before AFS detection, the final reaction mixture was diluted to 4 mL with ultrapure water, reduced with 0.125% (m/v) SnCl2 in an intermittent flow manner to form the Hg0 vapor and detected by AFS for quantitative analysis. Protein detection was schematically shown in Scheme 2. Firstly, 40 μL P1 (thrombin aptamer, 1 μM) and the same concentration of P2 (40 μL) were mixed with PBS (280 μL, pH 7.4, 10 mM) to form the aptamer probe-P2 arched structure at RT 6 ACS Paragon Plus Environment

Page 6 of 21

Page 7 of 21

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


for 1 h. Secondly, different concentrations of thrombin (40 μL) were added to the arched structure solution at RT for 1.5 h. Finally, the above mixtures were added with the solution of T-Hg2+-T hairpin structure at RT for 1 h, and then diluted to 4 mL with ultrapure water. Finally, the Hg2+ signals were obtained from the diluted solutions by CVG-AFS for thrombin quantitative analysis. All the measurements were parallel measured for three times, and the standard deviation (SD) was plotted as an error bar.

Scheme 1 Schematic illustration of the enzyme-free strand displacement reaction signal amplification strategy for target DNA detection.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Scheme 2 The schematic illustration of the enzyme-free strand displacement reaction signal amplification strategy for target protein detection.

RESULTS AND DISCUSSION Principle of the proposed strategy. The detection principle is illustrated in Scheme 1. Two hairpin DNA probes (HP and P4, in Table 1) were ingeniously designed. In the presence of Hg2+, free single-strand DNA P3 (containing 6 T bases at 3′ and 5′, respectively) with a random coil structure interacted with Hg2+ to form T-Hg2+-T hairpin structure (HP), which could be stable in solution and differentiated with free Hg2+ by CVG-AFS as we previously reported.22 The P4 could form stem-loop structure due to the binding of the complementary sequences at the ends. The stem of the P4 stem-loop structure is relatively longer than 8 ACS Paragon Plus Environment

Page 8 of 21

Page 9 of 21

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


those in the other stem-loop-based sensors. The purpose is to make the structure sufficiently stable individually in their hairpin structure, prevent the HP and P4 from hybridization, and improve the sensitivity of the method. Moreover, the sequence of the loop of HP is complementary to the target DNA, while all sequence of P3 is complementary to P4. When the HP was challenged with target DNA, the recognition of target DNA and HP would destroy T-Hg2+-T hairpin structure and release the Hg2+, leading to an increasing of fluorescence intensity. Then the P4 (help DNA) hybridizes with target-P3 complex and free target DNA, which is used to trigger another reaction cycle. In this way, the target DNA trigger could be exponentially produced. Therefore, the CVG-AFS-based target recycling strategy is hopeful for offering an ultrahigh sensitivity for the assay of nucleic acid. Furthermore, the enzyme-free and label-free and separation-free CVG-AFS-based system also extended for protein detection by the use of aptamer-P2 arched structure as well as choice of thrombin as a model analyte. The corresponding content for protein detection will be discussed in a later section of this work. To verify the feasibility of designed enzyme-free AFS amplified strategy for DNA detection, atomic mercury fluorescence intensities obtained upon analyzing the DNA in a series of control experiments were depicted in Figure 1. As shown in Figure 1a, a low fluorescent intensity was obtained for the probe solution containing the P3 and Hg2+ to form T-Hg2+-T hairpin structure. Negligible change was obtained upon adding P4 (as shown in Figure 1b). Upon incubation of target DNA with this HP probe solution, an increased fluorescence signal was observed (c and d vs. a). Such increase 9 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

in AFS signal is due to the fact that target DNA binds to and opens the T-Hg2+-T hairpin structure, leading to the release of Hg2+, then selective reduction by SnCl2. As shown in Figure 1e, after the addition of 0.1 pM target DNA with 100 nM P4, the increased signal is greater than that of 10 nM target DNA without P4 (e vs. c). Clearly, the signal enhancement was caused by the cycling use of the target DNA and the continuous generation of the P3-P4 complex as shown in Scheme 1. Moreover, with the increasing of target DNA, following with increased fluorescence signal could be observed (as shown in Figure 1e-h). Therefore, the results indicated that the conformational change of P3 and P4 were triggered by the target DNA and the strategy in Scheme 1 worked well.

Figure 1 The feasibility of the proposed method for DNA detection.

Optimization of Experimental Conditions. Formation T-Hg2+-T conditions. Incubation time is important for the formation of T-Hg2+-T hairpin structure. As shown in Figure S2A, the reaction between P3 and Hg2+ could reach the equilibrium within 2 h. Hence, the incubation time of 2 h was selected for further experiments. 10 ACS Paragon Plus Environment

Page 10 of 21

Page 11 of 21

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Besides, the different molar ratios of P3 to Hg2+ were investigated (Figure S2B). The optimal molar ratio of P3 to Hg2+ is 1:5 in this method. These experimental results well agree with the previous report.23 Based on these results, concentrations of 100 nM of P3 and 0.5 µM of Hg2+ were selected for further studies. It is known that Mg2+ can not only accelerate the combined rate between T-rich DNA and Hg2+ to form the T-Hg2+-T hairpin structure, but also stabilize the DNA structure due to neutralized negatively charged phosphate group. As shown in Figure S2C, the optimal concentration of Mg2+ is 10 mM in this method. Selective reduction conditions. The pH of the diluted solution is an important parameter influencing on not only the stability of T-Hg2+-T but also the binding affinity. As shown in Figure S3A, pH 7.0 was selected and the tedious pH adjustment was also eliminated for subsequent experiments because the samples could be directly analyzed after dilution with ultrapure water. It was found that the signal increased significantly with the concentration of SnCl2 in the range of 0.01%-0.125% (m/v); an obvious decrease is observed at the higher concentration range (as shown in Figure S3B). Therefore, a concentration of 0.125% (m/v) SnCl2 was selected for subsequent experiments based on a compromise between signal intensity and selective reduction of Hg2+. DNA assay. Time for competition reaction. We also studied the appropriate time for the competition reaction between the target DNA with the P3-Hg2+ complex. The (F-F0) / F0 increased rapidly with incubation time from 0 to 2 h and then leveled off after 2 h 11 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(as shown in Figure S4A). Consequently, an incubating time of 2 h was adopted for the competition reaction. Concentration of P4 (help DNA). In this assay, the initial amounts of P4 play an important role for performance of this analytical method. As shown in Figure S4B, P4 concentration of 100 nM could achieve the best (F-F0) / F0. A higher concentration of P4 could result in a lower (F-F0) / F0. This might be ascribed to the higher concentration of P4 for the higher background signal. Therefore, P4 concentration of 100 nM was adopted for the cycle amplification reaction. Performance of DNA Assay. Under the optimized experimental conditions, the detection was investigated by using target DNA with different concentrations. As shown in Figure 2A, the fluorescence intensity increased with the concentration of target DNA ranging from 10 aM to 300 nM. The inset shown a good linear correlation of the fluorescence intensity to the logarithm of concentration of the target DNA ranging from 10 aM to 100 nM with a correlation coefficient of R2 = 0.992. The limit of detection (LOD, 3σ) was estimated to be 0.25 aM, which is comparable to those obtained in the enzyme-free amplification methods,24-26 even as sensitive as other enzyme-aided amplification schemes.27-29 To confirm that the high sensitivity of current strategy was the consequence of the target-induced strand displacement reaction, control experiments involving P3 only at different target concentration were conducted under similar conditions. As shown in Figure 2B, a good linear correlation of the fluorescence intensity to the concentration of the target DNA ranging from 1 nM to 200 nM with a correlation coefficient of R2 = 12 ACS Paragon Plus Environment

Page 12 of 21

Page 13 of 21

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


0.997. The LOD was estimated to be 0.31 nM, which is about 9 orders of magnitude poorer than that of the current scheme.

Figure 2 A plot of the relationship between CVG-AFS signal of Hg2+ and the concentration of the target DNA (A) Amplification, the inset shows the linear part from 10 aM-100 nM. (B) No amplification, the inset shows the linear part from 1 nM-200 nM.

Methods Selectivity. The selectivity of the sensing scheme was also evaluated by monitoring the fluorescence response when this method was challenged with one base- and two base-mismatched as well as non-complementary DNA sequences at same concentrations of 1 nM, 10 nM and 100 nM, respectively. As shown in Figure 3, in contrast to the significant enhancement of fluorescence intensity (F-F0) induced by the target DNA, the addition of base–mismatched strands trigger much less fluorescence intensity enhancement. Thus, this method exhibited a good performance 13 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

to discriminate perfect complementary target and the base mismatched targets and hold potential for single nucleotide polymorphism analysis.

Figure 3 Sequence-specificity investigation of the proposed method using different DNA targets at same concentrations of 1 nM, 10 nM and 100 nM, respectively.

Protein assay. Inspired by the above results, this strategy was further applied for the determination of protein (Scheme 2), and human thrombin was chosen as the model analyte of interest, which played an important role in the thrombosis, hemostasis, and many coagulation-related reactions.30-31 Herein, the arched structure was formed by hybridization of aptamer of thrombin (apt 29) with Probe 2 (P2).32 In absence of thrombin, no free P2 could be generated and the T-Hg2+-T hairpin structure (HP) was stable in solution. In this case, low AFS signal from Hg2+ could be expected. When thrombin was present, it was bound to the aptamer sequence in the arched structure, due to the high binding affinity between thrombin and the corresponding aptamer and the P2 was released. The liberated P2 further hybridized with HP and opened the T-Hg2+-T hairpin structure of HP. Thus, on one hand, the free Hg2+ was released, leading to high atomic fluorescent signal; on the other hand, exposing the 14 ACS Paragon Plus Environment

Page 14 of 21

Page 15 of 21

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


complementary sequence of P3 and P4 (help DNA) led to binding of P4 with P3. Because the P3-P4 duplex is more stable than the P2-P3 hybridization, P4 would replace and free P2 when it hybridizes with P3. The released P2 then became available to trigger another reaction cycle for the formation of P3-P4 complex, resulting in the generation of massive Hg2+ even with a tiny amount of the target protein. Therefore, the current enzyme-free target recycling strategy by strand displacement was hopeful for offering an ultrasensitive for the assay of protein. In order to verify the feasibility of a proposed method for thrombin detection, the fluorescence signals of different mixtures were recorded, as shown in Figure 4A. Such results again confirmed that the proposed label-free and separation-free AFS-based protocol was successful for thrombin detection. To achieve optimal performance for thrombin detection by using the proposed method, the experimental conditions, such as the time for P1 and P2 to react to form the arched structure, the interaction time between the P1-P2 arched structure and thrombin, and the competitive reaction time between P1-P2-thrombin mixtures and T-Hg2+-T hairpin structure (HP), and the concentration of P1-P2 were investigated. As shown in Figure S5 A, C and D, the time of 1 h, 1.5 h and 1 h for the reaction between P1 and P2, the reaction between the P1-P2 arched structure and thrombin, and the reaction between P1-P2-thrombin mixtures and HP were enough, respectively. The concentration of P1-P2 arched structure was shown in Figure S5B, and it can be seen that the (F-F0) / F0 value sharply increased in the range from 50 nM to 100 nM, reaching the maximum value at the concentration of 100 nM, and slightly decreased 15 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

therefater. Therefore, the concentration of P1-P2 at 100 nM was used in the subsequent experiments. To show the ability of the described strategy to sensitively detect target protein, a series of different concentrations of thrombin ranging from 0.1 aM to 1 μM was measured (Figure 4B). It could be seen that the fluorescence intensity of Hg2+ with the logarithm of the concentration of thrombin showed a good linear relationship in the range from 0.1 aM to 100 nM with a correlation coefficient of 0.998. The directly measured detection limit can reach as low as 0.1 aM, indicating superior or comparable detectability compared with those reported previously.33-36 This high sensitivity could be ascribed to the large signal amplification effect of the developed enzyme-free strand displacement amplification strategy. To further prove the signal amplification effect of currently developed strategy, control experiments without P4 at different target protein concentrations were conducted at similar conditions. As shown in Figure 4C, the fluorescence intensity followed in similar manner to that in Figure 4B when the target concentration was varied from 10 pM - 200 nM. A careful comparison between parts B and C of Figure 4 reveals that the amount of target needed for the proposed scheme (Figure 4B) was much lower than that without the aid of P4 (Figure 4C) to produce comparable fluorescence intensity. The LOD of the control assay was only 0.5 pM, which is 6 orders of magnitude poorer than that of the current scheme.


Page 16 of 21

Page 17 of 21

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4 (A) The feasibility of the proposed method for protein (thrombin) detection. (B) Amplification, the inset shows the linear part from 0.1 aM-100 nM. (C) No amplification, the inset shows the linear part from 10 pM-200 nM. (D) Specificity for the determination of thrombin against other proteins. The concentration of BSA and HSA: 100 nM; trypsin, transferrin and lysozyme: 1000 nM; thrombin concentration: 1 nM.

The selectivity of the developed method was evaluated by using several other control proteins such as bovine serum albumin (BSA) and human serum albumin (HSA) at 100-fold higher than that of thrombin (1 nM), trypsin, transferrin and lysozyme at 1000-fold higher than that of thrombin (1 nM). As shown in Figure 4D, the presence of thrombin (1 nM) leads to a significant fluorescent response (refer to (F-F0)/F0), while the presence of excess of control protein (100 nM for BSA and HSA, 1000 nM for trypsin, transferrin and lysozyme) has a neglectable influence on the fluorescent signal compared to the blank test (in the absence of thrombin). This 17 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

comparison clearly shows the high selectivity of the method, which is associated with the highly specific binding between the target thrombin and the aptamer. To verify the potential application of the proposed strategy to complex biological samples, recovery tests by adding various concentrations of thrombin to human serum were performed using the developed method. The serum samples were diluted 10, 20 and 100 folds with buffer and filtered using a centrifugal filtration device (MWCO = 50 K) to remove macromolecules, e.g., HSA and other abundant proteins. The recoveries for the spiked thrombin were in the range of 87-102%, indicating the promissing applicability of this method to assay thrombin in real samples (Table S2). Conclusion A simple, cost-efficient, ultrasensitive, and homogeneous AFS-based DNA analytical method for target DNA and protein detection was developed on the basis of enzyme-free strand displacement reaction-induced signal amplification strategy for dramatically improved sensitivity of our previous work. Due to the significant signal amplification and the intrinsically high sensitivity of CVG-AFS detection, the LOD toward target DNA and thrombin was achieved to be as low as 0.25 aM and 0.1 aM, respectively, which was far more sensitive than most of the DNA and protein assays reported so far. In this strategy, the DNA probe does not need labeling or modifying, and the assay occurs directly in the homogeneous liquid phase, which avoids the separation and washing steps. Moreover, the simple method does not require protein enzymes nor thermal-cycling procedures. Thus, this may open a promising approach to develop label-free, separation-free, enzyme-free and ultrasensitive atomic or atomic 18 ACS Paragon Plus Environment

Page 18 of 21

Page 19 of 21

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


mass spectrometric bioassay. Acknowledgements The authors are grateful for the financial support from the National Natural Science Foundation of China (No.21275103 and No.21529501) and Doctoral Fund of Ministry of Education of China (No. 20120181110046).

Supporting Information Available: Optimization of CVG conditions and operating parameters of AFS, optimization of experimental conditions for DNA and thrombin detection, and analytical results for thrombin in human serum samples. This material is available free of charge via the Internet at http://pubs.acs.org. Notes The authors declare no competing financial interest. References (1) Chen, X.; Lin, Y. H.; Li, J.; Lin, L.-S.; Chen, G.-N.; Yang, H.-H. Chem. Commun. 2011, 47, 12116-12118. (2) Huang, J.; Wu, Y. R.; Chen, Y.; Zhu, Z.; Yang, X. H.; Yang, C. J.; Wang, K. M.; Tan, W. H. Angew. Chem. Int. Ed. 2011, 50, 401-404. (3) Wang, C.; Zhou, H.; Zhu, W. P.; Li, H. B.; Jiang, J. H.; Shen, G. L.; Yu, R. Q. Biosens. Bioelectron. 2013, 47, 324-328. (4) Huang, J. H.; Su, X. F.; Li, Z. G. Anal. Chem. 2012, 84, 5939-5943. (5) Xue, L. Y.; Zhou, X. M.; Xing, D. Chem. Commun. 2010, 46,7373-7375. (6) Liu, S. F.; Zhang, C. X.; Ming, J. J.; Wang, C. F.; Liu, T.; Li, F. Chem. Commun. 2013, 49, 7947-7949. (7) He, Y.; Xing, X. J.; Tang, H. W.; Pang, D. W. Small. 2013, 9, 2097-2101. (8) Liu, S. F.; Lin, Y.; Wang, L.; Liu, T.; Cheng, C. B.; Wei, W. J.; Tang, B. Anal. Chem. 2014, 86, 4008-4015.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(9) Shi, C.; Zhao, C. H.; Guo, Q. J.; Ma, C. P. Chem. Commun. 2011, 47, 2895-2897. (10) Zheng, C. B.; Li, Y.; He, Y. H.; Ma, Q.; Hou, X. D. J. Anal. At. Spectrom. 2005, 20, 746-750. (11) Chen, P. P.; Deng, Y. J.; Guo, K. C.; Jiang, X. M.; Zheng, C. B.; Hou, X. D. Microchem. J. 2014, 112. 7-12. (12) Campanella, B.; Onor, M.; D'Ulivo, A.; Giannarelli, S.; Bramanti, E. Anal. Chem. 2014, 86, 2251-2256. (13) Zhang, C.; Zhang, Z. Y.; Yu, B. B.; Shi, J. J.; Zhang, X. R. Anal. Chem. 2002, 74, 96-99. (14) Liu, X.; Liu, R.; Tang, Y. R.; Zhang, L. C.; Hou, X. D.; Lv, Y. Analyst. 2012, 137, 1473-1480. (15) Wu, L. L.; Qiu, L. W.; Shi, C. S.; Zhu, J. Biomacromolecules. 2007, 8, 2795-2800. (16) Du, F.; Alam, M. N.; Pawliszyn, J. Anal. Chim. Acta. 2014, 845. 45-52. (17) Hu, J.; Hou, X. D.; Wu, P. J. Anal. At. Spectrom. 2015, 30, 888-894. (18) Lee, S. J.; Adler, B.; Ekstrom, S.; Rezeli, M.; Vegvari, A.; Park, J. W.; Malm, J.; Laurell, T. Anal. Chem. 2014, 86, 7627-7634. (19) Liu, J.-M.; Yan, X.-P. J. Anal. At. Spectrom. 2011, 26, 1191-1197. (20) Luo, Y. C.; Yan, X. W.; Huang, Y. S.; Wen, R. B.; Li, Z. X.; Yang, L. M.; Yang, C. J.; Wang, Q. Q. Anal. Chem. 2013, 85, 9428-9432. (21) Zhang, S. X.; Han, G. J.; Xing, Z.; Zhang, S. C.; Zhang, X. R. Anal. Chem. 2014, 86, 3541-3547. (22) Chen, P. P.; Wu, P.; Chen, J. B.; Yang, P.; Zhang, X. F.; Zheng, C. B.; Hou, X. D. Anal. Chem. 2016, 88, 2065-2071. (23) Li, Y.; Sun, S. K.; Yang, J. L.; Jiang, Y. Analyst. 2011, 136, 5038-5045. (24) Liu, S. F.; Wang, Y.; Ming, J. J.; Lin, Y.; Cheng, C. B.; Li, F. Biosens. Bioelectron. 2013, 49, 472-477. (25) Zhang, X.; Zhang, J.; Wu, D. Z.; Liu, Z. J.; Cai, S. X.; Chen, M.; Zhao, Y. P.; Li, C. Y.; Yang, H. H.; Chen, J. H. Analyst. 2014, 139, 6109-6112. (26) Zheng, A.-X.; Li, J.; Wang, J.-R.; Song, X.-R.; Chen, G.-N.; Yang, H.-H. Chem. Commun. 2012, 48, 3112-3114. (27) Gao, F. L.; Lei, J. P.; Ju, H. X. Chem. Commun. 2013, 49, 4006-4008. (28) Gao, Y.; Li, B. X. Anal. Chem. 2014, 86, 8881-8887. (29) Zuo, X. L.; Xia, F.; Xiao, Y.; Plaxco, K. W. J. Am. Chem. Soc. 2010, 132, 1816-1818.


Page 20 of 21

Page 21 of 21

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(30) Arai, T.; Miklossy, J.; Klegeris, A.; Guo, J. P.; McGeer, P. L. J. Neuropathol. Exp. Neurol. 2006, 65, 19-25. (31) Bowman, L. J.; Anderson, C. D.; Chapman, W. C. Semin. Thromb. Hemost. 2010, 36, 477-484. (32) Tasset, D. M.; Kubik, M. F.; Steiner, W. J. Mol. Biol. 1997, 272, 688-698. (33) Jiang, B. Y.; Wang, M.; Li, C.; Xie, J. Q. Biosens. Bioelectron. 2013, 43, 289-292. (34) Liu, S.; Lin, Y.; Wang, L.; Liu, T.; Cheng, C.; Wei, W.; Tang, B. Anal. Chem. 2014, 86, 4008-4015. (35) Yuan, Y. L.; Chai, Y. Q.; Yuan, R.; Zhuo, Y.; Gan, X. X. Chem. Commun. 2013, 49, 7328-7330. (36) Zheng, A.-X.; Wang, J.-R.; Li, J.; Song, X.-R.; Chen, G.-N.; Yang, H.-H. Chem. Commun. 2012, 48, 374-376.

For TOC only


Strand Displacement-Induced Enzyme-Free Amplification for Label

Recommend Documents