Surface Modification Studies of Edge-Oriented Molybdenum Sulfide

Jun 26, 2004 - We have synthesized edge-oriented MoS2 nanosheets by the evaporation of a single source precursor based on Mo(IV)-tetrakis(diethylamino...
0 downloads 13 Views 866KB Size
Download PDF
6914

Langmuir 2004, 20, 6914-6920

Surface Modification Studies of Edge-Oriented Molybdenum Sulfide Nanosheets Heng Zhang,† Kian Ping Loh,*,† Chorng Haur Sow,‡ Huiru Gu,† Xiaodi Su,§ Chun Huang,† and Zhi Kuan Chen§ Department of Chemistry, National University of Singapore, 3 Science Drive 3, Singapore 117543, Department of Physics, National University of Singapore, 2 Science Drive 3, Singapore 117542, and Institute of Materials Research and Engineering, 3 Research Link, Singapore 117602 Received January 13, 2004. In Final Form: April 17, 2004 We have synthesized edge-oriented MoS2 nanosheets by the evaporation of a single source precursor based on Mo(IV)-tetrakis(diethylaminodithiocarbomato). The surface chemistry of the MoS2 nanosheets has been studied in order to evaluate the chemical reactivities of the basal planes and edges. By irradiating the MoS2 nanosheet with a scanning infrared laser, micron-scale lithographical structures can be created due to laser-induced oxidation of MoS2 to form nanocrystalline MoO3. Preferential reactivities of the MoS2 basal edges in an electrochemical environment and during vapor phase deposition have been demonstrated. Functionalization of the basal plane with 1-pyrene acetic acid allows the immobilization of DNA and immunoglobins on the MoS2 basal plane.

Layered transition metal dichalcogenides such as molybdenum sulfide (MoS2) are highly versatile with regard to industrial applications; these include high-temperature lubricants,1 hydrodesulfurization catalysts,2 and photocathodes.3 Creating functional nanosystems from MoS2 represents a significant challenge in the field of nanoscale science. The layered S-Mo-S crystal structure can give rise to different structural motifs which range from fullerene-like nanoclusters with ultralow friction properties,4 to nanotubes, which have been shown to be efficient hydrogen storage devices useful in fuel cells.5,6 The wide spacing of 0.615 nm between interplanar molybdenum in MoS2 affords a large surface area to trap physiosorbed hydrogen and for intercalation with planar cyclic organic molecules. The relationship between structure and form in MoS2 is interesting; that is, the weak van der Waals bonding between the basal plane is responsible for its lubrication properties, while the structural motifs of its faceted edges control the catalytic properties. Depending on the type of end applications, either edge-oriented films or basal-plane-oriented films should be fabricated. Modifying MoS2 with Co has been found to change the surface reconstructions on the edge sites, exposing the dangling bonds on Mo to form active catalytic sites.7-9 * To whom correspondence should be addressed. E-mail: [email protected] (K. P. Loh). Fax: (65) 67791691. † Department of Chemistry, National University of Singapore. ‡ Department of Physics, National University of Singapore. § Institute of Materials Research and Engineering. (1) Fleischauer, P. D.; Lince, J. R.; Bertrand, P.A.; Bauer, R. Langmuir 1989, 5, 1009. (2) Pecoraro, T. A.; Chinanelli, R. R. J. Catal. 1981, 67, 430. (3) Photochemistry and Photovoltaics of Layered Semiconductors; Aruchamy, A., Ed.; Kluvert: Dordrecht, 1992; p 2. (4) Rapoport, L.; Bibik, Yu.; Feldman, Y.; Homyonfer, M.; Cohen, S. R.; Tenne, R. Nature 1997, 387, 791. (5) Jun, C.; Nobuhiro, K.; Huatang, Y. J. Am. Chem. Soc. 2001, 123, 11813. (6) Chen, J.; Li, S. L.; Tao, Z. L. J. Alloys Compd. 2003, 356-357, 413. (7) Bollinger, M. V.; Jacobsen, K. W.; Norskov, J. K. Phys. Rev. B 2003, 67, 5411-5417. (8) Bollinger, M. V.; Lauritsen, J. V.; Jacobsen, K. W.; Norskov, J. K.; Helveg, S.; Besenbacher, F. Phys. Rev. Lett. 2001, 87, 196803196805. (9) Lauritsen, J. V.; Helveg, S.; Lagsgaard, E.; Stensgaard, I.; Clausen, B. S.; Topsoe, H.; Besenbacher, F. J. Catal. 2001, 197, 1.

Here we report for the first time a simple way of producing MoS2 two-dimensional (2-D) sheets by the onestep evaporation of the single source precursor tetrakis(diethylaminodithiocarbomato)molybdate(IV) (abbreviated as Mo(dedtc)4. We found that this precursor dissociated cleanly on a wide range of substrates to yield edge-oriented, high crystalline quality MoS2 nanosheets. This paper describes the surface chemistry investigations on these unique MoS2 nanosheets where we probe the chemistry on the edge and basal surfaces, respectively. Experimental Section Growth of MoS2. The one-step synthesis of Mo(dedtc)4 was performed using Schlenk tubes in an oxygen-free nitrogen atmosphere. Solvents were distilled by standard techniques and thoroughly deoxygenated before use. Essentially, Mo(CO)6 (0.82 g, 3.1 mmol) was stirred and refluxed at a temperature of 58 °C with bis(diethylthiocarbamoyl)disulfide (0.8 g of 2.7 mmol) in 25 cm3 of acetone under an oxygen-free nitrogen atmosphere for 2 h. The violet precipitate that appeared at room temperature was filtered and washed with pentane, dried, and annealed at 150 °C to evaporate off residual impurities. Thermogravimetric analysis (TGA) revealed a single weight loss step after this at 300 °C that corresponded to the evaporation of the precursor. The precursor was found to be air and moisture insensitive and could be used after storage in air for more than 1 year. Thermal evaporation of the precursor took place in a boron nitride Knudsen cell maintained at 300 °C. Tantalum foil was used as the substrate when the intention was to use the deposited MoS2 film as the working electrode, with tantalum as the backing support, in the cyclic voltammetry study. Biosensing Procedures. MoS2 samples were first dipped in 1-pyrene acetic acid for 3 h and then dipped in 60 µL of 10 µM NH2-FITC-DNA probe solution (the probe sequence was 5′GCACCTGACTCCTGTGGAGAAGTCTGC CGT-3′, with a C12alkylamino label and a FITC label at the 5′end, diluted in 0.1 M Na3PO4 buffer solution (pH 7.0) and kept in a humid incubation box for 10 h. The probe solution also contained 20 mg/mL 1-ethyl3-(3-dimethylaminopropyl)-carbo-diimide (EDC), which was used to activate the COOH groups of the pyrene-modified MoS2 sample surface. At the end of probe incubation, MoS2 samples were rinsed by 0.1 M Na3PO4 buffer thoroughly, dried by N2 flow, and put into 60 µL of 10 µM Cy5-labeled target DNA solution (diluted in 2×SSC buffer solution, pH 7.0) for hybridization. This target DNA has the sequence fully complementary to that of NH2FITC-DNA probes (5′-ACGGCAGACTTCTCCACAGGAGTCAGGTGC-3′) and a Cy5 label at the 5′ end. After 30 min of

10.1021/la049887t CCC: $27.50 © 2004 American Chemical Society Published on Web 06/26/2004

Edge-Oriented MoS2 Nanosheets

Langmuir, Vol. 20, No. 16, 2004 6915 were carried out on unmodified MoS2 while the procedure remained the same. Assaying the Concentration of Carboxylic Functional Groups on MoS2. To assay the concentration of carboxylic functional groups on the MoS2 nanosheets, samples of pyrenemodified MoS2 nanosheets were incubated with 1 mL of toluidine blue O (TBO) solution (0.5 mM) in 0.1 mM NaOH (pH 10) under constant shaking for 5 h at room temperature. Uncomplexed dye was removed by washing with an excess amount of 0.1 mM NaOH solution. The complexed TBO on pyrene-modified MoS2 was desorbed from the surface by incubating the sample in 1 mL of 50% acetic acid for 10 min, under vortexing. The concentration of the complexed TBO in the acetic acid solution was determined by its absorption at 633 nm with a Beckman DU640B spectrophotometer. The density of carboxyl groups on the surface was calculated from the complexed TBO content assuming that TBO complexes with carboxyl acid in a 1:1 ratio.

Figure 1. Structure of Mo(IV)-tetrakis(diethylaminothiocarbomato), the single source precursor used for the thermal evaporation of MoS2 nanowalled films. hybridization, samples were rinsed by 2×SSC buffer solution and analyzed by fluorescence microscope. To adsorb larger biomolecules that can be visualized by scanning electron microscopy (SEM), MoS2 samples (modified) were put into 100 µL of 57 µg/mL Human IgG solution (diluted by 1:100 in phosphate-buffered saline (PBS), pH 7.4), containing 20 mg/mL of EDC. The incubation time was 30 min. Control experiments

Results and Discussion In our experiments, the MoS2 nanosheets were produced by thermal evaporation of Mo(dedtc)4 at 300 °C. The single source precursor was generated from a one-step synthesis.10

Mo(CO)6(s) + 2Et2NC(S)SSC(S)NEt2(s) f Mo(dedtc)4(s) + 6CO(g)

Figure 2. SEM images of MoS2 nanowalled films deposited on nickel at different temperatures from (a) room temperature to (b) 400 °C, (c) 500 °C, and (d) 600 °C, respectively.

6916

Langmuir, Vol. 20, No. 16, 2004

Zhang et al.

Figure 4. High-magnification SEM images showing a MoS2 nanocone nucleating on the edges of the first-layer MoS2 nanosheet.

Figure 3. TEM image showing MoS2 triangular sheets (right, top) and the MoS2 nanosheet viewed from the side (left, top). The diffraction pattern of the single crystalline hexagonal MoS2 is shown below.

The structure of Mo(dedtc)4 is indicated in Figure 1. We found that this precursor decomposes cleanly on a wide range of substrates at temperatures above 350 °C to produce solid MoS2. The carbon, sulfur, and nitrogen moieties in the molecule escape as gaseous ethylene, sulfur, and hydrogen cyanide, respectively, following the decomposition. This is the first report of the use of a single source precursor for the growth of crystalline MoS2 films by thermal evaporation. The advantages are that the technique is simple, it is scalable to an industrial-scale process, and there is no need to use toxic hydrogen sulfide as the sulfur source. Figure 2a shows a typical scanning electron micrograph of the MoS2 grown on metal substrates (nickel) at 400 °C using Mo(dedtc)4. A high density of edge-oriented, triangular 2-D sheets with widths of about 1 µm and with nanoscale thickness can be seen. These triangular MoS2 sheets exhibit numerous sharp basal edges, affording a high density of reactive prismatic sites. Figure 3 shows the transmission electron microscopy (TEM) image of the triangular MoS2 sheet; the diffraction pattern indicates single crystalline phase, and it agrees with the hexagonal crystallographic symmetry of the (0002) face of MoS2. We (10) Decoster, M.; Conan, F.; Guerchais, J. E.; Mest, Y. L.; Pala, J. S. Polyhedron 1995, 14, 1741.

Figure 5. From left to right, the schematic shows how a MoS2 nanosheet nucleating on the tip of the MoS2 below can curl and form a nanocone because the edges are close to one another at the tip junction.

can see that the side-on, high-resolution TEM image of a single MoS2 nanosheet consists of between three and six van der Waals layers; the interlayer spacing between the lamellar sheets of 0.615 nm is consistent with the (0002) interlayer spacing of two Mo centers in MoS2. The single source precursor route allows us to control the structural morphology of the MoS2 films by varying the substrate temperature during deposition. Figure 2a-d shows the changes in the morphologies when the MoS2 films are grown at higher substrate temperatures on nickel. The trend is for the nanosheets to curl and form an inverted nanocone as the temperature increases. These inverted nanocones sometimes consist of several straightsection MoS2 basal planes joined edge-to-edge and at times are grown from a single rolled-up sheet, as can be seen in the high-magnification images of the individual nanocones in Figure 4a,b. It can also be seen that the nanocone nucleates on the sharp tips of the first-layer MoS2 nanosheets. A schematic illustrating their formation mechanism is shown in Figure 5. Following the growth of first-layer MoS2, secondary layers of MoS2 nucleate at

Edge-Oriented MoS2 Nanosheets

Langmuir, Vol. 20, No. 16, 2004 6917

Figure 6. SEM showing stages in the platinization of MoS2 nanowalled films by cyclic voltammetry. Scan rate, 100 mV/s; electrolyte, 0.1 M H2PtCl6. Note that initially, the Pt only adsorbs on the basal edges.

the tip regions of the first layers. For a nanosheet nucleating on the tip, the activation barrier for the edges on the two sides to curl round can be overcome if thermal activation is provided. The curling around of the nanosheet forms a “nanoflower” nucleus; the flared edges of the nanoflower continue to grow and develop into a micronsized “nanocone” ultimately. The sharp basal edges of the MoS2 2-D triangular sheets are sites of preferential reactivity. An experiment to assess the relative reactivities of the basal edge and basal face involved the electrochemical deposition of Pt on the MoS2 nanowall films. Figure 6 shows the SEM visualization of the deposition of Pt by cyclic voltammetry on the MoS2 nanosheets. Initially, the deposition of Pt occurs only on the edges of the MoS2 nanosheets; after the edges are fully covered, the deposition occurs on the basal plane. The preferential assembly along the edges of the nanosheets points to the potential of assembling dimensional metal wires or polymer lines along the edges of MoS2. Another important implication for the high density of reactive edges is the possibility of modifying the catalytic reactivity of the MoS2 by edge site substitution with transition metals such as cobalt to form bimetallic catalytic sites. Previous scanning tunneling microscopy studies of MoS2 atomic clusters have shown that edge modifications are responsible for the enhanced catalytic activity in hydrodesulfurization catalysis.7-9 We also performed the chemical vapor deposition of hexagonal boron nitride (h-BN) layers on MoS2 to see if heterogrowth between two types of hexagonal crystal systems can occur. The conditions used involved the plasma discharge of borazine (B3N3H6) precursors with a deposition temperature of 900 °C on the MoS2 nanosheets. Electron microscopy and energy dispersive X-microprobe (EDX) analysis in Figure 7 verify that the deposition of BN occurred primarily on the edges of the film with little visible growth on the basal planes, attesting to the marked contrast in the reactivity of the basal edges and the basal planes. Due to the selective deposition on the edges, rodlike BN crystals are formed around the MoS2 edges as visualized by SEM. Raman spectroscopy confirmed that the deposit is crystalline hexagonal BN, coexisting with MoS2. The experiment suggests that it should be possible to passivate the reactive basal edge by the selective growth of thin films on the edges. The band gap of MoS2 is sufficiently small (1.77 eV), so photochemical-induced reaction by IR light is possible. Moreover, the high density of reactive edges on the edgeoriented MoS2 allows oxidation to proceed more readily on the edges compared to single-crystal MoS2. The direct visual observation of anisotropic oxidation on the edges of MoS2 has not been reported. Lime and Frantz11 observed

Figure 7. (a) SEM image showing the preferential coating of h-BN on the basal edges of MoS2. (b) TEM image showing the same. The elemental composition is verified by EDX, inserted as an inset.

greater oxidation fractions in their X-ray photoelectron spectroscopy studies of MoS2 brushes used in space lubricants when the edges of the MoS2 were oriented to the analyzer. In this study, we directly probed the oxidation chemistry on the edges by performing localized oxidation. The laser-induced oxidation of the MoS2 nanosheets was carried out by scanning a He-Ne laser with a micronsized focusing spot on the films. Details of the setup of the laser used for the laser trimming of carbon nanotubes have been described previously.12 Essentially, the laser beam from a He-Ne laser was focused onto the MoS2 sample through an optical microscope and the sample was (11) Lime, J. R.; Frantz, P. P. Tribol. Lett. 2000, 9, 211. (12) Lim, K. Y.; Sow, C. H.; Lin, J.; Cheong, F. C.; Shen, Z. X.; Thong, J. T. L.; Chin, K. C.; Wee, A. T. S. Adv. Mater. 2003, 15, 300.

6918

Langmuir, Vol. 20, No. 16, 2004

Zhang et al.

Figure 8. (a) SEM image of the letters “NUS” written on the MoS2 films in ambient using an IR laser focused through an optical microscope. (b) High-magnification view showing that oxidation occurred initially on the basal edge. (c) Confocal Raman spectrum of an area not exposed to laser irradiation (remains as MoS2). (d) Raman spectrum of the laser-trimmed area which has transformed to MoO3.

Figure 10. Fluorescence assay of the sensing NH2-FITCDNA probes (green) and target Cy5-labeled DNA (red), imaged separately using image filters. The spatial overlap of the fluorescence indicates the absence of nonspecific adsorption.

Figure 9. CV showing the redox couple of hemin immobilized on MoS2.

moved on a motorized X-Y stage. The laser could be focused down to a beam diameter of about 1 µm and scanned on the surface in air, inducing local oxidation. By control of the laser power, features ranging from a deep recess cut to a superficial brush could be created. Figure 8a shows the image of micron-scale letters “NUS” created on the MoS2 films where the flat area around the characters consisted of MoO3. A zoom-in SEM view in Figure 8b of the initial stage of laser irradiation on the MoS2 reveals that the edges of the MoS2 are frayed and replaced by nanocrystalline MoO3, thus indicating that the anisotropic oxidation favors the edges at first. With

longer irradiation time, the entire MoS2 sheet will be transformed into nanocrystalline MoO3. The contrast arising from the topographical variation of the film is due to the volume reduction which accompanies the transformation of MoS2 sheets into nanocrystalline MoO3 after laser-induced oxidation in air. The different phases have been verified by performing confocal Raman microscopy on the modified area and the unmodified area. The respective Raman signatures agree very well with those of standard reference samples of single crystalline MoS2 and powder crystalline MoO3, as shown in Figure 8c,d, respectively. The Raman peaks at 383 and 408 cm-1 correspond to the E12g mode and the A1g modes of hexagonal MoS2 peaks, respectively.13 The Raman spectrum of MoO3 shows three peaks at 665, 817, and 995 cm-1 corresponding to the O-Mo3 B3g mode, the O-Mo2 B1g mode, and the O-Mo A1g mode, respectively.14 Because MoO3 is soluble in water, this suggests that a positive photoresist based (13) Frey, G. L.; Tenne, R. Phys. Rev. B 1999, 60, 2883.

Edge-Oriented MoS2 Nanosheets

Langmuir, Vol. 20, No. 16, 2004 6919

Figure 11. SEM image showing globular deposits on the basal plane of MoS2 due to adsorption of human immunoglobins: (left) before adsorption; (right) after adsorption.

Figure 12. CV showing the voltammetric peaks of dopamine. Scan rate, 100 mV/s; pH 7 PBS buffer.

on MoS2 can be fabricated by performing optical lithography on MoS2 film in air. We have demonstrated that edge-oriented films show preferential reactivity toward electrochemical and chemical vapor deposition as well as laser modification. The next question is, can we induce reaction on the basal plane by taking advantage of its high surface area? We tested the affinity of the MoS2 film for different types of biomolecules. The MoS2 nanowalled film can be functionalized readily with certain biomolecules by simply dipping in a buffer solution containing the biomolecules. For example, immobilization of the biomolecule hemin can be achieved on the film without any surface pretreatment of the MoS2. Hemin is a well-known natural metalloporphyrin useful as a mimetic enzyme for labeling antigen and antibody reactions, with an iron redox center in the molecule.15,16 Figure 9 shows the cyclic voltammogram (CV) of immobilized hemin on MoS2 where the redox couple is due to a single electron process between Fe2+ and Fe3+ in the hemin molecule. When we dipped a dense carbon nanotube (CNT) electrode into a similar buffer (14) Nazri, G. A.; Julie, N. C. Solid State Ionics 1992, 376, 53. (15) Zheng, N.; Zeng, Y.; Osborne, P. G.; Li, Y. J. Appl. Electrochem. 2002, 32, 129. (16) Chen, G. N.; Zhao, Z. F.; Wang, X. L. Anal. Chim. Acta 2002, 452, 245.

Figure 13. CV showing the voltammetric peaks of ascorbic acid. Scan rate, 100 mV/s; pH 7 PBS buffer.

solution containing hemin, it was found that the highdensity CNT array failed to adsorb any hemin, as judged from the absence of redox signals in the CV, suggesting that the reactivity with hemin is specific to MoS2. Unmodified MoS2 films show no strong affinity for DNA. We investigated this by dipping the MoS2 films in buffer containing fluorescent-labeled DNA biomolecules but observed no evidence of adsorption as judged by the lack of fluorescence. Surface modification based on carboimide chemistry is carried out to activate the basal plane for reaction. The MoS2 film is treated with 1-pyrene acetic acid in order to introduce COOH groups on the basal planes of the MoS2 for tethering to NH2-terminal DNA and proteins. 1-Pyrene acetic acid has four six-membered rings which can adsorb via van der Waals bonding on graphitic planes, although the adsorption on MoS2 will be incommensurate due to the incompatibility of the unit cell structures. Nevertheless, Fourier transform infrared spectroscopy shows that following treatment with 1-pyrene acetic acid and washing with buffer solution, there are distinct peaks at 1700 and 1650 cm-1 assignable to the CdO and C-C stretches. The density of the carboxylic groups on the MoS2 nanosheets was assayed by the complexing dye toluidine blue17 and revealed a density of 12.5 nmol/cm2 (refer to the Experimental Section for (17) Kato, S. S.; Ikada, K. Y. Biomaterials 1993, 14, 817.

6920

Langmuir, Vol. 20, No. 16, 2004

details). EDC was used to activate the COOH groups of the MoS2 samples to facilitate the formation of amide bonds with the NH2-FITC-DNA probe. The DNA-immobilized MoS2 was then used to assay for the Cy5-labeled complementary DNA. By using the different emission filters, NH2-FITC-DNA probes (green) and Cy5-labeled targets (red) were imaged separately, as shown in Figure 10. It can be seen that the red spots overlap with the regions of green spots, evidencing specific interactions between the sensing and complementary base pairs. The control experiment which was conducted using unmodified MoS2 showed no fluorescence. To show that the biomolecules were actually adsorbing on the basal plane, we used largersized biomolecules such as human immunoglobins and performed the same immobilization chemistry steps on the NH2-functionalized immunoglobins on COOH-functionalized MoS2. Following the treatment, SEM visualization of the MoS2 basal planes in Figure 11 shows that there are globular adsorbates on the pyrene-treated surface and no adsorbates on the control sample, thus confirming uptake of the biomolecules on the basal plane. To evaluate the electrochemical response of the MoS2 edge-oriented film to biomolecules, the MoS2 nanosheets grown on tantalum was used directly as a working electrode in this work. The effective surface area of the MoS2 electrode was estimated by cyclic voltammetry using 5 mM K3[Fe(CN)6]/1M KCl as a probe at various scan rates. The slope of the straight line of the plot Ipc versus v1/2 can be substituted into the equation

Ip ) (2.69 × 105)n2/3AD1/2v1/2C0 to calculate the effective surface area A. The slope of the straight line of Ip versus n1/2 is 3.87 × 10-5 A s1/2 V-1/2 for MoS2. Accordingly, the effective surface areas were estimated to be 4.68 × 10-3 cm-2. This value however is about an order smaller than the value obtained on a dense carbon nanotube sample grown in our laboratory. The ability of the MoS2 nanowalled film to act as an electrode for biochemical sensing was evaluated for dopamine (DA) and ascorbic acid (L-AA) using cyclic

Zhang et al.

voltammetry. DA is an important neurotransmitter that affects Parkinson’s disease, while L-AA is an interferent to its voltammetric detection due to the overlap of the anodic peak potentials. Figure 12 shows the voltammograms as a function of scan rate for the voltammetric detection of DA. The two oxidation states of DA can be resolved on MoS2, judging from the presence of two pairs of redox peaks. There is no sign of fouling of the MoS2 electrode after repeated cyclings. Good voltammetric response to L-AA has also been obtained, as shown in Figure 13. A plot of peak current versus the square root of scan rate is linear for both of these biomolecules, suggesting diffusion-controlled kinetics on MoS2. However, no differentiation between L-AA and DA can be attained because the anodic peaks occur at the same potential. Future work will look at possible surface modification of the MoS2, possibly with nano-gold clusters to enhance the selectivity of the response. Conclusions Edge-oriented MoS2 films have been synthesized for the first time by the evaporation of a single source precursor based on Mo(IV)-tetrakis(diethylaminodithiocarbomato). We have performed various reactions to evaluate the reactivities of the films and observed that the basal edges show preferential reactivity compared to the basal planes in electrochemical and chemical vapor deposition reactions. The MoS2 nanosheets are readily converted to MoO3 in air using an IR laser, and microlithographical structures of MoO3 could be directly written on the MoS2 films. The basal planes, generally unreactive, can act as a template for the immobilization of biomolecules after modification with 1-pyrene acetic acid. The voltammetric sensing of dopamine and ascorbic acid is also possible using the nanowalled MoS2 film as a working electrode. Acknowledgment. Professor Kian Ping Loh wishes to thank NUS Academic Grant Number R-143-000-221112 for the support of this project. We also thank Professor J. J. Vittal and Dr. M. Vetrichelvan for their helpful advice. LA049887T