Structural Features of DNA G-Quadruplexes Revealed by Surface

Subscriber access provided by University of Winnipeg Library

Biophysical Chemistry, Biomolecules, and Biomaterials; Surfactants and Membranes

Structural Features of DNA G-Quadruplexes Revealed by Surface-Enhanced Raman Spectroscopy Yang Li, Xiaoxia Han, Shan Zhou, Yuting Yan, Xiaoxuan Xiang, Bing Zhao, and Xinhua Guo J. Phys. Chem. Lett., Just Accepted Manuscript • DOI: 10.1021/acs.jpclett.8b01353 • Publication Date (Web): 31 May 2018 Downloaded from http://pubs.acs.org on May 31, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

The Journal of Physical Chemistry Letters

Structural Features of DNA G-quadruplexes Revealed by Surface-Enhanced Raman Spectroscopy Yang Li,a Xiaoxia Han,*a Shan Zhou,c Yuting Yan,a Xiaoxuan Xiang,a Bing Zhaoa and Xinhua Guo*a,b. a

State Key Laboratory of Supramolecular Structure and Materials, College of Chemistry, Jilin

University, 2699 Qianjin Street, Changchun 130012, P. R. China. b

Key Laboratory for Molecular Enzymology and Engineering of the Ministry of Education,

College of Life Science, Jilin University, Changchun 130012, P.R. China c

School of Future Technology, University of Chinese Academy of Sciences, Beijing 100000,

P.R. China. Corresponding Author * Dr. Xinhua Guo. Tel: 86-431-89228949; Fax: 86-431-89228949; E-mail: [email protected] * Dr. Xiaoxia Han. Tel: +86-431-85168473; Fax: +86-431-85193421; E-mail: [email protected]

ACS Paragon Plus Environment

1

The Journal of Physical Chemistry Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 20

ABSTRACT Surface-enhanced Raman spectroscopy (SERS) has been successfully used for the label-free detection of single-stranded oligonucleotides. However, the detection of complex DNA secondary structures remains a challenge. In this paper, structural features of diverse DNA Gquadruplexes were investigated via a novel SERS method. As a result, a series of highly reproducible and sensitive SERS signatures featuring the structures of G-quadruplexes were obtained. For the first time, we reported remarkably enhanced SERS bands corresponding to purine ring breathing vibrations. Moreover, we observed that, by measuring the intensity of the bands corresponding to intramolecular hydrogen bonds, we could quantitatively assess the stability of the G-quadruplexes. Since no labels on DNA strands were present as the experiments were carried out in the solution, the fingerprint peaks reflect the native, internal structure of the G-quadruplexes accurately. The method here detailed provides new insights into the promising applications of diverse DNA structural studies.


2

Page 3 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Nucleic acids, as important biomolecules, exhibit numerous structural diversities in addition to the Watson-Crick double helixes.1 One of the secondary structures is the G-quadruplex (Gq), which is formed by guanine-rich oligonucleotides (GROs). In general, the G-quadruplex consists of at least two G-quartets stacking on each other; each of them contains four guanine bases cyclically linked through Hoogsteen hydrogen bonds (Figure 1a). Each guanine base functions as both donor and receptor of hydrogen bonds in a G-quartet (e.g., N1H to O6 and N2H to N7) and adopts either syn or anti glycosidic bond angle (GBA) (Figure 1b). The monovalent cations, such as Na+, NH4+, or K+, are located between G-quartets, reducing the repulsions of O6 atoms and stabilizing the structure of G-quadruplexes.2 The G-quadruplex can be formed by a single strand folding or double-stranded and four-stranded associations. Three types of loops can connect G tracks in a folded G-quadruplex: a lateral loop, a diagonal loop, and a double-chain reversed loop (Figure 1c). The G-quadruplex with all strands arranged in the same 5'-3' orientation is defined as the parallel structure, whereas an antiparallel G-quadruplex is characterized by at least one strand arranged in the opposite direction to the others. Static studies revealed that there are 376000 GROs in the human genome that could potentially form G-quadruplexes;3 some of them are located in the telomere and promoter regions and show close correlations with cell immortalization and cancer diseases. 2, 4 However, the biological conformations and functions of the most potential G-quadruplex forming sequences are still unknown; so far, only a limited number of NMR and crystal structures of G-quadruplexes has been obtained.2 NMR and X-ray diffraction (XRD) are two main techniques used for atomic-level analysis of DNA structures.2-6 Unfortunately, NMR measurements usually require a large number of relatively pure samples, whereas XRD method


3


Page 4 of 20

Figure 1. (a) The G-quartet formed by cyclic guanine bases linked by Hoogsteen hydrogen bonds(the numbers in the figure are the Raman band frequencies corresponding to the hydrogen bonds and the ring breathing vibration in the G-quartet); (b) the conformation of anti and syn GBAs in dG C2'-endo; (c) the five different kinds of DNA G-quadruplexes studied in this work (listed from left to right); [d(TGnT)]4: the tetramolecular structures formed by the sequences d(TGnT) (n = 3-7) with all strands arranged in the same 5'-3' direction and all GBAs adopted in the anti-configuration; d(G3T)4 K: a parallel monomolecular structure with three double-chain reversed loops and all GBAs adopted in anti-configuration; Tel21 Na: an antiparallel monomolecular structure with alternate GBAs, two lateral loops, and a diagonal loop; 93del K: a parallel intercalated bimolecular structure with alternate GBAs and double-chain reversed loops; Oxy1.5 K: an antiparallel bimolecular structure with alternate GBA and two diagonal loops. In each structure, the grey squares represent anti GBA, whereas the white squares indicate syn GBA; the green ball represents the thymine residue, while the red ball represents adenine residues.


4

Page 5 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


needs fine crystals before the structural determination, which widely restricts the applications of the two techniques. Other techniques, such as circular dichroism spectroscopy (CD), fluorescence, ultraviolet spectrometry (UV), and mass spectrometry (MS), have been also used to obtain structural information including chain orientation, base stacking, stability, and stoichiometry, rather than structural details. 7-13 Raman spectroscopy provides vibrational information of the studied molecules and demonstrates the possibility to perform for structural studies of nucleic acids. In 1967, Lord and Thomas first reported the Raman spectra of purine, pyrimidine, nucleosides, 5'-mononucleotides, and related alkyl derivatives in aqueous solution, showing the potentials of the Raman signatures for further studies on the interaction between biomolecules.14 After that, additional characteristic Raman peaks of nucleic acid with different conformations were found.15-21 For example, Benevides et al. reported the characteristic Raman spectra associated with the N3 protonation of cytosine, which manifested the formation of C•C+ base pairs and four-stranded cytosine structure (i-motif) formed by intercalated C•C+ base pairs from two parallel strands arranged in an antiparallel direction.16 Deng et al. explored the effects of G•C base pairs content on B-DNA and described the characteristic Raman bands of B-DNA.17 Recently, Friedman et al. found that the bands in the 840–930 cm-1 and 1420–1460 cm-1 ranges could be associated with the deoxyribose backbone, whereas a band closed to 930 cm-1 corresponded to the highly polarized deoxyribosering symmetric stretching, which only appeared in the anti-parallel G-quadruplexes. They demonstrated the presence of a more ordered base stacking in the structure of G-quadruplexes than that in a double helix.18 Palacky et al. employed Raman to observe the polymorphism of Gquadruplexes varying with the change of DNA concentrations.19 Although the feasibility of


5


Page 6 of 20

Raman spectroscopy to detect the structures of nucleic acid has been proved, the inherently low sensitivity hampered the further application of Raman spectroscopy in the studies of nucleic acid. The development of surface-enhanced Raman spectroscopy (SERS) has considerably improved the detection ability of Raman spectroscopy, by increasing the signal intensity and sensitivity, remarkably. 22-35 However, to date, SERS-based methods are mainly applied for the detection of single-base mutation and sequence changes in single-stranded nucleic acids.25-31 Only a few SERS spectra related to DNA secondary conformations were reported,

31-35

since the direct

contact of structural DNA with the surface of substrates to produce featured SERS signals is hard to be maintained. Previously, Au nanoparticles were used to promote the contact between thiolmodified DNA strands and the surface of the substrates; in this case, thiol-modified DNA double helixes were detected.31 After that, the label-free detection of DNA duplexes was achieved using positively charged silver colloids.32 Recently, Rusciano et al. reported SERS signatures of Gquadruplexes, such as glycosidic bond angles, degree of hydrogen bonds, and thermal stability, by employing silver nanoparticles (Ag NPs) as a SERS-active substrate and via a home-made Raman spectrometer. In that case, average bands were used as the signal reproducibility was unsatisfactory.35 It is worthy to mention that the introduction of MgSO4 into silver nanoparticle promoted the aggregations of the nanoparticles for the detection of SERS signals of single strand (ss) DNA and double helixes.27-28 Xu et al. placed iodide ions into the silver colloids before adding magnesium ions (Ag IMNPs); the iodide ions acted as a “cleaning agent” and cleaned the surface of substrates effectively, increasing the signal-to-noise ratio and enabling the quantitative detection of the base contents in the (ss) DNA.30 However, none of these methods are capable of detecting G-quadruplexes with a more complex secondary structure. Inspired by the works mentioned above, we used Al3+ instead of Mg2+ to aggregate iodide-modified Ag nanoparticles


6

Page 7 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(Ag IANPs) for detection of the DNA i-motifs.33 The addition of aluminum ions not only neutralized the negative charges of the DNA phosphate backbones, but also allowed better aggregation of the iodide ions-modified silver nanoparticles through electrostatic interactions. Our results showed that these Ag IANPs lead DNA i-motifs to reside in a suitable environment and produce “hot spots” of sensitive SERS signals. In the present work, nine G-rich DNA sequences (Table 1), which can form monomolecular, bimolecular, or tetramolecular G-quadruplexes, were selected for investigating SERS structural signatures of G-quadruplexes by employing Ag IANPs as active-substrates. The particular NMR structures formed by each sequence in the presence of monovalent cation Na+, NH4+, or K+ have been reported (Figure 1c): 19-20, 36-42 these structures are characterized by the layers of G-quartets, GBA conformations, and loop shapes they have adopted. Briefly, [d(TGnT)]4s are parallel tetramolecular structures formed by the sequence d(TGnT) with (n = 3-7), all strands arranged in the same 5'-3' direction, and all GBAs in the anti-configuration, whereas d(G3T)4 K is a parallel monomolecular structure with three double-chain reversed loops and all GBAs in anticonfiguration. Tel21 Na is an antiparallel monomolecular structure, which has alternate GBAs, two lateral loops, and a diagonal loop, while 93del K is a parallel intercalated bimolecular structure with alternate GBAs and double-chain reversed loops. Finally, Oxy1.5 K is an antiparallel bimolecular structure, which has alternate GBAs and two diagonal loops. By studying these G-quadruplexes, we identified the fingerprint SERS bands corresponding to the detailed conformation of G-quadruplexes to build a new platform for secondary DNA structural studies.


7


Page 8 of 20

Table 1．．Sequences of the single-stranded DNA studied. Name Sequence (5'-3') TG3T TGGGT TG4T TGGGGT TG5T TGGGGGT TG6T TGGGGGGT TG7T TGGGGGGGT Tel21 GGGTTAGGGTTAGGGTTAGGG 93del GGGGTGGGAGGAGGGT Oxy1.5 GGGGTTTTGGGG (G3T)4 GGGTGGGTGGGTGGGT

Scheme 1. (a) A detailed procedure for the SERS detection of DNA G-quadruplexes and the featured SERS frequencies corresponding to hydrogen bonds and ring breathings; (b) proposed position of a G-quadruplex surrounded by Ag IANPs for production of sensitive and reproducible SERS signals, in which the guanine base plane is perpendicular to the surface of the substrate. Ag@cit: silver citrate nanoparticles; Ag@I: iodide-modified Ag nanoparticles.


8

Page 9 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Details of the detection procedure are displayed in Scheme 1. The sample preparation of Gquadruplexes and other experimental details are shown in the supporting information. The Gquadruplex structures formed by each sequence were confirmed via CD and MS (Figure S1, S2, and S3) before SERS detection. Figure 2a shows the Raman spectra of the G-quadruplex formed by the sequence d(TG5T) in ammonium acetate buffer solution (pH 4.5) by using Ag NPs, Ag IMNPs, and Ag IANPs as substrates. In the case of Ag NPs, the silver sol prepared according to Lee’s method.43 No significant DNA signal can be observed when the Ag NPs has been irradiated with 633-nm laser wavelength (red line in Figure 2a). In contrast, the weak signals of the same DNA sequence can be detected at the same environmental conditions but with Ag IMNPs as a substrate (black line), although the signals are difficult to distinguish from the

Figure 2. (a) SERS spectra of the G-quadruplex [d(TG5T)]4 obtained by using Ag NPs (red line), Ag IMNPs (black line), and Ag IANPs (green line), as substrates. The green line is the sum of 15 measurements without additional smoothing. The concentrations of Mg2+ and Al3+ in individual nanoparticles are equal. The band at 1581 cm-1 corresponds to the interbase H-bond of dG(N2H). (b) The SERS spectra of the sequence d(TG5T) taken in NH4+ buffer solution (black) and pure water condition (green).


9


Page 10 of 20

noises. However, to our expectation, a series of enhanced bands has been obtained (green line) when Ag IANPs were employed. It is clear that the Ag IANPs has acted as an enhanced substrate significantly improving the detection of G-quadruplexes in both sensitivity and reproducibility.33 Interestingly, a peak at 655 cm-1 can be assigned to the ring-breathing vibration of guanine, which is dominant in the Ag IANPs-promoted SERS spectrum; this peak cannot be observed in the Raman spectrum of the G-quadruplex [d(TG5T)]4 when using Ag NPs as substrates:34 this indicates that the substrates, Ag NPs and Ag IANPs, differently affect the SERS detection. To prove the SERS spectrum of the G-quadruplex [d(TG5T)]4 is different from the SERS spectrum of the single-stranded d(TG5T), the Raman spectrum of the sequence d(TG5T) was taken in pure water solution (Figure 2b, green line). Remarkably, featured peaks corresponding to the G-quadruplexes can be detected in the NH4+ containing solution but have not been observed in the pure water spectrum (Figure 2b, black line). This is consistent with the results obtained via CD (Figure S2) and MS (Figure 3S) as well as the common knowledge that the Gquadruplex is produced and stabilized by the presence of specific concentrations of monovalent cations.1-5 Furthermore, we investigated if the addition of ~1 mM aluminum ions in Ag IANPs would affect the formation and change the structures of the G-quadruplex. The CD spectra of the G-quadruplexes with and without the same concentrations of aluminum ions as presented in Ag IANPs were taken, showing no significant effect on both the peak positions and the intensities of the featured bands (Figure S2). Each band in the spectrum of the G-quadruplex [d(TG5T)]4 (Figure 2b, black line) has been assigned referring to the literature and listed in Table S1. The peaks at 929 cm-1, 955 cm-1, and 1539 cm-1 are attributed to the vibrational modes of the deoxyribose symmetric stretching, the deoxyribose and purine ring stretching, respectively.15 They are enhanced in comparison to the


10

Page 11 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


spectrum of single-stranded d(TG5T). The SERS bands at 1484 cm-1, 1578 cm-1, 1595 cm-1 and 1693 cm-1 in pure water spectrum reflect the H-bond interactions between H2O and the stretching (ν) of the bond N7=C8, the deformation (δ) of N2H, the δ of N1-H, and the ν of the bond C6=O, respectively.17,18,20 Upon the formation of the G-quadruplex in the presence of NH4+, these bands have shifted to new positions at 1468 cm-1 for the ν of dG-N7 Hoogsteen H-bond, at 1581 cm-1 for the δ of the N2-H interbase H-bond, at 1599 cm-1 for the δ of N1-H interbase H-bond, and at 1703 cm-1 for the ν of the O6 interbase H-bond. To the best of our knowledge, it is the first time that the Raman shifts involving the changes of hydrogen bonds have been observed in aqueous solution. Using Ag IANPs as a substrate, the peak at 655 cm-1 assigned to dG ring breathing becomes predominant in the Raman spectrum (Figure 2). According to the surface selection rule of SERS44-46, we suggest that the guanine bases in the G-quartet are almost perpendicular to the surface of the Ag IANPs, as shown in Scheme 1b. Previously, the band at 655 cm-1 cannot be observed when Ag NPs have been used as substrates, which may be attributed to the absence of the counter cations. In that case, the G-quadruplex structures are likely standing on the surface of silver nanoparticles, whereas the G-quartets are parallel to the surface of the substrates.34 With the present method, the addition of aluminum ions not only brings the silver nanoparticles together to produce high-quality “hot spots”33 but also reduces the repulsion between silver nanoparticles and the negatively charged phosphate groups. Therefore, a high-quality signal of the G-quadruplexes can be obtained. The well-defined orientation of the DNA on the enhanced substrate allows our method to potentially detect the interaction between DNA and its ligands. The particularly intense breathing vibration peak at 655 cm-1 can also be regarded as an additional marker for the formation of G-quadruplexes. As a result, our method cannot only


11


Page 12 of 20

prove the formation of a G-quadruplex structure with clear Raman shift of hydrogen bonds but also obtain the unique characteristic band supporting the conformation for the first time. Furthermore, we have employed Ag IANPs as substrates to investigate the other types of Gquadruplexes. To date, SERS bands of various G-quadruplexes are still unknown. The challenge remains since the highly sensitive and reproducible spectra are not easy to obtain. Figure 3 shows the SERS spectra of the G-quadruplexes (93del K, Tel21 Na, Oxy1.5 K, d(G3T)4 K, and [d(TGnT)]4 (n = 3, 6)). We assigned the SERS bands detected by referring to the bands in the Raman spectra of G-quadruplexes17,18,20 (Table S1). The bands corresponding to structural signatures of each G-quadruplex are marked in the spectra, with the gray bars indicating the bands associated to the hydrogen bonds in the G-quartet. Significantly, different bands, which reflect the conformational features of G-quadruplexes, can be observed when we compare the SERS spectra. The most remarkable change is the prominent peak at 731 cm-1 (assigned to dA) in the SERS spectrum of 93del K. Although the number of G bases in 93del K is much higher than the number of A bases (dG:dA=6:1), the intensity of ring breathing vibration peak of dA is enormously higher than that of dG. However, the fact that the signals of A bases are easily enhanced and could dominate the SERS spectra in the SERS assay does not explain why such an A base enormously enhanced SERS signal did not appear in the spectrum of Tel21 Na though it contains a higher dA amount (dG:dA = 4:1) (Figure 3, red line). Therefore, we suggest that the high intensity of dA-ring breathing peak in 93del K spectrum may present a structural feature. To closely inspect the structure of the 93del K, we have observed that the double-chain reversed loops consisted of two A bases, which, being coplanar with the second and the fifth levels of the G-quartets, stabilizing the G-quadruplex (Figure 1c).36 In contrast, other two A bases in the double-chain reversed loops are placed in a similar way of the A bases in the loop of the Tel21


12

Page 13 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Na G-quadruplex. Therefore, we propose that the A bases on the G-quartet plane may considerably contribute to enhancing the SERS signals. This is due to the coplanar dA being outside the structures that are closer to the surface of the silver nanoparticles. This observation provides additional evidence that the DNA G-quadruplex in our design hot spot is "laid" on the surface of Ag IANPs with the G-quartet plane located perpendicular to the surface rather than standing on it.

Figure 3. The Raman spectra of six different G-quadruplexes (93del K, Tel21 Na, Oxy1.5 K, d(G3T)4 K, and two tetramolecular G-quadruplexes TGnT, with n=3,6). The gray bars represent the characteristic peaks of the G-quadruplex; light blue bars represent the dG and dA ring breathing vibrations, whereas green bars represent the conformations of GBA. All spectra have been normalized by phosphate groups marked with a dark green bar. It has been reported that the positions and intensities of the peaks in the range of 550-700 cm-1 and 1300-1380 cm-1 are correlated with the types of GBA for all of dG, dA, and dT bases.15 Therefore, the featured bands in this area could be used to distinguish anti and syn GBA conformations of G-quadruplex. Initially, we have inspected the peak in the region of 1374 cm-1 assigned to dG C2'-endo/syn and the peak at 1342 cm-1assigned to dG C2'-endo/anti. We have found that the two antiparallel G-quadruplexes (Oxy1.5 K and Tel21 Na) exhibit two adjacent


13


Page 14 of 20

bands at 1374 cm-1 and 1342 cm-1, which is consistent with the presence of both syn and anti GBA contents in the structure. However, the intensity of the peak at 1342 cm-1 is higher than that at 1374 cm-1 corresponding to four parallel G-quadruplexes (93del K, d(G3T)4 K, [d(TG3T)]4, [d(TG6T)]4, because all the GBAs in the structure are anti except two syn GBA in 93del K. In addition, very similar SERS spectra have been observed for the G-quadruplexes [d(TG3T)]4 and d(G3T)4 K, since they contain the same anti GBAs and three layers of G-quartets; the only discrepancies are a clear loop peak at 607 cm-1 belonging to d(G3T)4 and a peak at 929 cm-1 (assigned to backbones), which is significantly higher than that of [d(TG3T)]4. This change in peak intensity may be due to the rigidity of the structure. The above spectral characteristics can be used to distinguish the two similar G-quadruplexes. So far, it is clear that featured bands detected in our SERS spectra can provide structural information of individual G-quadruplex. Moreover, by comparing the SERS spectra of the anti-parallel G-quadruplexes Tel21 Na and of Oxy1.5, we can observe the dA ring peak and the low-intensity peak at 1700 cm-1 in the spectrum of Tel21 Na. The low-intensity peak at 1700 cm-1 reveals the fewer layers of the Tel21 Na than Oxy1.5 K. Besides, a red-shift of the T4 loop band allows us to distinguish it from the band of TTA loop, rendering the two antiparallel G-quadruplexes distinguishable as well. Previously, the Raman bands of G-quadruplexes were also identified in the areas where there were the featured bands corresponding to the DNA double helixes.15 As shown in Figure 3, the peaks at around 788 cm-1, 820 cm-1, and 865 cm-1, which can be observed in B-DNA and ZDNA, were also detected in the SERS spectra of all the G-quadruplexes (93del K, Tel21 Na, Oxy1.5 K, and tetramolecular G-quadruplexes TGnT), with the exception of d(G3T)4 K. The d(G3T)4 K produces a band at 862 cm-1, which could be formed by Z-DNA. The peak position of the phosphate backbones in the G-quadruplexes has undergone a red shift compared to the


14

Page 15 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


double-stranded DNA (typically for B-DNA). These SERS results provide further evidence of similarities of Raman bands between G-quadruplexes and double helixes in defined frequency ranges. Additionally, we find that the peak at 1703 cm-1 has a good correlation with the number of Gquadruplex layers. Although the peak intensity of Tel21 Na is slightly higher than that of [d(TG3T)]4 and d(G3T)4 K, they are much lower than that of Oxy1.5 K. Moreover, the peak intensities of 93del K and [d(TG6T)]4 at 1703 cm-1 are close to each other and much higher than the peak intensity of Oxy1.5 K. Therefore, five parallel tetramolecular G-quadruplexes [d(TGnT)]4 (n =3-7) have been selected for investigation (Figure 4a). From their SERS spectra, it can be seen that the intensities of the featured bands at 655±1 cm-1, 1349±1 cm-1, 1599±1 cm-1, and 1703±1 cm-1 corresponding to the formation of G-quadruplexes, increase with the number of G-quadruplexes’ layers. Furthermore, evident Raman band shifts can be observed, indicating the formation of the hydrogen bonds between dG (N7) and (N2-H) in a G-quartet, instead of the hydrogen bonds between dG (N7) and water.35 Besides, by increasing the number of Hoogsteen hydrogen bonds formed, the peak intensity of dG ν (N7=C8) at 1468 cm-1 increases as well. At the same time, the corresponding bands at 1490 cm-1 (non-G-quartet DNA) shift to around 1460 cm-1 for G-quartet DNA, particularly, 1483cm-1 for d(TG3T), 1470 cm-1 for d(TG4T), 1468 cm-1 for d(TG5T), 1466 cm-1 for d(TG6T), 1461 cm-1 for d(TG7T). As a result, we have observed that an increasing number of hydrogen bonds is associated to an increased stability of the Gquadruplexes, following the order of [d(TG7T)]4 > [d(TG6T)]4> [d(TG5T)]4 > [d(TG4T)]4 > [d(TG3T)]4. This is consistent with previous findings.2 Therefore, our method can be used to evaluate the stability of G-quadruplexes.


15


Page 16 of 20

Figure 4. (a) The SERS spectra of the sequence d(TG3-7T) in NH4+ buffer solution (without smoothing). The peaks of the νs PO2- (green bar), and the dG O6 interbase H-bond (grey bar) have been marked. The redshift of the peaks is assigned to the strong Hoogsteen H-bond of dG N7; (b) The graph of relative intensity ratio (I1700/I1090) versus the numbers of the layers (n) of the G-quadruplexes formed by the five sequences d(TG3-7T). Each point represents the average of 5 measurements, whereas each error bar indicates the standard deviation. Since the SERS signals are highly reproducible, we examined if the method could analyze the stability of the G-quadruplexes quantitatively. The peak of dG for the stretching v(C6=O6) at ~1700 cm-1 was selected for this purpose. Its relative intensity was normalized by phosphate peak at 1090 cm-1. The graph of relative intensity ratio (I1700/I1090) versus the layer (n) of the Gquadruplexes formed by the sequences d(TG3-7T) was shown in Figure 4b. A good linear relationship between band relative intensities and layers can be obtained, demonstrating that the method we have developed can be applied to determine the stability of the G-quadruplexes quantitatively. In summary, we have implemented a simple SERS-based platform by using Ag IANPs as substrates to rapidly obtain structural information of DNA G-quadruplexes. Our method is highly sensitive and reproducible. Indeed, for the first time, we have reported high-intensity peaks corresponding to dG and dA ring breathing variations located in the G-quartet plane. In addition, we also obtained a series of neat and enhanced bands of G-quadruplexes representing particular


16

Page 17 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


structural features, such as hydrogen bonds, glycosidic band angles, and layers of G-quartets, which could be used to distinguish structural polymorphisms in detail. Our results strongly suggested that the G-quadruplex adopted an appropriate position within the Ag IANPs, resulting in the enhancement of the intensity of those bands that correspond to the base ring breathing and hydrogen bonds in the G-quartet. Therefore, the stability trend of G-quadruplex and the number of layers in the G-quadruplex can be quantitatively evaluated by measuring the relative intensity of SERS bands assigned to Hoogsteen hydrogen bonds. The present study provides a new way for label-free characterization of G-quadruplexes and further work on the different DNA conformations and the interactions between DNAs and their ligands in the organism. ASSOCIATED CONTENT Supporting Information. Ag IANPs preparation; SERS measurements; Sample preparation, CD spectra and MS spectra. AUTHOR INFORMATION Corresponding Authors *E-mail: [email protected] *E-mail: [email protected] Notes The authors declare no competing financial interests. ACKNOWLEDGMENT


17


Page 18 of 20

This work was financially supported by the National Natural Science Foundation of China (21675060

and

51273080),

International

Collaboration

Project

of

Jilin

Province

(20160414010GH). REFERENCES (1) Choi, J.; Majima, T. Conformational changes of non-B DNA. Chem. Soc. Rev. 2011, 40, 5893-5909. (2) Huppert, J. L. Four-stranded nucleic acids: structure, function and targeting of Gquadruplexes. Chem. Soc. Rev. 2008, 37, 1375-1384. (3) Huppert, J. L.; Balasubramanian, S. Prevalence of quadruplexes in the human genome. Nucleic Acids Res. 2005, 33, 2908-2916. (4) Biffi, G.; Tannahill, D.; Mccafferty, J.; Balasubramanian, S. Quantitative visualization of DNA G-quadruplex structures in human cells. Nat. Chem. 2013, 5, 182. (5) Ida, R.; Wu, G. Direct NMR detection of alkali metal ions bound to G-quadruplex DNA. J. Am. Chem. Soc. 2008, 130, 3590-3602. (6) Zuo, X.; Cui, G.; Merz, K. M.; Zhang, L.; Lewis, F. D.; Tiede, D. M. X-ray diffraction "fingerprinting" of DNA structure in solution for quantitative evaluation of molecular dynamics simulation. Proc. Natl. Acad. Sci. U. S. A. 2006, 103, 3534-3539. (7) Cao, Y.; Gao, S.; Yan, Y.; Bruist, M. F.; Wang, B.; Guo, X. Assembly of supramolecular DNA complexes containing both G-quadruplexes and i-motifs by enhancing the G-repeat-bearing capacity of i-motifs. Nucleic Acids Res. 2017, 45, 2638. (8) Cao, Y.; Shang, G.; Li, C.; Yan, Y.; Bing, W.; Guo, X. Structural varieties of selectively mixed G and C rich short DNA sequences studied with electrospray ionization mass spectrometry. J. Mass Spectrom. 2016, 51 , 931-937. (9) Gao, S.; Cao, Y.; Yan, Y.; Guo, X. Sequence Effect on the Topology of 3 + 1 Interlocked Bimolecular DNA G-quadruplexes. Biochemistry 2016, 55 (19), 26942703. (10) Kypr, J.; Kejnovská, I.; Renčiuk, D.; Vorlíčková, M. Circular dichroism and conformational polymorphism of DNA. Nucleic Acids Res. 2009, 37, 1713-1725. (11) Marchand, A.; Gabelica, V. Folding and misfolding pathways of G-quadruplex DNA. Nucleic Acids Res. 2016, 44, 10999-11012. (12) Wang, K.; You, M.; Chen, Y.; Han, D.; Zhu, Z.; Huang, J.; Williams, K.; Yang, C. J.; Tan, W. Self-Assembly of a Bifunctional DNA Carrier for Drug Delivery. Angew. Chem., Int. Ed. 2011, 50, 6098-6101. (13) Smargiasso, N.; Rosu, F.; Wei, H.; Colson, P.; Baker, E. S.; Bowers, M. T.; Pauw, E. D.; Gabelica, V. G-quadruplex DNA assemblies: loop length, cation identity, and multimer formation. J. Am. Chem. Soc. 2008, 130, 10208-10216. (14) Lord, R. C.; Jr, G. J. T. Raman spectral studies of nucleic acids and related molecules—I Ribonucleic acid derivatives.Spectrochim. Acta, Part A. 1967, 23, 25512591. (15) Benevides, J. M.; Overman, S. A.; Thomas, G. J. Raman, polarized Raman and ultraviolet resonance Raman spectroscopy of nucleic acids and their complexes. J.


18

Page 19 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Raman Spectrosc. 2005, 36, 279-299. (16) Benevides, J. M.; Kang, C.; Thomas, G. J. Raman Signature of the Four-Stranded Intercalated Cytosine Motif in Crystal and Solution Structures of DNA Deoxycytidylates d(CCCT) and d(C8)†.Biochemistry 1996, 35, 5747-5755. (17) Deng, H.; Bloomfield, V. A.; Benevides, J. M.; Thomas, G. J. Dependence of the Raman signature of genomic B DNA on nucleotide base sequence. Biopolymers 1999, 50, 656-666. (18) Friedman, S. J.; Terentis, A. C. Friedman, S. J.; Terentis, A. C. Analysis of G quadruplex conformations using Raman and polarized Raman spectroscopy. J. Raman Spectrosc. 2016, 47, 259-268. (19) Palacký, J.; Vorlíčková, M.; Kejnovská, I.; Mojzeš, P. Polymorphism of human telomeric quadruplex structure controlled by DNA concentration: a Raman study. Nucleic Acids Res. 2013, 41, 1005-1016. (20) Krafft, C.; Benevides, J. M.; Jr, T. G. Secondary structure polymorphism in Oxytricha nova telomeric DNA. Nucleic Acids Res. 2002, 30, 3981-3991. (21) Deng, H.; Bloomfield, V. A.; Benevides, J. M.; Jr, G. J. T. Structural basis of polyamine–DNA recognition: spermidine and spermine interactions with genomic BDNAs of different GC content probed by Raman spectroscopy.Nucleic Acids Res. 2000, 28, 3379-3385. (22) Han, X. X.; Kitahama, Y.; Itoh, T.; Wang, C. X.; Zhao, B.; Ozaki, Y. Proteinmediated sandwich strategy for surface-enhanced Raman scattering: application to versatile protein detection. Anal. Chem. 2009, 81, 3350-3355. (23) Yang, S.; Dai, X.; Stogin, B. B.; Wong, T. S. Ultrasensitive surface-enhanced Raman scattering detection in common fluids. Proc. Natl. Acad. Sci. U. S. A. 2015, 113, 268273. (24) Chen, H. Y.; Lin, M. H.; Wang, C. Y.; Chang, Y. M.; Gwo, S. Large-Scale Hot Spot Engineering for Quantitative SERS at the Single-Molecule Scale. J. Am. Chem. Soc. 2015, 137, 13698-13705. (25) Kang, T.; Yoo, S. M.; Yoon, I.; Lee, S. Y.; Kim, B. Patterned multiplex pathogen DNA detection by Au particle-on-wire SERS sensor. Nano Lett. 2010, 10, 1189-1193. (26) Mahajan, S.; Richardson, J.; Brown, T.; Bartlett, P. N. SERS-Melting: A New Method for Discriminating Mutations in DNA Sequences. J. Am. Chem. Soc. 2008, 130, 15589-15601. (27) Bell, S. E.; Sirimuthu, N. M. Surface-enhanced Raman spectroscopy (SERS) for submicromolar detection of DNA/RNA mononucleotides. J. Am. Chem. Soc. 2006, 128, 15580-15581. (28) Papadopoulou, E.; Bell, S. E. J. Label-Free Detection of Single-Base Mismatches in DNA by Surface-Enhanced Raman Spectroscopy. Angew. Chem. 2011, 123, 92249227. (29) Wang, H. N.; Fales, A. M.; Vodinh, T. Plasmonics-based SERS nanobiosensor for homogeneous nucleic acid detection. Nanomedicine 2015, 11, 811-814. (30) Xu, L. J.; Lei, Z. C.; Li, J.; Zong, C.; Yang, C. J.; Ren, B. Label-free Surfaceenhanced Raman Spectroscopy Detection of DNA with Single-base Sensitivity. J. Am. Chem. Soc. 2015, 137, 5149-5154. (31) Barhoumi, A.; Zhang, D.; Tam, F.; Halas, N. J. Surface-Enhanced Raman Spectroscopy of DNA. J. Am. Chem. Soc. 2008, 130, 5523-5529.


19


Page 20 of 20

(32) Guerrini, L.; Krpetić, Ž.; Van Lierop, D.; Alvarez Puebla, R. A.; Graham, D. Direct Surface Enhanced Raman Scattering Analysis of DNA Duplexes. Angew. Chem., Int. Ed. 2015, 54, 1144-1148. (33) Li, Y.; Han, X. X.; Yan, Y.; Cao, Y.; Xiang, X.; Wang, S.; Zhao, B.; Guo, X. LabelFree Detection of Tetramolecular I-motif by Surface-Enhanced Raman Spectroscopy. Anal. Chem. 2018, 90, 2996-3000. (34) Miljanić, S.; Ratkaj, M.; Matković, M.; Piantanida, I.; Gratteri, P.; Bazzicalupi, C. Assessment of human telomeric G-quadruplex structures using surface-enhanced Raman spectroscopy. Anal. Bioanal. Chem. 2017, 409, 1-11. (35) Rusciano, G.; De Luca, A. C.; Pesce, G.; Sasso, A.; Oliviero, G.; Amato, J.; Borbone, N.; D'Errico, S.; Piccialli, V.; Piccialli, G. Label-free probing of G-quadruplex formation by surface-enhanced Raman scattering. Anal. Chem. 2011, 83, 6849-6855. (36) Phan, A. T.; Kuryavyi, V.; Ma, J. B.; Faure, A.; Andréola, M. L.; Patel, D. J. An interlocked dimeric parallel-stranded DNA quadruplex: a potent inhibitor of HIV-1 integrase. Proc. Natl. Acad. Sci. U. S. A. 2005, 102, 634-639. (37) Do, N. Q.; Lim, K. W.; Ming, H. T.; Heddi, B.; Phan, A. T. Stacking of Gquadruplexes: NMR structure of a G-rich oligonucleotide with potential anti-HIV and anticancer activity. Nucleic Acids Res. 2011, 39, 9448-9457. (38) Guo, X.; Liu, S.; Yu, Z. Bimolecular quadruplexes and their transitions to higherorder molecular structures detected by ESI-FTICR-MS. J. Am. Soc. Mass Spectrom. 2007, 18, 1467-1476. (39) Vorlã-Ckovã, M.; Chlã, d. J.; Kejnovskã, I.; Fialovã, M.; Kypr, J. Guanine tetraplex topology of human telomere DNA is governed by the number of (TTAGGG) repeats. Nucleic Acids Res. 2005, 33, 5851-5860. (40) Redon, S.; Bombard, S.; Elizondo Riojas, M. A.; Chottard, J. C. Platinum cross linking of adenines and guanines on the quadruplex structures of the AG3(T2AG3)3 and (T2AG3)4 human telomere sequences in Na+ and K+ solutions. Nucleic Acids Res. 2003, 31, 1605-1613. (41) Micco, M.; Collie, G. W.; Dale, A. G.; Ohnmacht, S. A.; Pazitna, I.; Gunaratnam, M.; Reszka, A. P.; Neidle, S. Structure-based design and evaluation of naphthalene diimide G-quadruplex ligands as telomere targeting agents in pancreatic cancer cells. J. Med. Chem. 2013, 56, 2959-2974. (42) Martino, L.; Virno, A.; Pagano, B.; Virgilio, A.; Di, M. S.; Galeone, A.; Giancola, C.; Bifulco, G.; Mayol, L.; Randazzo, A. Structural and thermodynamic studies of the interaction of distamycin A with the parallel quadruplex structure [d(TGGGGT)]4. J. Am. Chem. Soc. 2007, 129, 16048-16056. (43) Lee, P.; Meisel, D. Adsorption and surface-enhanced Raman of dyes on silver and gold sols. J. Phys. Chem. 1982, 86, 3391-3395. (44) Creighton, J. R.; Baucom, K. C. Reflectance-difference spectroscopy of adsorbatecovered GaAs(100) surfaces: a combined surface science and in-situ OMVPE study. Surf. Sci. 1998, 409, 372-383. (45) Gao, X.; Davies, J. P.; Weaver, M. J. Test of surface selection rules for surfaceenhanced Raman scattering: the orientation of adsorbed benzene and monosubstituted benzenes on gold. J. Phys. Chem. 1990, 94, 6858-6864. (46) Varghese, H. T.; Panicker, C. Y.; Anto, P. L.; Philip, D. Potential dependent SERS profile of sulfanilamide on silver electrode. J. Raman Spectrosc. 2006, 37, 487-491.


20

Structural Features of DNA G-Quadruplexes Revealed by Surface

Recommend Documents