Structural Studies of an A2-Type Modular Polyketide Synthase

Jun 11, 2013 - ... load: https://cdn.mathjax.org/mathjax/contrib/a11y/accessibility-menu.js ..... Other distinguishing features of A2-type KRs are mad...
0 downloads 0 Views 3MB Size
Download PDF
Articles pubs.acs.org/acschemicalbiology

Structural Studies of an A2-Type Modular Polyketide Synthase Ketoreductase Reveal Features Controlling α‑Substituent Stereochemistry Jianting Zheng,† Shawn K. Piasecki,‡ and Adrian T. Keatinge-Clay†,‡,* †

Department of Chemistry and Biochemistry and ‡Institute for Cellular and Molecular Biology, The University of Texas at Austin, Austin, Texas 78712, United States S Supporting Information *

ABSTRACT: Modular polyketide synthase ketoreductases often set two stereocenters when reducing intermediates in the biosynthesis of a complex polyketide. Here we report the 2.55-Å resolution structure of an A2-type ketoreductase from the 11th module of the amphotericin polyketide synthase that sets a combination of L-αmethyl and L-β-hydroxyl stereochemistries and represents the final catalytically competent ketoreductase type to be structurally elucidated. Through structureguided mutagenesis a double mutant of an A1-type ketoreductase was generated that functions as an A2-type ketoreductase on a diketide substrate analogue, setting an αalkyl substituent in an L-orientation rather than in the D-orientation set by the unmutated ketoreductase. When the activity of the double mutant was examined in the context of an engineered triketide lactone synthase, the anticipated triketide lactone was not produced even though the ketoreductase-containing module still reduced the diketide substrate analogue as expected. These findings suggest that reengineered ketoreductases may be catalytically outcompeted within engineered polyketide synthase assembly lines. stereoselective (controlling the face of the β-keto group attacked by the NADPH hydride to set the hydroxyl group stereochemistry) and stereospecific (binding one epimer over the other to control α-substituent stereochemistry) during reduction reactions, they were also shown to be capable of epimerizing α-substituents of β-ketothioester intermediates prior to a reduction reaction.9 Physical insights into the mechanisms of stereocontrol have been supplied by crystal structures, which as of this report have been determined for each type of reductase-competent KR.10−12 The crystal structures reveal that all KRs share the same fold, that their catalytic residues are in equivalent positions, and that the nicotinamide coenzyme binds to each of them in the same orientation. Thus, differential reduction of polyketides is a consequence of differential binding of ACP-tethered polyketide intermediates. Sequence fingerprints for different KR types were first detected for A-type and B-type KRs, which generate 13,14 L- and D-hydroxy groups, respectively. A conserved tryptophan in A-type KRs was hypothesized to help them bind polyketide intermediates so that the re side of the β-keto group faces the reactive NADPH hydride, and a leucineaspartate-aspartate (LDD) motif in B-type KRs was hypothesized to help bind polyketides so that the si side of the β-keto group faces the reactive NADPH hydride. However, even with the knowledge of the locations of the A-type tryptophan and

C

omplex polyketides represent a large class of secondary metabolites with diverse bioactivities that include antibacterial, antifungal, antiparasitic, immunosuppressive, and cholesterol-lowering properties. Many of these stereochemically dense compounds are biosynthesized by multimodular polyketide synthases (PKSs).1−4 These megadalton enzymatic assembly lines construct polyketide chains from small, organic precursors. During these syntheses, α-alkyl, β-ketothioester intermediates are commonly processed by ketoreductases (KRs) located within the modules of the synthase.5 These reductions result in one of four stereochemical combinations since both D- and L-orientations are possible for both of the resulting α-alkyl and β-hydroxy groups. As these reduction events usually set the majority of the stereocenters within complex polyketides, understanding how KR stereocontrol is enforced is central to determining both how PKSs biosynthesize polyketides and how they may be engineered to produce molecules of medicinal relevance. The enzymology of KRs has steadily advanced over the past 15 years.5 These short-chain dehydrogenase/reductase (SDR) enzymes were first demonstrated to set the orientations of the β-hydroxy groups of polyketide intermediates through domainswapping experiments in which a KR of one stereoselectivity was successfully replaced by a KR of the opposite stereoselectivity in an engineered synthase.6,7 KRs were later demonstrated to also set the orientations of the α-alkyl groups of polyketide intermediates through experiments in which isolated KRs incubated with a racemic mixture of an αsubstituted, β-ketothioester substrate showed stereospecific reduction of one epimer.8 In addition to KRs being both © 2013 American Chemical Society

Received: March 5, 2013 Accepted: June 11, 2013 Published: June 11, 2013 1964

dx.doi.org/10.1021/cb400161g | ACS Chem. Biol. 2013, 8, 1964−1971

ACS Chemical Biology

Articles

the B-type LDD motif relative to the catalytic residues, how stereoselectivity is imparted is not immediately apparent. How a KR can be stereospecific for one α-epimer over another must also be controlled by how a polyketide is uniquely guided into the active site of that KR. The two classes of A-type KRs possess opposite stereospecificities: A1-type KRs reduce Dα-alkyl-β-ketothioester substrates, while A2-type KRs reduce Lα-alkyl-β-ketothioester substrates.11 A glutamine is usually present three residues N-terminal to the catalytic tyrosine of A1-type KRs, while histidine is usually present in this position in A2-type KRs. We have previously shown that the glutamineto-histidine mutant of the A1-type AmpKR2 (the KR from the second module of the amphotericin PKS) equally reduces both epimers of the substrate mimic (±)-2-methyl-3-oxopentanoateS-N-acetylcysteamine (NAC).12 We anticipated that the structure of an A2-type KR would elucidate other stereospecificity-conferring features and further guide the conversion of the A1-type AmpKR2 into an A2-type KR. Here we report the 2.55-Å resolution structure of the A2type KR from the 11th module of the amphotericin PKS (AmpKR11), which sets the L-orientations of both the C16methyl and C17-hydroxyl groups in the amphotericin aglycone prior to post-PKS tailoring enzymes catalyzing the oxidation of the C16-methyl group to a carboxylic acid (Figure 1).15 In addition to the conserved histidine, a conserved β-branched residue was identified as a key mediator of stereocontrol in A2type KRs. The substitution of a histidine for the glutamine and a threonine for the glycine completely reversed the stereo-

specificity of AmpKR2 from D-2-methyl-3-oxopentanoate-SNAC to L-2-methyl-3-oxopentanoate-S-NAC. The 1.52-Å resolution structure of this double mutant revealed a large shift in the position of the A-type tryptophan. Both the unmutated and doubly mutated AmpKR2 were incorporated into the second module of a triketide lactone synthase. While the unmutated AmpKR2 produced the expected stereochemistry, the double mutant did not display activity. However, both KR-incorporated modules were capable of reducing (±)-2-methyl-3-oxopentanoate-S-NAC as anticipated. These experiments indicate that the engineered KR was kinetically outcompeted within the engineered triketide lactone synthase.

■

RESULTS AND DISCUSSION Overall Structure. While a construct of AmpKR11 (AmphI residues 4263−4759) truncated similarly to other structurally characterized KR domains did not crystallize, a construct that included the dimerization element (DE) that is N-terminal to the KR domain, Amp(DE+KR)11 (AmphI residues 4201− 4759, here numbered 1−559), provided crystals that diffracted to 3.30-Å resolution.10−12,16,17 The diffraction limit was extended to 2.55-Å resolution through crystal dehydration, and the structure was determined through molecular replacement using AmpKR2 (PDB Code: 3MJS) as a search model18,12 (Figure 2, Supplementary Figure 1, and Table 1). The DE dimer lies on a crystallographic 2-fold axis. Its elevated temperature factors may indicate either disorder or an inherent asymmetry as observed for the DE from the third module of the spinosyn PKS, SpnDE3 (Figure 2a).17 The connectivity of its second and third helices apparently differs from that observed for SpnDE3, and the angle between the third helices of the DE dimer is smaller than that observed for the SpnDE3 dimer (∼50° vs ∼70°). Clear electron density is visible for NADP+, present in the crystallization condition at 5 mM, while the Nterminal end of the lid helix αFG is absent in the electron density maps (Figure 2b). Structural alignments reveal that the A2-type AmpKR11 is highly similar to the A1-type AmpKR2, the B1-type TylKR1, and the B2-type EryKR1 (PDB Codes: 3MJS, 2Z5L, 2FR0; 1.1 Å, 1.4 Å, and 1.6 Å Cα rmsd, respectively).10−12,19 Differences between A1- and A2-Type KRs. While the overall folds of A1- and A2-type KRs are equivalent, these enzymes reduce oppositely configured α-substituted, βketothioester epimers. Sequence alignments provide clues as to which residues are responsible for these opposite specificities.12 The residue three N-terminal to the catalytic tyrosine is most often glutamine in A1-type KRs and histidine in A2-type KRs. Also, the loop preceding the lid helix contains a WxxWxxxx(L/M) motif in A1-type KRs, whereas this loop is usually shorter and contains a higher proportion of negatively charged residues in A2-type KRs. Other distinguishing features of A2-type KRs are made apparent through the AmpKR11 structure (Figure 2c and Supplementary Figure 1). An unusual hydrogen-bond network is mediated by the asparagine four residues C-terminal to the catalytic tyrosine. Rather than form a hydrogen bond with the backbone carbonyl of the catalytic tyrosine, Y426, as observed in all other KR-types, the N430 side-chain NH2 forms a hydrogen bond with the backbone carbonyl of A415 from αEF. This orientation of the A415/G416 amide is opposite to the orientation observed in other structurally characterized KRs, as is the orientation of the neighboring W418/G419 amide. The Y511 hydroxyl group also forms a hydrogen bond with the

Figure 1. AmpKR11 in the biosynthesis of amphotericin B. The first 11 modules of the amphotericin multimodular PKS synthesize the βketo intermediate presented to AmpKR11 by the acyl carrier protein (ACP) from the 11th module. After this A2-type KR sets the Lorientations of both the C16-hydroxyl and C17-methyl substituents, the polyketide is further elongated and cyclized. Post-PKS tailoring enzymes modify the newly formed macrolide, through reactions that include the oxidation of the C16-methyl to a carboxylic acid and pyran formation. 1965

dx.doi.org/10.1021/cb400161g | ACS Chem. Biol. 2013, 8, 1964−1971

ACS Chemical Biology

Articles

Figure 2. Structure of an A2-type KR. (A) The structure of Amp(DE+KR)11 bound to NADP+ was determined to 2.55-Å resolution. A comparison with Spn(DE+KR)3, the DE+KR dimer from the third module of the spinosyn PKS, shows that the AmpDE11 dimer has a more acute angle between its third helices (∼50° vs ∼70°). KRs, KR structural subdomain; KRc, KR catalytic subdomain. (B) Stereodiagram of the AmpKR11 active site reveals that the A-type tryptophan forms a hydrogen bond with Y507. The orientation of the signature A2-type histidine, H423, is also revealed. (C) A stereodiagram shows active site residues from the A2-type AmpKR11 superposed on equivalent residues from the A1-type AmpKR2. The hydrogen bond network mediated by the AmpKR11 asparagine (four residues C-terminal to the catalytic tyrosine) is different from all other solved KR structures. The β-branched residue 12 residues N-terminal to the catalytic tyrosine in A2-type KRs plays a large role in shifting the position of the A-type tryptophan. See also Supplementary Figure 1.

The side chain of the residue three N-terminal to the catalytic tyrosine has been hypothesized to form a hydrogen bond with the substrate thioester carbonyl to help guide the polyketide into the active site.10 In AmpKR11 the histidine in this position is oriented via two interactions, steric contact with L371 and a hydrogen bond with G421 (δ-NH with the G421 carbonyl). A recent crystal structure is suggestive of how the residue in this position and surrounding residues interact with substrates: the complex between a high-molecular-weight FabG (HMw-FabG) and hexanoyl-CoA shows how residues on loops DE and EF (equivalent to the loop containing the LDD motif in B-type KRs) guide an acyl-S-pantetheinyl moiety into the active site of an SDR enzyme (PDB Code: 3V1U).20 Conversion of an A1-Type KR into an A2-Type KR. Guided by sequence alignments of A-type KRs, we previously mutated the A1-type AmpKR2 into a nonspecific A-type KR by substituting a histidine for the glutamine three residues Nterminal to the catalytic tyrosine (conversion of (±)-2-methyl3-oxopentanoate-S-NAC to the 2L,3L-product increased from 3% to 55%).12 We sought to use the structure of the A2-type AmpKR11 as a guide to further convert AmpKR2 into an A2-

G419 backbone carbonyl to further contribute to the unusual hydrogen-bond network of αEF. The conformation of αEF causes the A-type tryptophan (W418 in AmpKR11) to assume a different orientation than the A-type tryptophan of the A1type AmpKR2 (the indole nitrogen is 1.0 Å farther away from the catalytic tyrosine hydroxyl group compared to AmpKR2). The A-type tryptophan indole NH is hypothesized to form a hydrogen bond with the terminal carbonyl of the phosphopantetheinyl arm in A1-type KRs.12 However, the hydrogen bond it forms with the Y507 hydroxyl group indicates that the A-type tryptophan of A2-type KRs does not directly form a hydrogen bond with the phosphopantetheinyl arm. Another significant difference between A1- and A2-type active sites is made apparent through the AmpKR11 structure: a β-branched residue (threonine, valine, or isoleucine) is present in A2-type KRs 12 residues N-terminal to the catalytic tyrosine, while in A1-type KRs this residue is commonly a glycine or asparagine. This residue (T414 in AmpKR11) is sandwiched between the catalytic serine and the A-type tryptophan and significantly influences the orientation of the A-type tryptophan. 1966

dx.doi.org/10.1021/cb400161g | ACS Chem. Biol. 2013, 8, 1964−1971

ACS Chemical Biology

Articles

Table 1. Crystallography Data and Refinement Statistics Amp(DE+KR)11 space group a, b, c (Å) α, β, γ (deg) resolution (Å) Rmerge I/σ(I) completeness (%) redundancy resolution (Å) no. reflections Rwork/Rfree no. of atoms protein NADP+ glycerol water B-factors protein NADP+ glycerol water rms deviations bond lengths (Å) bond angles (deg)

Data Collection C2221 45.14, 133.51, 185.14 90, 90, 90 50−2.55 (2.59−2.55) 0.126 (0.791) 11.0 (2.2) 97.2 (97.3) 6.0 (5.0) Refinement 50−2.55 18,174 0.227 (0.280) 3,764 48

AmpKR2(G355T/Q364H) P1 61.55, 63.72, 71.98 72.92, 67.22, 89.74 50−1.52 (1.55−1.52) 0.064 (0.124) 14.8 (8.2) 87.1 (83.3) 1.9 (1.9) 50−1.52 121,324 0.197 (0.223) 6,929 96 12 628

6 92.6 87.9 59.1

16.1 12.4 27.7 22.7

0.014 1.705

0.009 1.107

of unmutated AmpKR2 and principally generates the B2-type product (67% 2L,3D-product) (Figure 3a). Inability To Alter the Stereospecificity of A2-Type KRs. Having converted an isolated A1-type KR into an A2-type KR, we sought to also perform the reverse (Figure 4). Studies of the A2-type AmpKR1 showed that mutating the A2-type histidine to the A1-type glutamine did not change its stereospecificity;12 AmpKR11(H423Q) also did not show altered stereospecificity. Substituting the β-branched residue of AmpKR11 with glycine did not change its stereospecificity but did decrease its activity: AmpKR11(T414G) and AmpKR11(T414G/H423Q) were, respectively, 1% and 8% as active as unmutated AmpKR11. Equivalent results were obtained from the corresponding mutants of the A2-type AmpKR1. Inserting a Re-engineered KR into a Triketide Lactone Synthase. One goal in PKS engineering is to control polyketide stereocenters by modifying the residues that mediate stereocontrol within a synthase.3,23Thus, having converted an A1-type KR into an A2-type KR through two point mutations, we sought to observe this re-engineered KR within a functional triketide lactone synthase.24 We first ensured that production of the 2L-triketide lactone product was possible for a triketide lactone synthase by constructing a synthase containing EryMod1 and AmpMod11 (first module of the erythromycin PKS and eleventh module of the amphotericin PKS) (Figure 5 and Supplementary Figure 3). While ∼75% of the triketide lactone product was the ketolactone formed from the triketide intermediate not being reduced before being cyclized by EryTE (the thioesterase from the erythromycin PKS), ∼25% was the 2L-triketide lactone (see Methods for NMR characterization).25 We then tested whether the 2L-triketide lactone could be generated through KR-swapping (only a trace of the 2L-

type KR and hypothesized that engineering a threonine 12 residues N-terminal to the catalytic tyrosine would alter the Atype tryptophan orientation and disrupt the normal binding mode of A1-type KRs. Remarkably, the AmpKR2(G355T/Q364H) double mutant behaved as an A2-type KR, reducing the L-methyl epimer of (±)-2-methyl-3-oxopentanoate-S-NAC (94% 2L,3L-product) (Figure 3a). Thus, two mutations were sufficient to reverse the stereospecificity of an A1-type KR. There had been hints that this was possible. Opposite specificity is displayed by KRs within the mycolactone PKS that vary by a single active site residue (in total, three residues differ between the KRs); the KR that contains a glutamine three residues N-terminal to the catalytic tyrosine is B1-type, and the KR that contains a leucine in this position is B2-type.5,21 Also, directed mutagenesis of the standalone B2-type EryKR1 was employed to convert it into an A2-type KR through five active site mutations.22 AmpKR2(G355T/Q364H) was more active than unmutated AmpKR2 toward (±)-2-methyl-3-oxopentanoate-S-NAC. The catalytic efficiency of the double mutant was measured to be four times higher than the unmutated enzyme (8.74 ± 1.32 vs 2.28 ± 0.36 M−1 s−1) (Supplementary Figure 2). To better understand how the stereospecificity of AmpKR2 was reversed, the structure of AmpKR2(G335T/Q364H) was determined to 1.52 Å (Figure 3b and Table 1). The threonine substitution alters the structure of AmpKR2 much more significantly than the histidine substitution (PDB Code: 3MJT).12 The side chain of the introduced threonine displaces the A-type tryptophan (W359; Cα by 0.7 Å, Nε1 by 0.5 Å, and Cζ3 by 2.1 Å) and significantly shifts the backbone atoms of both αEF and loop EF. The AmpKR2(G355T) mutant lends further support that the introduction of the threonine precludes binding through the A1-mode: this single mutant possesses 13% of the activity 1967

dx.doi.org/10.1021/cb400161g | ACS Chem. Biol. 2013, 8, 1964−1971

ACS Chemical Biology

Articles

Figure 4. A2-type KRs resist stereospecificity re-engineering. Residues identified as key mediators of stereocontrol in A2-type KRs were mutated to those present in A1-type KRs. Chiral chromatography of the reactions show that even when key residues were mutated, the mutant AmpKR11 and AmpKR1 enzymes displayed similar stereospecificity to unmutated AmpKR11 and AmpKR1.

Figure 3. Reversing the stereospecificity of an A1-type KR through two point mutations. (A) In an in vitro KR reaction the 2D- and 2Lepimers of a 2-methyl-3-oxopentanoate-S-NAC molecule interconvert in solution until a standalone A1-, A2-, B1-, or B2-type KR stereospecifically binds one of them and stereoselectively reduces its β-keto group. The unmutated A1-type AmpKR2 can be observed to select the D-epimer through chiral chromatography. With the installation of the A2-type histidine, AmpKR2(Q364H) selects either the D- or L-epimer. When the A2-type β-branched residue is also installed, the AmpKR2(G355T/Q364H) double mutant selects the Lepimer, generating the product expected of an A2-type KR. (B) The structure of the AmpKR2(G355T/Q364H) double mutant was determined to 1.52-Å resolution to learn more about its reversed stereospecificity. Superposed with the unmutated AmpKR2 (PDB Code: 3MJS), a large shift in the A-type tryptophan orientation is apparent (Cα by 0.65 Å, Nε1 by 0.50 Å, and Cζ3 by 2.14 Å). This may prevent the tryptophan from forming a productive hydrogen bond with the NAC carbonyl, hypothesized to be made with substrates by A1-type KRs.

Together, these results indicate that either (1) the AmpKR2 double mutant is a poor epimerase, such that the L-α-isomer is seldom generated before the triketide intermediate is transferred to EryTE or (2) epimerization occurs, but the AmpKR2 double mutant has a low affinity for the triketide intermediate. The first possibility seems unlikely since epimerization can be catalyzed even by mutant C2-type KRs.16 The second possibility seems more plausible since triketide lactone synthases often generate a significant proportion of the triketide ketolactone relative to the triketide hydroxylactone even when the KR in the second module needs not await epimerization of the triketide intermediate (e.g., the synthase composed of EryMod1 and EryMod6).24 To observe activity from an inserted KR, its catalytic efficiency needs to be greater than the competing downstream activity (e.g., EryTE).28 PKS Engineering Perspective. The crystal structure of an A2-type KR, the last type of reductase-competent KR to be structurally characterized, allows a comparison of the features that differentially bind α-substituted, β-ketoacyl intermediates. The atomic resolution details of how KRs achieve both stereospecificity and stereoselectivity will eventually be revealed through structures of KRs complexed with polyketide substrates. While such knowledge may enable the re-engineering of standalone KRs, it does not immediately permit the reengineering of PKSs to produce epimers of natural polyketides. Within a PKS assembly line, a KR domain competes with a downstream activity, such as that of a KS or TE. Unless an engineered KR domain is more catalytically efficient than this enzyme, its activity will not be reflected in the structure of the polyketide product. Even the techniques of module-swapping and domain-swapping that preserve the active site architecture of a KR may not enable the catalytic efficiency of that KR to approach those of KRs operating on their native substrates. Thus, the engineering of PKS assembly lines, which commonly involves the incorporation of processing enzymes that operate at suboptimal catalytic efficiencies, could benefit from commensurate decreases in the rates of competing downstream enzymes.

triketide lactone had been observed when the A2-type KR from the seventh module of the rifamycin PKS, RifKR7, was swapped for EryKR2 within a triketide lactone synthase composed of EryMod1 and EryMod2).26 Indeed, the synthase with Amp(DE +KR)11 swapped for EryKR2 was able to generate the 2Ltriketide lactone (5% of the triketide lactone products). The inclusion of DE proved necessary for KR function, presumably because the dimeric DE orients the KR domains for optimal activity within a module (Figure 5).17 Amp(DE+KR)2 and its G355T/Q364H double mutant were then swapped for EryKR2 within a triketide lactone synthase.24 The synthase containing unmutated AmpKR2 synthesized the expected 2D-triketide lactone (∼85% of triketide lactone products), while the synthase containing the doubly mutated AmpKR2 produced no detectable quantity of the expected 2Ltriketide lactone. To determine if the module-embedded KRs still possess the activities they displayed as isolated domains, each of the KR-containing modules were incubated with (±)-2methyl-3-oxopentanoate-S-NAC (Supplementary Figure 4). Both the module-embedded AmpKR2 and module-embedded AmpKR2(G355T/Q364H) reduced this substrate mimic as anticipated.27 1968

dx.doi.org/10.1021/cb400161g | ACS Chem. Biol. 2013, 8, 1964−1971

ACS Chemical Biology

Articles

Figure 5. Attempts to reverse a polyketide stereocenter through point mutations of a PKS. Engineered PKSs were expressed within E. coli K207-3 cells, and their triketide lactone products were were detected by LC−MS. The first subunit in each of the PKSs is composed of the loading didomain (EryATL and EryACPL), the first module of the erythromycin PKS (EryMod1), and the C-terminal docking domain from DEBS1 of the erythromycin PKS (CDD(DEBS1)). Each of the second subunits include the N-terminal docking domain from DEBS2 (NDD(DEBS2)) and EryTE. When the second subunit contains EryMod2, only the expected 2D-triketide lactone is produced. When AmpMod11, harboring the A2-type AmpKR11, replaces EryMod2 the expected 2L-triketide lactone is produced (25% of products). Also, when the A2-type AmpKR11 (and AmpDE11) replaces EryKR2, the anticipated 2L-triketide lactone is produced (5% of products). However, when the A2-type AmpKR2(G355T/Q364H) double mutant (and AmpDE2) replaces EryKR2, none of the expected 2L-triketide lactone is detected. These results suggest that EryTE is outcompeting catalytically inefficient KRs swapped into the synthase. See also Supplementary Figure 3.

■

(PDB Code: 3MJS) as a search model.29−31,12 The model was iteratively built in Coot and refined by Refmac (Table 1).32,33 Crystallization of AmpKR2(G355T/Q364H) was performed as reported for AmpKR2.12 Data collected on Beamline 5.0.2 at the Advanced Light Source were processed with HKL2000, and phases were determined by molecular replacement with Phaser using AmpKR2 (PDB Code: 3MJS) as a search model.29−31,12 The model was iteratively built in Coot and refined by Refmac (Table 1).32,33 KR Mutagenesis. The GeneTailor Site-Directed Mutagenesis System (Invitrogen) was used to generate mutants of the standalone KR domains. The oligonucleotides used for mutations were as follows: AmpKR2, G355T, 5′-CGTTCGTGCTGTTCTCGTCCACCGCCGCGGTCTGGGGCA-3′ and 5′-GGACGAGAACAGCACGAACGCGTCCAGGTCGAGGTCG-3′, Q364H, 5′-TGGGGCAGCGGTGGCCATCCCGGCTACGCC-3′, and 5′-TGGCCACCGCTGCCCCAGACCGCGGCGCC-3′; AmpKR1, T358G, 5′ACTTCGTCCTGTACTCCTCCGGCGCCGGCATGTGGGGCA3′ and 5′-GGAGGAGTACAGGACGAAGTCGTCCAGCTCCTCGTCGT-3′, H367Q, 5′-GGGGCAGCGGCGTGCAGGCCGCGTATGTCG-3′ and 5′-TGCACGCCGCTGCCCCACATGCCGGCGGT-3′; AmpKR11, T414G, 5′-ACTTCGTCCTGTACTCCTCCGGCGCCGGCATGTGGGGCA-3′ and 5′GGAGGAGTACAGGACGAAGTCGTCCAGCTCCTCGTCGT-3′, H423Q, 5′-ATGTGGGGCAGCGGCGCGCAGGCCGCGTATGTCGCGGG-3′ and 5′-TGCGCGCCGCTGCCCCACATGCCGGCGGTGGAGGAGT-3′, Y501F, 5′-CGACGTCGACTGGGAGACGTTCCACCCCGTCTACACCT-3′ and 5′-ACGTCTCCCAGTCGACGTCGGCGACCGCGATGACCTG-3′. All mutants were verified by DNA sequencing. In Vitro KR Reactions. The KR reduction reactions were set up as previously described.12 Briefly, a 0.2-mL solution containing 150 mM NaCl, 50 μM NADP+, 10 mM D-glucose, 1 mM Bacillus subtilis glucose dehydrogenase (the NADPH regeneration system), 3 mM (±)-2methyl-3-oxopentanoate-S-NAC, 5 mM KR, 10% (v/v) glycerol, and 50 mM HEPES (pH 7.5) was incubated at 21 °C for 12 h. The products were extracted with 800 mL of ethyl acetate, which was then removed by vacuum evaporation. The residue was resuspended in 100 μL 80% hexanes/20% ethanol, and 20 μL samples were loaded onto a ChiralCel OC-H column (250 × 4.6 mm) connected to a Beckman Coulter HPLC system. An isocratic mobile phase of 93% hexanes/7%

METHODS

Cloning, Expression, and Purification. All cloning was performed using Streptomyces nodosus genomic DNA as a template. The DNA encoding AmpKR11 was amplified with primers 5′ATCGTAATCCATATGTGGCGCTACCGCCCGACCTGGAA3′and 5′-TGATTCGATGAATTCACTGCACCTCGGGGACCTCGT-3′ (NdeI and EcoRI restriction sites in italics, stop codon underlined). The DNA encoding Amp(DE+KR)11 was amplified with primers 5′-ATCGTAATCCATATGGCCGCCGCCCCGGAGGCCGTCA-3′ and 5′-TGATTCGATGAATTCAGCGGTGCTGTTCGGCGGCGGGCA-3′ (NdeI and EcoRI restriction sites in italics, stop codon underlined). The DNA encoding AmpKR1 was amplified with primers 5′-GGAGATATACATATGGGCGAGCGCTCCACCGTCGAC-3′ and 5′-CGTAATGCTCGAGTCAGTCGGCCAGCAGCCGCGCCAC-3′ (NdeI and XhoI restriction sites in italics, stop codon underlined). All inserts were digested and ligated into pET28b (Novagen). The cloning of AmpKR2 has been described.12 Expression plasmids were transformed into E. coli BL21(DE3) cells, which were inoculated into LB media containing 50 mg/L kanamycin, grown at 37 °C until OD600 = 0.4, and induced with 0.5 mM IPTG. After 12 h at 15 °C, the cells were collected by centrifugation and resuspended in lysis buffer (300 mM NaCl, and 50 mM HEPES, pH 7.5). Following sonication and removal of cell debris (30,000g for 45 min), the supernatant was poured over a column containing 3 mL of nickel-NTA resin (Qiagen). The column was washed with 50 mL of lysis buffer containing 15 mM imidazole and eluted with 5 mL of lysis buffer containing 300 mM imidazole. Protein was further polished over a Superdex 200 gel filtration column (GE Healthcare Life Sciences) equilibrated with 150 mM NaCl and 10 mM HEPES (pH 7.5). Amp(DE+KR)11 was concentrated to 15 mg /mL in 25 mM NaCl, 1 mM DTT, and 10 mM HEPES (pH 7.5). Crystallization and Structure Determination. Crystals of Amp(DE+KR)11 grew in 4 days at 22 °C by sitting-drop vapor diffusion. Drops contained 2 μL of protein solution (supplied with 5 mM NADP+) and 3 μL of crystallization buffer (20% PEG4K, 200 mM NaCl, and 100 mM HEPES, pH 8.5). Crystals were dehydrated in 35% PEG4K and 10% (v/v) glycerol for 20 min before being frozen in liquid nitrogen. Data collected on Beamline 5.0.2 at the Advanced Light Source were processed with HKL2000, and phases were determined by molecular replacement with Phaser using AmpKR2 1969

dx.doi.org/10.1021/cb400161g | ACS Chem. Biol. 2013, 8, 1964−1971

ACS Chemical Biology

■

ethanol was run at a flow rate of 0.8 mL/min. The stereochemistries of the products were confirmed by comparison with known standards.27 Steady-state kinetic constants were determined for AmpKR2 and AmpKR2(G355T/Q364H) reactions with (±)-2-methyl-3-oxopentanoate-S-NAC by tracking NADPH absorbance at 340 nm over 14 min (BioTek Synergy HT spectrophotometer). Reactions (110 μL total volume) consisted of 50 mM HEPES pH 7.5, 150 mM NaCl, 10% (v/ v) glycerol, 1.3 mM NADPH, 2 μM KR, and 0−200 mM (±)-2methyl-3-oxopentanoate-S-NAC. All components were incubated 20 min before diketide was added and absorbances were measured. Triketide Lactone Synthase Assays. Triketide lactone synthases were constructed by inserting the NdeI/EcoRI fragments of pKOS422108-1 (Loading didomain + EryMod1 + C-terminal docking domain of DEBS1) and pKOS422-99-2 (N-terminal docking domain of DEBS2 + EryMod2 + C-terminal docking domain) into pET21b and pET28b, respectively.24 An AvrII site was engineered upstream of EryACP2 using primers 5′-GCCGGAAACCGAATCCCTAGGCGATCGCTTGGCCGGGC-3′and 5′-GCCCGGCCAAGCGATCGCCTAGGGATTCGGTTTCCGGC-3′. Amp(DE+KR)2 and Amp(DE+KR)11 were then inserted between the PstI and AvrII restriction sites using primers 5′-ATCGTAATCCTGCAGCCGAAGACCGCCGCCCCCGCGGGCACCGCCGA-3′ and 5′-ATCGTAATCCCTAGGGGCGGCACGGCCGCGTCGGCGCCACCGT-3′ as well as 5′-ATCGTAATCCTGCAGGCCGCCGCCCCGGAGGCCGTCA-3′ and 5′ATCGTAATCCCTAGGTCGCCCCGGGCGGGGTCCCCGGCGCTCTGCT-3′ (restriction sites in italics). Mutations were introduced into the triketide lactone synthases with the same primers used for the site-directed mutagenesis of the standalone KR domains. E. coli K207-3 cells transformed with the expression plasmids encoding the triketide lactone synthase were grown at 37 °C in 1 L of LB containing 50 mg/L ampicillin and 25 mg/L kanamycin to OD600 = 0.4 before 5 mM propionate (pH 7.0), 50 mM succinate (pH 7.0), 50 mM glutamate (pH 7.0), and 0.5 mM IPTG were supplemented.34 The cultures were grown for 2 more days at 22 °C. Media were then harvested by centrifugation, brought to pH 3.0 with hydrochloric acid, and extracted with an equal volume of ethyl acetate. Extracts were analyzed by thin-layer chromatography (50% ethyl acetate/hexanes; vanillin stain). Samples containing polyketides were further analyzed by LC−MS. A gradient of 5−95% B (solvent A, water with 0.1% formic acid; solvent B, acetonitrile with 0.1% formic acid) was run using a Gemini C18 column (5 μm, 2 mm × 50 mm) for 12 min using a flow rate of 0.7 mL/min (Agilent Technologies LC−MS system, 1200 Series HPLC, 6130 quadrupole mass spectrometer): triketide ketolactone [M + H]+ expected mass, 171.2 Da, observed mass, 171.2 Da; triketide hydroxylactone [M + H]+ expected mass, 173.2 Da, observed mass, 173.2 Da. To confirm the configuration of C2 and C3 stereocenters of the triketide hydroxylactone, 1H NMR spectra were obtained on a Varian 400-MHz DirectDrive instrument and compared with reported data.35 2D-Triketide hydroxylactone: 1H NMR (CDCl3, 400 MHz) δ 4.13 (ddd, 1H, J = 2.4, 6.4, 7.6 Hz, C5−H), 3.83 (dd, 1H, J = 4.3, 10.3 Hz, C3−H), 2.47 (qd, 1H, J = 7.1, 10.3 Hz, C2−H), 2.17 (ddq, 1H, J = 2.4, 4.3, 6.9 Hz, C4−H), 1.94 (br s, 1H, OH), 1.82 (m, 1H, C6−H), 1.58 (m, 1H, C6−H), 1.41 (d, 3H, J = 7.1 Hz, C8−H), 1.01 (t, 3H, J = 7.5 Hz, C7−H), 0.97 (d, 3H, J = 7.1 Hz, C9−H). 2LTriketide hydroxylactone: 1H NMR (CDCl3, 400 MHz) δ 4.25 (td, 1H, J = 4.7, 9.4 Hz, C5−H), 4.19 (m, 1H, C3−H), 2.80 (dq, 1H, J = 4.5, 7.0 Hz, C2−H), 2.38 (m, 1H, C4−H), 1.85(m, 1H, C6−Ha), 1.61 (m, 1H, C6−Hb), 1.34 (d, 3H, J = 7.0 Hz, C8−H), 1.05 (t, 3H, J = 7.4 Hz, C7−H), 1.05 (d, 3H, J = 7.3 Hz, C9−H).

■

Articles

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS Financial support was provided by Welch Foundation Grant F1712 (A.T.K.-C.). Instrumentation and technical assistance for this work were provided by the Macromolecular Crystallography Facility at the University of Texas at Austin, with financial support from the College of Natural Sciences, the Office of the Executive Vice President and Provost, and the Institute for Cellular and Molecular Biology. The Berkeley Center for Structural Biology is supported in part by the National Institutes of Health, National Institute of General Medical Sciences, and the Howard Hughes Medical Institute. The Advanced Light Source is supported by the Director, Office of Science, Office of Basic Energy Sciences, of the U.S. Department of Energy under Contract No. DE-AC0205CH11231.

■

REFERENCES

(1) Khosla, C., Tang, Y., Chen, A. Y., Schnarr, N. A., and Cane, D. E. (2007) Structure and mechanism of the 6-deoxyerythronolide B synthase. Annu. Rev. Biochem. 76, 195−221. (2) Tsai, S. C., and Ames, B. D. (2009) Structural enzymology of polyketide synthases. Methods Enzymol. 459, 17−47. (3) Kwan, D. H., and Schulz, F. (2011) The stereochemistry of complex polyketide biosynthesis by modular polyketide synthases. Molecules 16, 6092−6115. (4) Keatinge-Clay, A. T. (2012) The structures of type I polyketide synthases. Nat. Prod. Rep. 29, 1050−1073. (5) Zheng, J., and Keatinge-Clay, A. T. (2013) The status of type I polyketide synthase ketoreductases. Med. Chem. Commun. 4, 34−40. (6) Oppermann, U., Filling, C., Hult, M., Shafqat, N., Wu, X., Lindh, M., Shafqat, J., Nordling, E., Kallberg, Y., Persson, B., and Jornvall, H. (2003) Short-chain dehydrogenases/reductases (SDR): the 2002 update. Chem. Biol. Interact. 143−144, 247−253. (7) Kao, C. M., McPherson, M., McDaniel, R. N., Fu, H., Cane, D. E., and Khosla, C. (1998) Alcohol stereochemistry in polyketide backbones is controlled by the β-ketoreductase domains of modular polyketide synthases. J. Am. Chem. Soc. 120, 2478−2479. (8) Siskos, A. P., Baerga-Ortiz, A., Bali, S., Stein, V., Mamdani, H., Spiteller, D., Popovic, B., Spencer, J. B., Staunton, J., Weissman, K. J., and Leadlay, P. F. (2005) Molecular basis of Celmer’s rules: stereochemistry of catalysis by isolated ketoreductase domains from modular polyketide synthases. Chem. Biol. 12, 1145−1153. (9) Valenzano, C. R., Lawson, R. J., Chen, A. Y., Khosla, C., and Cane, D. E. (2009) The biochemical basis for stereochemical control in polyketide biosynthesis. J. Am. Chem. Soc. 131, 18501−18511. (10) Keatinge-Clay, A. T., and Stroud, R. M. (2006) The structure of a ketoreductase determines the organization of the beta-carbon processing enzymes of modular polyketide synthases. Structure 14, 737−748. (11) Keatinge-Clay, A. T. (2007) A tylosin ketoreductase reveals how chirality is determined in polyketides. Chem. Biol. 14, 898−908. (12) Zheng, J., Taylor, C. A., Piasecki, S. K., and Keatinge-Clay, A. T. (2010) Structural and functional analysis of A-type ketoreductases from the amphotericin modular polyketide synthase. Structure 18, 913−922. (13) Reid, R., Piagentini, M., Rodriguez, E., Ashley, G., Viswanathan, N., Carney, J., Santi, D. V., Hutchinson, C. R., and McDaniel, R. (2003) A model of structure and catalysis for ketoreductase domains in modular polyketide synthases. Biochemistry 42, 72−79.

ASSOCIATED CONTENT

S Supporting Information *

This material is available free of charge via the Internet at http://pubs.acs.org. Accession Codes

The atomic coordinates of Amp(DE+KR)11 and AmpKR2(G355T/Q364H) have been deposited in the PDB with accession codes 4L4X and 4DIF, respectively. 1970

dx.doi.org/10.1021/cb400161g | ACS Chem. Biol. 2013, 8, 1964−1971

ACS Chemical Biology

Articles

(14) Caffrey, P. (2003) Conserved amino acid residues correlating with ketoreductase stereospecificity in modular polyketide synthases. ChemBioChem 4, 654−657. (15) Caffrey, P., Lynch, S., Flood, E., Finnan, S., and Oliynyk, M. (2001) Amphotericin biosynthesis in Streptomyces nodosus: deductions from analysis of polyketide synthase and late genes. Chem. Biol. 8, 713−723. (16) Zheng, J., and Keatinge-Clay, A. T. (2011) Structural and functional analysis of C2-type ketoreductases from modular polyketide synthases. J. Mol. Biol. 410, 105−117. (17) Zheng, J., Fage, C. D., Demeler, B. D., Hoffman, D. W., and Keatinge-Clay, A. T. (2013) The missing linker: a dimerization motif located within polyketide synthase modules. ACS Chem. Biol., DOI: 10.1021/cb400047s. (18) Heras, B., and Martin, J. L. (2005) Post-crystallization treatments for improving diffraction quality of protein crystals. Acta Crystallogr., Sect. D: Biol. Crystallogr. 61, 1173−1180. (19) Krissinel, E., and Henrick, K. (2004) Secondary-structure matching (SSM), a new tool for fast protein structure alignment in three dimensions. Acta Crystallogr., Sect. D: Biol. Crystallogr. 60, 2256− 2268. (20) Dutta, D., Bhattacharyya, S., Roychowdhury, A., Biswas, R., and Das, A. K. (2013) Crystal structure of hexanoyl-CoA bound to βketoacyl reductase FabG4 of Mycobacterium tuberculosis. Biochem. J. 450, 127−139. (21) Stinear, T. P., Mve-Obiang, A., Small, P. L., Frigui, W., Pryor, M. J., Brosch, R., Jenkin, G. A., Johnson, P. D., Davies, J. K., Lee, R. E., Adusumilli, S., Garnier, T., Haydock, S. F., Leadlay, P. F., and Cole, S. T. (2004) Giant plasmid-encoded polyketide synthases produce the macrolide toxin of Mycobacterium ulcerans. Proc. Natl. Acad. Sci. U.S.A. 101, 1345−1349. (22) Baerga-Ortiz, A., Popovic, B., Siskos, A. P., O’Hare, H. M., Spiteller, D., Williams, M. G., Campillo, N., Spencer, J. B., and Leadlay, P. F. (2006) Directed mutagenesis alters the stereochemistry of catalysis by isolated ketoreductase domains from the erythromycin polyketide synthase. Chem. Biol. 13, 277−285. (23) Kwan, D. H., Tosin, M., Schlager, N., Schulz, F., and Leadlay, P. F. (2011) Insights into the stereospecificity of ketoreduction in a modular polyketide synthase. Org. Biomol. Chem. 9, 2053−2056. (24) Menzella, H. G., Reid, R., Carney, J. R., Chandran, S. S., Reisinger, S. J., Patel, K. G., Hopwood, D. A., and Santi, D. V. (2005) Combinatorial polyketide biosynthesis by de novo design and rearrangement of modular polyketide synthase genes. Nat. Biotechnol. 23, 1171−1176. (25) Tsai, S. C., Miercke, L. J., Krucinski, J., Gokhale, R., Chen, J. D., Foster, P. G., Cane, D. E., Khosla, C., and Stroud, R. M. (2001) Crystal structure of the macrocycle-forming thioesterase domain of the erythromycin polyketide synthase: versatility from a unique substrate channel. Proc. Natl. Acad. Sci. U.S.A. 98, 14808−14813. (26) Kellenberger, L., Galloway, I. S., Sauter, G., Böhm, G., Hanefeld, U., Cortés, J., Staunton, J., and Leadlay, P. F. (2008) A polylinker approach to reductive loop swaps in modular polyketide synthases. ChemBioChem 9, 2740−2749. (27) Piasecki, S. K., Taylor, C. A., Detelich, J. F., Liu, J., Zheng, J., Komsoukaniants, A., Siegel, D. R., and Keatinge-Clay, A. T. (2011) Employing modular polyketide synthase ketoreductases as biocatalysts in the preparative chemoenzymatic syntheses of diketide chiral building blocks. Chem. Biol. 18, 1331−40. (28) Sharma, K. K., and Boddy, C. N. (2007) The thioesterase domain from thepimaricin and erythromycin biosynthetic pathways can catalyze hydrolysis of simple thioester substrates. Bioorg. Med. Chem. Lett. 17, 3034−3037. (29) Otwinowski, Z., and Minor, W. (1997) Processing of X-ray diffraction data collected in oscillation mode, in Methods in Enzymology, Vol. 276: Macromolecular Crystallography, Part A, Carter, C.W., Jr. and Sweet, R.M., Eds., pp 307−326 (New York: Academic Press).

(30) Potterton, E., Briggs, P., Turkenburg, M., and Dodson, E. (2003) A graphical user interface to the CCP4 program suite. Acta Crystallogr., Sect. D: Biol. Crystallogr. 59, 1131−1137. (31) McCoy, A. J., Grosse-Kunstleve, R. W., Adams, P. D., Winn, M. D., Storoni, L. C., and Read, R. J. (2007) Phaser crystallographic software. J. Appl. Crystallogr. 40, 658−674. (32) Emsley, P., and Cowtan, K. (2004) Coot: model-building tools for molecular graphics. Acta Crystallogr., Sect. D: Biol. Crystallogr. 60, 2126−2132. (33) Murshudov, G. N., Vagin, A. A., and Dodson, E. J. (1997) Refinement of macromolecular structures by the maximum-likelihood method. Acta Crystallogr., Sect. D: Biol. Crystallogr. 53, 240−255. (34) Murli, S., Kennedy, J., Dayem, L. C., Carney, J. R., and Kealey, J. T. (2003) Metabolic engineering of Escherichia coli for improved 6deoxyerythronolide B production. J. Ind. Microbiol. Biotechnol. 30, 500−509. (35) Castonguay, R., He, W., Chen, A. Y., Khosla, C., and Cane, D. E. (2007) Stereospecificity of ketoreductase domains of the 6deoxyerythronolide B synthase. J. Am. Chem. Soc. 129, 13758−13769.

1971

dx.doi.org/10.1021/cb400161g | ACS Chem. Biol. 2013, 8, 1964−1971