Structural and Functional Analysis of the Loading Acyltransferase from

Jan 12, 2015 - strict substrate specificity of the KSQ-type loading ATs is preserved when ..... plished using the GeneTailor Site-Directed Mutagenesis...
0 downloads 0 Views 5MB Size
Download PDF
Articles pubs.acs.org/acschemicalbiology

Structural and Functional Analysis of the Loading Acyltransferase from Avermectin Modular Polyketide Synthase Fen Wang,† Yanjie Wang,† Junjie Ji,† Zhan Zhou,† Jingkai Yu,† Hua Zhu,‡ Zhiguo Su,† Lixin Zhang,*,‡ and Jianting Zheng*,† †

National Key Laboratory of Biochemical Engineering, Institute of Process Engineering, Chinese Academy of Sciences, Beijing 100190, P.R. China ‡ CAS Key Laboratory of Pathogenic Microbiology and Immunology, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, P.R. China S Supporting Information *

ABSTRACT: The loading acyltransferase (AT) domains of modular polyketide synthases (PKSs) control the choice of starter units incorporated into polyketides and are therefore attractive targets for the engineering of modular PKSs. Here, we report the structural and biochemical characterizations of the loading AT from avermectin modular PKS, which accepts more than 40 carboxylic acids as alternative starter units for the biosynthesis of a series of congeners. This first structural analysis of loading ATs from modular PKSs revealed the molecular basis for the relaxed substrate specificity. Residues important for substrate binding and discrimination were predicted by modeling a substrate into the active site. A mutant with altered specificity toward a panel of synthetic substrate mimics was generated by site-directed mutagenesis of the active site residues. The hydrolysis of the Nacetylcysteamine thioesters of racemic 2-methylbutyric acid confirmed the stereospecificity of the avermectin loading AT for an S configuration at the C-2 position of the substrate. Together, these results set the stage for region-specific modification of polyketides through active site engineering of loading AT domains of modular PKSs.

last extension module to control the release and cyclization of the full-length polyketide intermediates. The avermectin PKS from Streptomyces avermitilis is a modular PKS that catalyzes the formation of avermectin aglycons by the addition of seven acetate and five propionate extender units to a starter unit.4 Under normal conditions in vivo, the loading module of avermectin PKS recruits 2methylbutyryl-coenzyme A (CoA) or isobutyryl-CoA as the starter unit to synthesize the avermectins of “a” series or “b” series, respectively (Figure 1), whereas the substrate feeding of a S. avermitilis mutant shows more than 40 alternative carboxylic acids can be accepted as starter units to generate a wide range of novel derivatives, including the commercially important analogue, doramectin.5 Interestingly, this broad specificity toward unnatural starter units could be transferred to a heterologous modular PKS by the substitution of the loading module. New erythromycin derivatives with branched starter units are produced when the loading module of 6deoxyerythronolide B synthase (DEBS) is replaced by that of the avermectin PKS.6 The loading module of avermectin PKS contains an AT domain and an ACP domain and is thus also

Modular polyketide synthases (PKSs) are large multifunctional enzyme complexes responsible for the assembly of structurally diverse polyketide natural products, many of which are endowed with a wide range of useful biological and pharmacological properties including antibacterial, antitumor, antifungal, antiparasitic, and immunosuppressant activities.1−3 Polyketide biosynthesis resembles fatty acid biosynthesis in that an acyl starter unit is condensed with a series of substituted malonyl extender units to form poly-β-keto intermediates. Compared to fatty acid biosynthesis, modular PKSs utilize a much wider variety of starter and extender units, leading to enormous structural diversity of polyketides. A minimal extension module has three domains: a ketosynthase (KS) that catalyzes the decarboxylative condensation, an acyltransferase (AT) that recruits the extender unit, and an acyl carrier protein (ACP) that shuttles the growing polyketide intermediate between enzymatic domains. It may also contain a ketoreductase (KR) to catalyze the reduction of the initially formed β-ketoester to a β-hydroxyester, a dehydratase (DH) to dehydrate the β-hydroxyester, and an enoylreductase (ER) domain to reduce the double bond. An additional loading module is located at the N-terminus of the first extension module to prime the KS1 domain, whereas a dedicated thioesterase (TE) domain is located at the C-terminus of the © XXXX American Chemical Society

Received: October 25, 2014 Accepted: January 12, 2015

A

DOI: 10.1021/cb500873k ACS Chem. Biol. XXXX, XXX, XXX−XXX

Articles

ACS Chemical Biology

The extension ATs that play a pivotal role in extender unit selection during polyketide chain elongation have been extensively investigated. The crystal structures of two extension ATs from DEBS (EryAT3 and EryAT5, named by the corresponding PKS and module of origin) have been solved and facilitated the engineering of substrate specificity of extension AT domains.12,13 Here, we report the 2.0 Å resolution structure of the loading AT domain of avermectin PKS, AveAT0, which represents a compelling target for the study of substrate specificity because of its ability to accept various unnatural starter units for the biosynthesis of a series of avermectin derivatives. The structure helped reveal the molecular basis for the broad substrate specificity. Residues important for substrate binding and discrimination were predicted by modeling a substrate into the active site and a single mutation could significantly alter the specificity and activity. The stereospecificity of AveAT0 was revealed by the hydrolysis of racemic 2-methylbutyryl-SNAC (SNAC = Nacetylcysteamine that mimics the end of the pantetheine moiety of CoA) thioester. The structural and functional studies of AveAT0 presented here highlight the possibility of the rational engineering of loading ATs in modular PKSs.

Figure 1. Loading AT within avermectin PKS. The loading AT recruits 2-methylbutyryl or isobutyryl from coenzyme A and transfers it to loading ACP to primer the biosynthesis of avermectins of “a” series or “b” series, respectively.

called a loading didomain. The loading AT is the primary determinant of starter unit specificity in polyketide chain initiation, while the loading ACP accepts the starter unit selected by the loading AT and transfers it to the KS of the first extension module. The didomain architecture of loading module is also observed in DEBS that catalyzes the formation of 6-deoxyerythronolide B (6-dEB), the aglycon of erythromycin. In the wild type strain, the loading AT of DEBS recruits only propionate-CoA as starter unit, whereas in recombinant cells or with the purified enzyme in vitro, several other acyl-CoA thioesters are accepted as starter units to prime the assembly of 6-dEB derivatives.7 The loading AT of lipomycin PKS shows significant similarity to that of avermectin PKS. As expected, in vitro characterization of LipPks1, a PKS subunit containing both the loading didomain and the first extension module, reveals that several acyl-CoA thioesters, including isobutyryl-CoA, are accepted as the starter units.8 More than half of PKS loading modules contain an additional N-terminal domain termed KSQ closely resembling a KS domain except that the catalytic cysteine residue of the active site is replaced by glutamine (Q).9 ATs of KSQ-type loading modules are specific for CoA-esters of dicarboxylic acids rather than monocarboxylic acids that are accepted by the ATs of avermectin-type (AVE-type) loading modules. Decarboxylation of dicarboxylic acid CoA-esters catalyzed by KSQs has been invoked as the mechanism for chain initiation on these modular PKSs. In contrast to the broad specificity of AVE-type loading ATs, the KSQ-type loading ATs exhibit a strict substrate specificity and select either malonyl-CoA or methylmalonyCoA, which is decarboxylated in situ to provide acetyl or propionate starter units for the polyketide initiation.10 The strict substrate specificity of the KSQ-type loading ATs is preserved when they are studied in vitro with purified enzymes. Similar to ATs of extension modules, the ATs of the KSQ-type loading modules contain a conserved arginine residue in their active sites. The crystal structure of the Escherichia coli malonylCoA:ACP acyltransferase (MCAT) crystallized with malonylCoA reveals that this arginine residue lies in the active site and interacts with the free carboxyl group of the substrate.11 The oleandomycin PKS contains a KSQ in its loading module and its loading AT can be replaced by an authentic extension AT without interrupting the activity of the enzyme.10

■

RESULTS AND DISCUSSION Expression of Discrete Loading AT. In the past decade, the structural analysis has facilitated the dissection of an intact PKS module into isolated domains that could be used for assays of substrate specificity, catalytic activity, stereocontrol, and interdomain interactions.14,15 The KS-to-AT linkers have been shown to stabilize the extension ATs that are expressed as isolated domains. The absence or incompleteness of KS-to-AT linkers in AT constructs results in insoluble and/or inactive proteins. The expression of discrete loading AT domains has been a challenge. Thus far, kinetic assays are all carried out by using multimodular enzymes or loading AT-ACP didomains whose utility is limited due to the presence of the fused ACPs and other catalytic domains.7,8,16 Here, we show that AveAT0 can be expressed as a standalone domain in E. coli BL21 (DE3), providing the opportunity to investigate the detailed mechanism of loading ATs. The 26 amino acids preceding the AveAT0 were included in the construct since the 107 residues N-terminal of EryAT0 were necessary for creating an active loading AT, whereas the G354 that was 16 residues upstream of the loading ACP was chosen as the C-terminal end by sequence alignments with EryKS-AT3 and EryKS-AT5 didomains.7,12,13 The N-terminally histidine-tagged protein migrated at ∼35 kDa on a size exclusion column as estimated by comparison to molecular weight standards, consistent with the expected monomer mass of 40 kDa (Supporting Information Figure 1). Overall Structure. The AveAT0 purified to homogeneity was entered into crystallization trials and diffraction-quality crystals were obtained by sitting-drop method using sodium formate as the precipitant. The protein crystallized in space group P212121 with one monomer per asymmetric unit. The crystal structure was solved by molecular replacement using the structure of EryAT5 (PDB code 2HG4) as a search model and refined to 2.0 Å resolution, with Rworking and Rfree values of 0.21 and 0.24, respectively (Table 1).13 The final refined model contains 318 out of 354 residues of the monomer. No electron density was observed for the 26 N-terminal residues, the last two C-terminal residues, and an internal disordered region (residue 319−326). B

DOI: 10.1021/cb500873k ACS Chem. Biol. XXXX, XXX, XXX−XXX

Articles

ACS Chemical Biology

structurally homologous proteins using the Dali server revealed similarity to the AT domains of PKSs (PDB code 4MZ0, 2.1 Å Cα rmsd; PDB code 3TZY, 1.8 Å Cα rmsd; PDB Code 3SBM, 2.2 Å Cα rmsd; PDB code 4AMP, 2.5 Å Cα rmsd), the AT domains of type I mammalian fatty acid synthases (FASs) (PDB code 2VZ8, 1.9 Å Cα rmsd), and the discrete malonylCoA:ACP transacylases of type II bacterial FASs (PDB code 2G2Z, 2.4 Å Cα rmsd; PDB code 1NM2, 2.6 Å Cα rmsd).11,17−22 Active Site. The active site of AveAT0 is a predominantly hydrophobic cavity located at the interface of the large α,βhydrolase subdomain and the small ferredoxin-like subdomain (Figure 2A). The volume of the AveAT0 active site cavity (971 Å3 calculated by program CAST) is significantly smaller than that of EryAT3 (1800 Å3) and EryAT5 (1588 Å3).12,13,23 Dynamics simulations of MonAT5 reveals that the ferredoxinlike subdomain tends to move away from the α,β-hydrolase subdomain to form a more open and exposed active site in the absence of substrate.24 The active site cavity of AveAT0 is formed by the residues from the β strands of the small subdomain, the α helices of the large subdomain, and the loops connecting these secondary structure elements (Figure 2B). The catalytic S120 of the highly conserved Gly-X-Ser-X-Gly motif is located at the N terminus of helix αE where its nucleophilicity is enhanced by the α helix dipole effect, while catalytic His227 that is proposed to act as a general base/acid catalyst in the acyl-transfer reaction resides in the loop FI connecting the two subdomains. The carbonyl groups of Asn276 and Ser279 are at hydrogen bond distance from the δnitrogen atom of His227 and help to position its side chain in an optimal orientation where the ε-nitrogen atom establishes a hydrogen bond with the side-chain hydroxyl group of the catalytic Ser120 (Figure 3), thereby increasing its reactivity. The similarly arranged serine-histidine “‘catalytic dyad”’ indicates that AveAT0 utilizes a catalytic mechanism analogous

Table 1. Data Collection and Refinement Statistics (Molecular Replacement) AveAT0 Data Collection P212121 47.21, 74.29, 82.42 90 50−2.0 0.073 (0.209) 14.8(8.1) 99.4 (99.9) 4.3 (4.9)

space group a, b, c (Å) α, β, γ (deg) resolution (Å) Rmerge I/σI completeness (%) redundancy Refinement resolution (Å) No. reflections Rwork/Rfree No. atoms protein water B-factors protein water rmsd bond lengths (Å) bond angles (deg)

50−2.0 19000 0.21/0.24 2392 58 25 28 0.010 1.391

AveAT0 contains two subdomains: a large α,β-hydrolase subdomain (residues 27−152 and 230−353) composed of a mixed-stranded β-sheet surrounded by α-helices and a small subdomain (residues 156−219) that adopts a typical ferredoxin-like fold containing four-stranded antiparallel βsheets and two distal α-helices (Figure 2). AveAT0 most closely resembles its counterparts in the extending modules of DEBS (Protein Data Bank (PDB) codes 2HG4, 1.1 Å Cα rmsd; PDB code 2QO3, 1.4 Å Cα rmsd).12,13 An automatic search for

Figure 2. Structure of a loading AT. (a) The loading AT AveAT0 contains two subdomains: a hydrolase subdomain and a ferredoxin subdomain. The linkers between two subdomains are colored in gray. The substrate binding tunnel was shown as surface. Catalytic serine and histidine residues are shown as stick while the N-terminal and C-terminal ends as spheres. (b) Structure based sequence alignment of AveAT0, EryAT3, and EryAT5. The reported secondary structure is from AveAT0. The linkers connecting two subdomain are underlined in gray. Catalytic residues are labeled “*”. Residues of active site cavity are labeled “+”. C

DOI: 10.1021/cb500873k ACS Chem. Biol. XXXX, XXX, XXX−XXX

Articles

ACS Chemical Biology

to other PKS and FAS ATs. Transfer of the acyl group from CoA to ACP occurs by a ping-pong bibi mechanism through an acyl-AT intermediate that is attacked by the thiol residue of the phosphopantetheine arm of ACP cosubstrates.25−27 In the absence of holo-ACP, the acyl-enzyme intermediate will be rapidly hydrolyzed due to the nucleophilic attack by the water molecule.28 AveAT0 catalyzes the hydrolysis of a panel of synthetic SNAC thioesters of monocarboxylic acids. The crystals could be grown or soaked in crystallization buffer containing millimolar concentration of these substrate mimics, but no corresponding electron density was observed. To elucidate the details of substrate binding, 2-methylbutyryl-SNAC was modeled into the active site using the program Coot. The substrate−enzyme interactions observed in the malonyl-FabD intermediate structure complexed with CoA (PDB code 2Z2G) were used to guide the modeling.11 The substrate was positioned with the 2-methylbutyryl moiety inserted deep into the cavity and the SNAC moiety toward the entrance. An ordered water molecule forming hydrogen bonds to both the backbone amides of the conserved Gln35 and the side chain OH of the catalytic Ser120 was used to guide the placement of the thioester carbonyl of the substrate while the SNAC portion was orientated through a hydrogen bond to the side chain of His119. The modeled results suggested that (2S)-methylbutyryl was accepted by AveAT0 as the starter unit for biosynthesis of the avermectin. The α-methyl in an R-orientation would sterically clash with the catalytic histidine. The modeling of the substrate revealed 13 residues (Gln35, Gln92, His119, Ser120, Leu121, Trp145, Gln149, Leu158, Ile220, Val222, Val224, Ala226, and His227) within 6 Å of the 2-methylbutyryl moiety (Figure 3B, C). The hydrophobic

Figure 3. Active site of AveAT0. (a) The hydrogen bonds shown as dash lines in yellow help the orientation of catalytic serine and histidine. (b) Stereodiagram shows the 2Fo-Fc electron density map (contoured at 1.0 δ) surrounding the residues in direct contact with the acyl moiety of the substrate. The (2S)-methylbutyryl-SNAC shown as yellow sticks was modeled into the cavity by program Coot. (c) The surface representation of residues forming the cavity that accommodates the acyl moiety of (2S)-methylbutyryl-SNAC.

Figure 4. Comparisons of residues involved in enzyme−substrate recognition by sequence alignment. The alignment was numbered according to AveAT0. The residues directly contact the acyl moiety of the substrate are labeled by “*”. The conserved HFAH or YASH motifs and arginine residue were underlined. D

DOI: 10.1021/cb500873k ACS Chem. Biol. XXXX, XXX, XXX−XXX

Articles

ACS Chemical Biology interactions between these residues and the acyl moiety are the major contributors to the enzyme−substrate recognition, in agreement with the relaxed specificity of Ave-type loading ATs since the hydrophobic interactions are less discriminatory compared to the electrostatic and hydrogen bond interactions that require specific arrangements of functional groups within a substrate.29 A sequence alignment was performed by ClustalX to compare the 13 residues of loading ATs (Figure 4). These substrate-recognition residues of AVE-type loading ATs are less conserved compared to the KSQ-type loading ATs, consistent with the fact that monocarboxylic acids with diverse acyl moieties are recruited. The majority of KSQ-type loading ATs recruit malonyl or methylmalonyl as the starter unit. The active site contains an arginine at the end of the substrate binding pocket (position 145, AveAT0 numbering) to stabilize the carboxylate group and a conserved “HAFH” or “YASH” motif (positions 224−227) to mediate the binding of malonyl or methylmalonyl, respectively, as observed in extension ATs.26 The ionic interaction of the arginine side chain with the dicarboxylic acid thioester imposes a strong spatial constraint on the binding of the substrate and accounts for the strict specificity of the KSQ-type loading ATs. The BorAT0 (loading AT of borrelidin PKS) contains a conserved arginine and accepts trans1,2-cyclopentanedicarboxylic acid as the starter unit that is extended without in situ decarboxylation.16 As a result, the KSQ of borrelidin loading module has degenerated due to the absence of selective pressure and performs no catalytic function. Besides, the BorAT0 has a Thr224 and a Gly226 to lower the sterical hindrance of the substrate binding pocket. The Val222 has been proposed to constrain the size of the malonate side chain and the V222A mutation of EryAT6 enables the incorporation of 2-propargylmalonyl, an extender with a bulky side chain.30 Indeed, the loading AT of apoptolidin PKS (ApoAT0) that recruits methoxymalonate has an alanine residue at this position.31 Hydrolytic Activity. The hydrolytic activity toward incorrect acyl-CoA thioesters has been proposed to control the specificity of an AT domain.28 However, kinetic assays of EryAT3 toward methylmalonyl-CoA and malonyl-CoA reveal the specificity (as reflected by kcat/Km) for the cognate substrate is 200-fold higher in the hydrolysis and 30-fold higher in the transacylation, suggesting that the hydrolytic rate actually reflects the substrate specificity of an AT.25,27 The formation of the acyl-enzyme intermediate instead of the selective hydrolytic cleavage of incorrectly acylated protein is likely the most important step in the substrate discrimination of ATs from modular PKSs. The acyl-SNAC thioesters can be incorporated into polyketides efficiently by modular PKSs.32 We therefore sought to evaluate the ability of AveAT0 to hydrolyze a panel of seven synthetic acyl-SNAC thioesters by monitoring the free SH of the released SNAC with Ellman’s reagent, which has been used for spectrophotometric measurement of the SH groups in a protein.33 A series of control reactions were carried out in parallel to ensure that the hydrolysis of acyl-SNAC was due to enzymatic activity of AveAT0. The steady-state kinetic parameter for each substrate is listed in Table 2. The catalytic efficiency of the hydrolysis reaction of AveAT0 for 2methylbutyryl-SNAC (kcat/Km = 29.6 ± 3.8 mM−1 min−1) was about 30 times lower than that of EryAT3 for methylmalonyl-CoA.25 AveAT0 showed the highest rate of hydrolysis with 2-methylbutyryl-SNAC and isobutyryl-SNAC. The specificity for 2-methylbutyryl-SNAC, as measured by kcat/ Km, was approximately 3-fold over isobutyryl-SNAC (kcat/Km =

Table 2. Kinetic Analysis of the Hydrolytic Reaction Catalyzed by AveAT0 in the Absence of ACP Acceptor enzyme

SNAC thioesters

AveAT0

2methylbutyryla isobutyryl acetyl 3-methylbutyryl pentanoyl butyryl propionyl 2-methylbutyryl isobutyryl acetyl 3-methylbutyryl pentanoyl butyryl propionyl 2-methylbutyryl isobutyryl acetyl 3-methylbutyryl pentanoyl butyryl propionyl

V222L

V222A

a

kcat/Km (mM−1 min−1)

Kcat (min−1)

Km (mM)

29.6 ± 3.8

14.8 ± 0.7

0.5 ± 0.06

10.4 ± 4.5 6.0 ± 3.2 6.0 ± 3.0 4.1 ± 1.1 2.2 ± 0.8 1.3 ± 0.4 1.1 ± 0.6 0.5 ± 0.4 0.1 ± 0.01 1.7 ± 0.3 4.8 ± 0.8 2.3 ± 1.1 0.2 ± 0.2 2.6 ± 0.3 1.5 ± 0.7 0.1 ± 0.01 0.03 ± 0.01 1.8 ± 0.2 0.8 ± 0.5 0.3 ± 0.2

5.2 ± 0.9 1.2 ± 0.2 0.6 ± 0.07 3.3 ± 0.4 2.6 ± 0.4 1.0 ± 0.1 5.1 ± 1.9 1.0 ± 0.4 N.D.b 1.0 ± 0.09 6.3 ± 0.4 11.2 ± 3.2 2.1 ± 0.8 6.7 ± 0.4 2.6 ± 0.6 N.D. N.D. 2.1 ± 0.1 0.6 ± 0.1 0.6 ± 0.2

0.5 ± 0.2 ± 0.1 ± 0.8 ± 1.2 ± 0.8 ± 4.6 ± 2.0 ± N.D. 0.6 ± 1.3 ± 4.9 ± 8.6 ± 2.6 ± 1.7 ± N.D. N.D. 1.2 ± 0.8 ± 2.4 ±

0.2 0.1 0.05 0.2 0.4 0.2 2.3 1.4 0.1 0.2 1.9 4.4 0.2 0.7

0.1 0.4 1.5

Racemic mixture was used in assays. bN.D., not determined.

10.4 ± 4.5 mM−1 min−1), which correlated well with the avermectin biosynthesis in S. avermitilis (Zhuo et al., 2014).4 The noncognate acyl-SNACs could be hydrolyzed by AveAT0 as expected, although the efficiency (kcat/Km) was 5−25 fold lower. To get further insights into the specificity of AveAT0, two residues (Val222 and Ala226) whose involvement in substrate binding had been revealed by structural analysis were examined by site-directed mutagenesis. The A226L mutant was almost completely inactive (data not shown), probably due to the bulky side chain of leucine hindering the binding of all tested substrates, while the V222A mutation moderately compromised the activity. Interestingly, the V222L mutation that significantly decreased catalytic efficiency for the native substrate slightly increased the catalytic efficiency for nonnative pentanoyl-SNAC and butyryl-SNAC, suggesting a single mutation potentially shifted the specificity of AveAT0. Stereospecificity of AveAT0. During the biosynthesis of avermectins, the 2-methylbutyryl-CoA starter unit produced by the degradation of branched-chain amino acid isoleucine has an S configuration at C-2 position.4 The active site architecture also suggests the stereospecificity AveAT0 for the (2S)methylbutyryl thioester. Since the two isomers of 2methylbutyric acid can be readily resolved by capillary gas chromatography (GC) and detected by mass spectrum (MS) (Supporting Information Figure 2), we sought to determine the in vitro stereospecificity of AveAT0 toward the racemic (2RS)methylbutyryl-SNAC thioesters.34 In a reaction catalyzed by AveAT0, 7 times more (2S)-methylbutyric acid was observed than the R isomer, which was obviously from the spontaneous hydrolysis of the substrate by comparing to a control reaction without enzyme (Figure 5). The stereospecificity of AveAT0 for (2S)-methylbutyryl-SNAC was further confirmed by its incapability to hydrolyze the optical pure (2R)-methylbutyrylSNAC (data not shown). E

DOI: 10.1021/cb500873k ACS Chem. Biol. XXXX, XXX, XXX−XXX

Articles

ACS Chemical Biology

hydrolytic activity of the mutants. The shift of the substrate specificity of V222L mutant to pentanoyl was caused by the drastic decrease in catalytic efficiency toward the natural substrate rather than the enhanced catalytic efficiency for the unnatural substrate, as observed in the biochemical assays of EryAT3 mutants (Dunn et al., 2013).25 In addition to pinpoint active residues that are involved in enzyme−substrate recognition, the crystal structures of AT domains can also be used in more global approaches such as molecular dynamics simulations to help the identification of residues outside the substrate binding pockets that may indirectly influence the architecture of active sites and to predict the promiscuity of wild-type enzymes toward unnatural substrates.24,30 In summary, understanding the molecular basis for the substrate specificity of loading ATs is crucial to introduce unnatural starter units into polyketide products by rational engineering of modular PKSs. In this work, we focused on the loading AT of avermectin modular PKS, which was shown to accept a variety of starter units and provide the first structural insights into the substrate specificity of loading ATs. We have examined the substrate preference of isolated AveAT0 toward natural and unnatural substrates, shifted its specificity by single mutation of the active site residues, and confirmed its stereospecificity for an S configuration at C-2 position of the 2-methylbutyryl substrate. The structural and functional studies of loading ATs presented here combined with computational modeling will help the engineering of avermectin modular PKS for the generation of new derivatives with expected starter units and to push the ratio of desired products.

Figure 5. Stereospecificity of AveAT0. (a) AveAT0 stereospeifically catalyzes the hydrolysis of (2S)-methylbutyryl-SNAC. (b) Chiral GCMS of 2-methylbutyric acid produced by incubation of racemic methylbutyryl-SNAC with AveAT0. The (2R)-methylbutyric acid was produced by the spontaneous hydrolysis of the substrate by comparing to the control reaction without enzyme. See also Supporting Information Figure 2.

Engineering of Loading ATs. The intrinsic promiscuity of loading ATs of modular PKSs has been widely utilized to introduce noncognate starter units into the final polyketide products.5,35 Although the relaxed substrate specificity provides the potential to generate novel polyketide derivatives with altered substituents by feeding unnatural carboxylic acids to the producers, it sometimes causes serious problems for the industrial production of polyketide compounds due to the biosynthesis of mixtures of multiple chemical species. For example, the commercially important avermectins are produced as mixtures of “a” series that use the 2-methylbutyryl starter unit and “b” series that use the isobutyryl starter unit (Figure 1).4 A better understanding of the specificity of loading ATs toward different carboxylic acid starter units has the commercial potential to increase the production ratios of the desired polyketides and, consequently, to reduce the cost of the purification process. Compared to the swapping of entire catalytic domains, site directed mutagenesis of the active site residues lining the substrate binding pockets seems to be more reasonable for engineering the specificity of ATs because the catalytic domains remain in their native environments, thus minimizing the deleterious perturbations to the protein−protein interactions introduced by the manipulations.36 According to the recruited starter units, the loading ATs are classified into two types. A conserved arginine in the active site indicates a KSQ-type loading AT that recruits a dicarboxylic acid starter unit while the absence of arginine in the corresponding position suggests an Ave-type loading AT that accepts a monocarboxylic acid starter unit. The shift of specificity from malonyl to acetyl by an arginine to alanine mutation in mammalian FAS inspires the engineering of corresponding residue in loading ATs.37 However, neither the tryptophan to arginine mutation in an Ave-type loading AT (EryAT0) nor the arginine to tryptophan mutation in a KSQ-type AT (oleandomycin loading AT) switches the specificity of the enzymes toward propionate and malonate, suggesting the involvement of other active site resides in the discrimination of starter units.7,10 By docking a substrate mimic into the active site of AveAT0, the residues that may directly contact the 2-methylbutyryl moiety were predicted. The involvement in substrate binding of Val222 and Ala226 residues was confirmed by in vitro assays of the

■

METHODS

Protein Expression and Purification. The AveAT0 domain was amplified from S. avermitilis genomic DNA using primers 5′ATCGTAATCCATATGCAGAGGATGGACGGCGGGGAAGAAC3′ and 5′-TGATTCGATGAATTCAACCATGCCCCCGTAGTTGGGCGAGAGAC-3′ (NdeI-EcoRI sites italicized, the stop codon underlined) and cloned into pET28a. The resulting plasmid was transformed into E. coli BL21(DE3). The transformed cells were grown to an OD600 of 0.4 in LB medium at 37 °C and induced with 0.15 mM IPTG for 12 h at 16 °C. The cells were then harvested by centrifugation at 4000 rpm for 20 min and resuspended with lysis buffer containing 500 mM NaCl, 50 mM Tris (pH 7.5), and 10% glycerol (v/v). The cell suspension was lysed by sonication on ice and centrifuged at 15 000g for 45 min to remove cell debris. The cell-free extract was loaded onto Nickel-NTA resin that had been washed with lysis buffer. The column was washed with lysis buffer containing 10 mM imidazole (pH 7.5). His-tagged AveAT0 was then eluted with lysis buffer containing 300 mM imidazole. The protein was further polished using a Superdex 200 gel filtration column (GE Healthcare) equilibrated with a buffer containing 150 mM NaCl, 10 mM Tris (pH7.5), and 10% (v/v) glycerol. Using protein concentrators, the resulting protein was moved into a buffer containing 25 mM NaCl, 10 mM Tris (pH 7.5), 10% (v/v) glycerol, and 1 mM DTT at a concentration of 12 mg mL−1. Crystallization and Structure Determination. The AveAT0 crystals were grown in sitting drops containing 2 μL protein solution and 2 μL precipitant solution (pH6.75, 3.4 M sodium formate) at 20 °C. Crystals were soaked in crystallization solution containing 20% (v/ v) glycerol before being frozen in liquid nitrogen. Data were collected at Shanghai Synchrotron Radiation Facility Beamline BL17U1 and processed with Mosflm, Pointless, and Scala programs of the CCP4 suite.38 The structure of EryAT5 [PDB code 2HG4] was used as a search model for molecular replacement in Phaser.38 The model was built in Coot, refined through Refmac, and visualized by PyMol.38,39 Size Estimation. A 0.1 mL sample of AveAT0 was injected onto a Superdex 200 gel-filtration column equilibrated with 150 mM NaCl, F

DOI: 10.1021/cb500873k ACS Chem. Biol. XXXX, XXX, XXX−XXX

Articles

ACS Chemical Biology

Aliquots (20 μL) were withdrawn at specific time points and then an equal volume dimethyl sulfoxide (DMSO) was added to quench the reaction. After the addition of 40 μL of 2 mM Ellman’s reagent, the sample was immediately vortexed and incubated for 10 min. All samples were analyzed spectrophotometrically at 412 nm. Kinetic parameters were calculated from the average of at least three sets of triplicates with the Michaelis−Menten equation using the curve fitting software GraphPad Prism. Chiral GC-MS. The above-described hydrolytic reactions of racemic 2-methylbutyryl-SNAC were extracted with equal volume of methyl tert-butyl ether. The organic extract was concentrated in vacuo and the residue was dissolved in 100 μL of methanol. Chiral GC-MS analyses were carried out isothermally at 100 °C (55 cm/s) on a GCMS system consisting of Thermo Trace 1300 gas chromatograph and ISQ single-quadrupole mass spectrometer, using a 30 m × 0.25 mm inner diameter, 0.25 μm film-thickness β-DEX 120 capillary column (Supelco) in the split mode (20:1) with helium as carrier.

10 mM Tris (pH 7.5), and 10% (v/v) glycerol. The molecular weight of AveAT0 was estimated through a comparison to standards as previously described.40 Mutation of AveAT0. Generation of the mutants was accomplished using the GeneTailor Site-Directed Mutagenesis System (Invitrogen) following the manufacturer’s instructions. The oligonucleotides used for mutagenesis were as follows: V222L:5′-GCATGATCCCGCTGGACGTTCCCGCCCACTCCCCCCTGATGTACGCCA-3′and 5′-CGGGAACGTCCAGCGGGATCATGCGCGTGCGCACCTGCGCGGCGGTGA-3′; V222A: 5′GCATGATCCCGGCCGACGTTCCCGCCCACTCCCCCCTGATGTACGCCA-3′ and 5′-CGGGAACGTCGGCCGGGATCATGCGCGTGCGCACCTGCGCGGCGGTGA-3′; and A226L:5′-TGTGGACGTTCCCCTGCACTCCCCCCTGATGTACGCCATCGAGGAACGGGT-3′ and 5′-TCAGGGGGGAGTGCAGGGGAACGTCCACCGGGATCATGCGCGTGCGCACCT-3′. All mutants were verified by DNA sequencing. Syntheses of acyl-SNACs. The synthesis of SNAC has been described previously.41 All acyl-SNAC thioesters used for functional assays were synthesized by similar protocols. Briefly, to the stirred solution of a monocarboxylic acid (0.84 mmol, 1.0 equiv) in 10 mL THF at room temperature (RT) was added DCC (174 mg, 0.84 mmol, 1.0 equiv), HOBt (114 mg, 0.84 mmol, 1.0 equiv), and SNAC (0.1 g, 0.84 mmol, 1.1eq ). After 45 min, K2CO3 (58 mg, 0.42 mmol, 0.5 equiv) was added. The reaction was filtered and concentrated after another 3 h. The residue was redissolved in ethyl acetate and washed with sat. aqueous NaHCO3. The organic layer was dried over sodium sulfate and concentrated. The crude material was chromatographed on silica gel eluting with 1:5 petroleum ether/ethyl acetate to yield the desired compound as a clear solid. (2RS)-Methylbutyryl-SNAC. 1H NMR (CDCl3, 600 MHz): δ (ppm) 6.51 (s, 1H), 3.42 (q, J = 6.3 Hz, 2H), 2.99 (t, J = 6.5 Hz, 2H), 2.59 (q, J = 6.9 Hz, 1H), 1.98 (s, 3H), 1.75−1.70 (m, 1H), 1.51−1.46 (m, 1H), 1.17 (d, J = 7.0 Hz, 3H), 0.92 (t, J = 7.4 Hz, 3H). ESI-MS [M + Na]+, 226.1. 2-Methylpropionyl-SNAC. 1H NMR (CDCl3, 600 MHz): δ (ppm) 6.09 (s, 1H), 3.43 (q, J = 6.2 Hz, 2H), 3.01 (t, J = 6.5 Hz, 2H), 2.79− 2.74 (m, 1H), 1.97(s, 3H), 1.19 (d, J = 6.9 Hz, 6H). ESI-MS [M + Na]+, 212.1. Acetyl-SNAC. 1H NMR (CDCl3, 600 MHz): δ (ppm) 6.29 (s, 1H), 3.43 (t, J = 6.1 Hz, 2H), 3.04 (t, J = 6.1 Hz, 2H), 2.36 (d, J = 5.0 Hz, 3H), 1.99 (s, 3H). ESI-MS [M + Na]+, 184.0. Propionyl-SNAC. 1H NMR (CDCl3, 600 MHz): δ (ppm) 6.14 (s, 1H), 3.39 (m, 2H), 2.99 (t, J = 6.6 Hz, 2H), 2.56 (m, 2H), 1.94 (s, 3H), 1.15 (t, J = 7.5 Hz, 3H). ESI-MS [M + Na]+, 198.1. 3-Methylbutyryl-SNAC. 1H NMR (CDCl3, 600 MHz): δ (ppm) 6.41 (s, 1H), 3.42 (q, J = 6.2 Hz, 2H), 3.03 (t, J = 6.6 Hz, 2H), 2.45 (d, J = 7.1 Hz, 2H), 1.97 (s, 3H), 2.18−2.13 (m, 1H), 0.96 (t, J = 6.7 Hz, 6H). ESI-MS [M + Na]+, 226.1. Butyryl-SNAC. 1H NMR (CDCl3, 600 MHz): δ (ppm) 6.40 (s, 1H), 3.42 (q, J = 6.3 Hz, 2H), 3.03 (t, J = 6.6 Hz, 2H), 2.56 (t, J = 7.4 Hz, 2H), 1.97 (s, 3H), 1.69 (q, J = 7.4 Hz, 2H), 0.96 (t, J = 7.4 Hz, 3H). ESI-MS [M + Na]+, 212.1. Pentanoyl-SNAC. 1H NMR (CDCl3, 600 MHz): δ (ppm) 6.75 (s, 1H), 3.42 (q, J = 6.3 Hz, 2H), 3.02 (t, J = 6.7 Hz, 2H), 2.57 (t, J = 7.6 Hz, 2H), 1.98 (s, 3H), 1.64 (t, J = 7.6 Hz, 2H), 1.35 (t, J = 7.5 Hz, 2H), 0.91 (t, J = 7.4 Hz, 3H). ESI-MS [M + Na]+, 226.1. (2R)-Methylbutyryl-SNAC. 1H NMR (CDCl3, 600 MHz): δ (ppm) 6.29 (s, 1H), 3.43 (q, J = 6.2 Hz, 2H), 3.02 (t, J = 6.5 Hz, 2H), 2.59 (q, J = 6.9 Hz, 1H), 1.97 (s, 3H), 1.75−1.70 (m, 1H), 1.50−1.45 (m, 1H), 1.17 (d, J = 6.9 Hz, 3H), 0.91 (t, J = 7.5 Hz, 3H); ESI-MS [M + Na]+, 226.1. Kinetic Analysis of Hydolytic Activity. The Ellman’s reagent DTNB was used to monitor the free SH of the released SNAC (Riener et al., 2002).33 A series of control reactions were conducted in parallel to eliminate the absorbance caused by two cysteine residues in the enzyme, the spontaneous hydrolysis of the substrates, and the reagents. All reactions were carried out at 25 °C in the presence of 25 mM NaCl, 10 mM Tris (pH 7.5), 10% (v/v) glycerol, varying concentration (0−4 mM) of acyl-SNAC and 5−10 μM of enzymes.

■

ASSOCIATED CONTENT

S Supporting Information *

This material is available free of charge via the Internet at http://pubs.acs.org. Accession Codes

The final structure is deposited in the PDB with accession code 4RL1.

■

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected]. *E-mail: [email protected]. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS The authors acknowledge the Analytical Instrumentation Center of Institute of Process Engineering, Chinese Academy of Sciences. The diffraction data were collected at the Shanghai Synchrotron Radiation Facility (SSRF, China) Beamline BL17U1. This work was supported in part by the National Program on Key Basic Research Project (973 program, 2013CB734000), National Natural Science Foundation of China (31370101, 31400051), Beijing Natural Science Foundation (5144031), the Recruitment Program of Global Experts of China, and the starting fund of the Chinese Academy of Sciences. L.Z. is an Awardee for National Distinguished Young Scholar Program in China.

■

REFERENCES

(1) Khosla, C., Herschlag, D., Cane, D. E., and Walsh, C. T. (2014) Assembly line polyketide synthases: Mechanistic insights and unsolved problems. Biochemistry 53, 2875−2883. (2) Xu, W., Qiao, K., and Tang, Y. (2013) Structural analysis of protein−protein interactions in type I polyketide synthases. Crit. Rev. Biochem. Mol. Biol. 48, 98−122. (3) Dutta, S., Whicher, J. R., Hansen, D. A., Hale, W. A., Chemler, J. A., Congdon, G. R., Narayan, A. R., Hakansson, K., Sherman, D. H., Smith, J. L., and Skiniotis, G. (2014) Structure of a modular polyketide synthase. Nature 510, 512−517. (4) Zhuo, Y., Zhang, T., Wang, Q., Cruz-Morales, P., Zhang, B., Liu, M., Barona-Gomez, F., and Zhang, L. (2014) Synthetic biology of avermectin for production improvement and structure diversification. Biotechnol. J. 9, 316−325. (5) Dutton, C. J., Gibson, S. P., Goudie, A. C., Holdom, K. S., Pacey, M. S., Ruddock, J. C., Bu’Lock, J. D., and Richards, M. K. (1991)

G

DOI: 10.1021/cb500873k ACS Chem. Biol. XXXX, XXX, XXX−XXX

Articles

ACS Chemical Biology Novel avermectins produced by mutational biosynthesis. J. Antibiot. (Tokyo) 44, 357−365. (6) Marsden, A. F. A., Wilkinson, B., Cortes, J., Dunster, N. J., Staunton, J., and Leadlay, P. F. (1998) Engineering broader specificity into an antibiotic-producing polyketide synthase. Science 279, 199− 202. (7) Lau, J., Cane, D. E., and Khosla, C. (2000) Substrate specificity of the loading didomain of the erythromycin polyketide synthase. Biochemistry 39, 10514−10520. (8) Yuzawa, S., Eng, C. H., Katz, L., and Keasling, J. D. (2013) Broad substrate specificity of the loading didomain of the lipomycin polyketide synthase. Biochemistry 52, 3791−3793. (9) Bisang, C., Long, P. F., Cortes, J., Westcott, J., Crosby, J., Matharu, A. L., Cox, R. J., Simpson, T. J., Staunton, J., and Leadlay, P. F. (1999) A chain initiation factor common to both modular and aromatic polyketide synthases. Nature 401, 502−505. (10) Long, P. F., Wilkinson, C. J., Bisang, C. P., Cortes, J., Dunster, N., Oliynyk, M., McCormick, E., McArthur, H., Mendez, C., Salas, J. A., Staunton, J., and Leadlay, P. F. (2002) Engineering specificity of starter unit selection by the erythromycin-producing polyketide synthase. Mol. Microbiol. 43, 1215−1225. (11) Oefner, C., Schulz, H., D’Arcy, A., and Dale, G. E. (2006) Mapping the active site of Escherichia coli malonyl-CoA-acyl carrier protein transacylase (FabD) by protein crystallography. Acta Crystallogr., Sect. D: Biol. Crystallogr. 62, 613−618. (12) Tang, Y., Chen, A. Y., Kim, C. Y., Cane, D. E., and Khosla, C. (2007) Structural and mechanistic analysis of protein interactions in module 3 of the 6-deoxyerythronolide B synthase. Chem. Biol. 14, 931−943. (13) Tang, Y., Kim, C. Y., Mathews, II, Cane, D. E., and Khosla, C. (2006) The 2.7-Å crystal structure of a 194-kDa homodimeric fragment of the 6-deoxyerythronolide B synthase. Proc. Natl. Acad. Sci. U.S.A. 103, 11124−11129. (14) Chen, A. Y., Cane, D. E., and Khosla, C. (2007) Structure-based dissociation of a type I polyketide synthase module. Chem. Biol. 14, 784−792. (15) Castonguay, R., He, W., Chen, A. Y., Khosla, C., and Cane, D. E. (2007) Stereospecificity of ketoreductase domains of the 6deoxyerythronolide B synthase. J. Am. Chem. Soc. 129, 13758−13769. (16) Hagen, A., Poust, S., de Rond, T., Yuzawa, S., Katz, L., Adams, P. D., Petzold, C. J., and Keasling, J. D. (2014) In vitro analysis of carboxyacyl substrate tolerance in the loading and first extension modules of Borrelidin PKS. Biochemistry 53, 5975−5977. (17) Bergeret, F., Gavalda, S., Chalut, C., Malaga, W., Quemard, A., Pedelacq, J. D., Daffe, M., Guilhot, C., Mourey, L., and Bon, C. (2012) Biochemical and structural study of the atypical acyltransferase domain from the mycobacterial polyketide synthase Pks13. J. Biol. Chem. 287, 33675−33690. (18) Keatinge-Clay, A. T., Shelat, A. A., Savage, D. F., Tsai, S. C., Miercke, L. J., O’Connell, J. D., Khosla, C., and Stroud, R. M. (2003) Catalysis, specificity, and ACP docking site of Streptomyces coelicolor malonyl-CoA:ACP transacylase. Structure 11, 147−154. (19) Liew, C. W., Nilsson, M., Chen, M. W., Sun, H., Cornvik, T., Liang, Z. X., and Lescar, J. (2012) Crystal structure of the acyltransferase domain of the iterative polyketide synthase in enediyne biosynthesis. J. Biol. Chem. 287, 23203−23215. (20) Maier, T., Leibundgut, M., and Ban, N. (2008) The crystal structure of a mammalian fatty acid synthase. Science 321, 1315−1322. (21) Wong, F. T., Jin, X., Mathews, II, Cane, D. E., and Khosla, C. (2011) Structure and mechanism of the trans-acting acyltransferase from the disorazole synthase. Biochemistry 50, 6539−6548. (22) Whicher, J. R., Smaga, S. S., Hansen, D. A., Brown, W. C., Gerwick, W. H., Sherman, D. H., and Smith, J. L. (2013) Cyanobacterial polyketide synthase docking domains: A tool for engineering natural product biosynthesis. Chem. Biol. 20, 1340−1351. (23) Liang, J., Edelsbrunner, H., and Woodward, C. (1998) Anatomy of protein pockets and cavities: measurement of binding site geometry and implications for ligand design. Protein Sci. 7, 1884−1897.

(24) Bravo-Rodriguez, K., Ismail-Ali, A. F., Klopries, S., Kushnir, S., Ismail, S., Fansa, E. K., Wittinghofer, A., Schulz, F., and SanchezGarcia, E. (2014) Predicted incorporation of non-native substrates by a polyketide synthase yields bioactive natural product derivatives. ChemBioChem 15, 1991−1997. (25) Dunn, B. J., Cane, D. E., and Khosla, C. (2013) Mechanism and specificity of an acyltransferase domain from a modular polyketide synthase. Biochemistry 52, 1839−1841. (26) Dunn, B. J., and Khosla, C. (2013) Engineering the acyltransferase substrate specificity of assembly line polyketide synthases. J. R. Soc. Interface 10, 20130297. (27) Dunn, B. J., Watts, K. R., Robbins, T., Cane, D. E., and Khosla, C. (2014) Comparative analysis of the substrate specificity of transversus cis-acyltransferases of assembly line polyketide synthases. Biochemistry 53, 3796−3806. (28) Bonnett, S. A., Rath, C. M., Shareef, A. R., Joels, J. R., Chemler, J. A., Hakansson, K., Reynolds, K., and Sherman, D. H. (2011) AcylCoA subunit selectivity in the pikromycin polyketide synthase PikAIV: Steady-state kinetics and active-site occupancy analysis by FTICR-MS. Chem. Biol. 18, 1075−1081. (29) Babtie, A., Tokuriki, N., and Hollfelder, F. (2010) What makes an enzyme promiscuous? Curr. Opin. Chem. Biol. 14, 200−207. (30) Sundermann, U., Bravo-Rodriguez, K., Klopries, S., Kushnir, S., Gomez, H., Sanchez-Garcia, E., and Schulz, F. (2012) Enzymedirected mutasynthesis: A combined experimental and theoretical approach to substrate recognition of a polyketide synthase. ACS Chem. Biol. 8, 443−450. (31) Du, Y., Derewacz, D. K., Deguire, S. M., Teske, J., Ravel, J., Sulikowski, G. A., and Bachmann, B. O. (2011) Biosynthesis of the apoptolidins in Nocardiopsis sp. FU 40. Tetrahedron 67, 6568−6575. (32) Klopries, S., Sundermann, U., and Schulz, F. (2013) Quantification of N-acetylcysteamine activated methylmalonate incorporation into polyketide biosynthesis. Beilstein J. Org. Chem. 9, 664−674. (33) Riener, C. K., Kada, G., and Gruber, H. J. (2002) Quick measurement of protein sulfhydryls with Ellman’s reagent and with 4,4′-dithiodipyridine. Anal. Bioanal. Chem. 373, 266−276. (34) Zhang, A., Amalin, D., Shirali, S., Serrano, M. S., Franqui, R. A., Oliver, J. E., Klun, J. A., Aldrich, J. R., Meyerdirk, D. E., and Lapointe, S. L. (2004) Sex pheromone of the pink hibiscus mealybug, Maconellicoccus hirsutus, contains an unusual cyclobutanoid monoterpene. Proc. Natl. Acad. Sci. U.S.A. 101, 9601−9606. (35) Moss, S. J., Carletti, I., Olano, C., Sheridan, R. M., Ward, M., Math, V., Nur, E. A. M., Brana, A. F., Zhang, M. Q., Leadlay, P. F., Mendez, C., Salas, J. A., and Wilkinson, B. (2006) Biosynthesis of the angiogenesis inhibitor borrelidin: Directed biosynthesis of novel analogues. Chem. Commun. (Camb), 2341−2343. (36) Kushnir, S., Sundermann, U., Yahiaoui, S., Brockmeyer, A., Janning, P., and Schulz, F. (2012) Minimally invasive mutagenesis gives rise to a biosynthetic polyketide library. Angew. Chem., Int. Ed. Engl. 51, 10664−10669. (37) Rangan, V. S., and Smith, S. (1997) Alteration of the substrate specificity of the malonyl-CoA/acetyl-CoA:acyl carrier protein Sacyltransferase domain of the multifunctional fatty acid synthase by mutation of a single arginine residue. J. Biol. Chem. 272, 11975−11978. (38) Potterton, E., Briggs, P., Turkenburg, M., and Dodson, E. (2003) A graphical user interface to the CCP4 program suite. Acta Crystallogr., Sect. D: Biol. Crystallogr. 59, 1131−1137. (39) Emsley, P., and Cowtan, K. (2004) Coot: Model-building tools for molecular graphics. Acta Crystallogr., Sect. D: Biol. Crystallogr. 60, 2126−2132. (40) Zheng, J., Taylor, C. A., Piasecki, S. K., and Keatinge-Clay, A. T. (2010) Structural and functional analysis of A-type ketoreductases from the amphotericin modular polyketide synthase. Structure 18, 913−922. (41) Piasecki, S. K., Taylor, C. A., Detelich, J. F., Liu, J., Zheng, J., Komsoukaniants, A., Siegel, D. R., and Keatinge-Clay, A. T. (2011) Employing modular polyketide synthase ketoreductases as biocatalysts H

DOI: 10.1021/cb500873k ACS Chem. Biol. XXXX, XXX, XXX−XXX

Articles

ACS Chemical Biology in the preparative chemoenzymatic syntheses of diketide chiral building blocks. Chem. Biol. 18, 1331−1340.

I

DOI: 10.1021/cb500873k ACS Chem. Biol. XXXX, XXX, XXX−XXX