Surface-Plasmon-Coupled Fluorescence Enhancement Based on

Subscriber access provided by UB + Fachbibliothek Chemie | (FU-Bibliothekssystem)

Article

Surface plasmon coupled fluorescence enhancement based on ordered gold nanorod array biochip for ultra-sensitive DNA analysis Zhong Mei, and Liang Tang Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.6b02797 • Publication Date (Web): 08 Nov 2016 Downloaded from http://pubs.acs.org on November 9, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Analytical Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Surface plasmon coupled fluorescence enhancement based on ordered gold nanorod array biochip for ultra-sensitive DNA analysis Zhong Mei, Liang Tang* Department of Biomedical Engineering, University of Texas at San Antonio San Antonio, TX 78249 USA

*Corresponding author Liang Tang, PhD Department of Biomedical Engineering University of Texas at San Antonio 1 UTSA Circle San Antonio, TX 78249 Email: [email protected] Tel: +01 210-458-6557; Fax: +01 210-458-7007

1 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 23

Abstract An innovative gold nanorod (GNR) array biochip was developed to systematically investigate the localized surface plasmon resonance (LSPR) coupled fluorescence enhancement for signal amplification in molecular beacon detection. Ordered GNR assembly in vertical standing array on glass surface was fabricated as plasmonic substrates, resulting in dramatically intensified LSPR between adjacent nanoparticles as compared to that from ensemble of random nanorods. We have shown that the plasmonic response of the nanoarray can be tuned by the proper choice of GNR size to overlap the fluorophore excitation and emission wavelengths greater than 600 nm. Plasmon induced fluorescence enhancement was found to be distance dependent with the competition between quenching and enhancement by the metal nanostructures. The augmented fluorescence enhancement by the GNR array can efficiently overcome the quenching effect of the gold nanoparticle even at close proximity. The enhancement correlates with the spectral overlap between the fluorophore excitation/emission and the plasmonic resonance of the GNR array, indicating a surface plasmon-enhanced excitation and radiative mechanism for the amplification. From these results, the applicability of the ordered GNR array chip was extended to molecular fluorescence enhancement for practical use as a highly functional and ultrasensitive plasmonic DNA biochip in molecular beacon fashion.

Keywords: Fluorescence enhancement, metal-enhanced fluorescence, localized surface plasmon resonance, gold nanorod array, DNA biochip


Page 3 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction Fabrication of biochips based on plasmonic nanoparticles has attracted increasing interests for its robust, rapid and convenient detection.1,2 These biochips utilize localized surface plasmon resonance (LSPR) as optical transduction of biological binding events. Its sensitivity to changes in the local refractive index exhibits a red shift of the spectral band in proportional to target binding on the plamonic surface.3-6 Although LSPR biosensing is very simple to implement, the actual spectral sensitivity is usually limited. It remains a challenge for practical LSPR sensors based on the spectral shift only to detect biomolecules at extremely low level, which is highly desired for biomedical diagnosis.7-9 On the contrary, fluorescence detection has a great potential to be exploited for highly sensitive bioanalytical applications in life sciences.10-13 Recently, dramatic fluorescence enhancement induced by the LSPR of metallic nanostructures has been reported to enable fluorescence based detection with high sensitivity.14-16 The metal enhanced fluorescence (MEF) can be attributed to at least (1) excitation enhancement due to strong local electric fields associated with the excitation of LSPR, and (2) increase in the radiative decay rate from a surface plasmon resonance-coupled excited state of the fluorophore.17,18 As such, LSPR amplification in nanostructures can directly lead to fluorescence intensity increase. One approach is to fabricate substrates consisting of regular arrays of noble metal nanoparticles to exploit strong electric fields (hot spot) at the gap between two neighboring particles to create intensified LSPR. To optimize the efficiency of this process, a good spectral overlap between emission band and the surface plasmon band of the metallic substrate is needed.19 It is therefore crucial to design and fabricate MEF substrates which offer the possibility of LSPR tuning in order to match the excitation/emission wavelength of desired fluorophores. One difficulty in practice is the precise nanostructure platform construction to yield a homogeneous hot spot surface.20 Ordered 3 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 23

arrays of plasmonic crystals defined by electron-beam lithography are reproducible and tunable, but imply a high cost and low throughput.21 A good alternative can be nanosphere lithography, in which close-packed arrays of base nano/microspheres are used as templates for metal film evaporation. An interconnected network of silver or copper half shells templated on polystyrene or silica microsphers were reported for such purpose.22-24 However, silver is reactive to be easily oxidized. The precise tuning of the LSPR wavelength from visible to near infrared region by changing the diameter of the underlying micro/nano-structures is not straightforward. Moreover, the generation of Cu LSPR at a longer wavelength than the interband transition region of copper (>590 nm) into near infrared spectrum can be challenging. On the contrary, anisotropic nanostructures such as gold nanorod (GNR) is promising for direct assembly in an ordered array format on substrate and benefit in their turn from simplicity and controlled morphology. GNR synthesis can be precisely adjusted to generate plasmonic wavelength tunable form visible to NIR region (600-1,350 nm) depending on the aspect ratio. This feature provides an easy way to fabricate plasmonic surface of ordered array to overlap the fluorophore excitation and emission spectra over 600 nm for enhancement study. The rod shaped structure can be readily immobilized to preferably form a vertically standing GNR monolayer array to create a homogeneous “hot spot” surface with amplified LSPR, to which fluorophore molecules can be attached. It will eliminate the necessary of inert base nanosphere fabrication and half shell metal deposition process to reduce the cost and system complexity. In this study, monolayer assembly of ordered GNR cluster array on glass surface was performed. Experimental and simulation results indicated amplification of the LSPR at the hot spots between neighboring particle tips in the nanoarray. This allows for the identification of the correlations between morphology, plasmonic properties, and fluorescence enhancement activity


Page 5 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


of the GNR nanoarray platform. It was found that the fluorescence enhancement strongly depends on the nanorod assembly pattern, plasmonic modulation, and the distance between the fluorophore and nanoarray surface. Furthermore, a practical use of the ordered GNR array to develop an innovative DNA biochip was demonstrated to result in a significant improvement in the sensitivity of molecular beacon detection due to the plasmon coupled fluorescence enhancement.

Experimental section Materials Gold chloride (HAuCl4, 99%), sodium borohydride (NaBH4, 99%), cetyltrimethylammonium bromide (CTAB), sodium oleate (NaOL, >97%), L-ascorbic acid (AA), silver nitrate (AgNO3, 99%), hydrochloric acid (HCl, 95-98%), (3-mercaptopropyl)trimethoxysilane (MPTMS), sodium chloride (NaCl) were purchased from Sigma-Aldrich (St. Louis, MO). Tris(2carboxyethyl)phosphine (TCEP) were from Thermo Scientific (Rochester, NY). All the following DNA oligonucleotides were synthesized and HPLC-purified by Biosearch Technologies (Petaluma, CA). Single strand DNA (ssDNA) sequences include thiolated 5’-SSC6- TTTTAGAGATATGAGCAG-3’; 5’-SS-C6TTTTAGAGATATGAGCAGAACTGGAAAGGAGGCTGAGAGATGGCT-3’; and 5’-SS-C6TTTTAGAGATATGAGCAGAACTGGAAAGGAGGCTGAGAGATGGCTCGAGTACTACC AGGCTGCGACTCGTCAGACGTATAGTGA-3’. Fluorescence labeled complementary ssDNA sequences: 5’-Quasar 670- CTGCTCATATCTCTAAAA-3’; 5’-Quasar 670AGCCATCTCTCAGCCTCCTTTCCAGTTCTGCTCATATCTCTAAAA-3’; and 5’-Quasar 5 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 23

670TCACTATACGTCTGACGAGTCGCAGCCTGGTAGTACTCGAGCCATCTCTCAGCCTCC TTTCCAGTTCTGCTCATATCTCTAAAA-3’; Hairpin probe ssDNA is 5’-SS-C6TTTTTTTTTCGACGAGAGATATGAGCAGAACTGGAAAGGAGGCTGACGTCG-Quasar 670-3’ while the detection ssDNA is 5’-TCAGCCTCCTTTCCAGTTCTGCTCATATCTCT-3’.

Immobilization of GNRs on glass substrates Gold nanorods (GNRs) with varying aspect ratios were chemically synthesized by a seedmediated growth method using a bisurfactant mixture of CTAB and NaOL.25 To compare the effect of surface plasmon resonance on the fluorescence enhancement, two types of GNR assembly (i.e. random and ordered array assembly) on glass surface were performed. The random GNR assembly was following our previous publication with slight modifications (see supporting information).26 To immobilize GNRs in a vertically standing array, a controlled solvent evaporation method was used to induce self-assembly of GNRs.27 Briefly, GNR solutions were spun at 6,000 rpm for 10 min and the precipitates were resuspended in an aqueous CTAB (2 mM) solution containing 4 mM NaCl. The final GNR concentration was ~7 nM. Glass substrate was cleaned with acetone and ethanol, followed by deposition of 8 uL of the GNR solution. The whole set up was covered for a slow solvent evaporation overnight at room temperature and ~75% humidity. Afterwards, the glass was gently washed with DI water and dried with nitrogen gas to remove excess NaCl, CTAB and nanoparticles.


Page 7 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Attachment of fluorescence to GNR biochip and fluorescence enhancement measurement Fluorescent molecules were attached to GNRs via DNA duplex to ensure desired distance from the nanorod surface (refer to supporting information). To covalently bind to gold nanoparticle, one single-strand DNA terminal was modified with disulfide (-S-S-) group while its complementary DNA was labeled with fluorescence on the 5’ end. Varying base pair number of the DNA sequences controls the distance between the fluorophore and the nanorod. After fluorophore conjugation, fluorescence intensities in free form and on the ordered GNR arrays were measured using a Biotek plate reader. To investigate the effect of LSPR from GNR cluster on fluorescence enhancement, the same amount of fluorescence sample was directly deposited onto the glass surface without GNRs as control sample. Its fluorescence intensity was recorded as baseline I0. The fluorescence enhancement factor (EF) was determined according to the following equation EF = (IFG-I0)/I0

(1)

where IFG is the fluorescence intensity from the fluorophore molecules attached to ordered GNR arrays at varying distances.

Quantitative DNA detection on GNR array biochip After GNRs were immobilized to a microscope glass slide, forming vertically-standing nanoarrays, each spot of GNRs was functionalized with 5 ul of 20 uM hairpin ssDNA via Au-S bonds. After rinsing with PBS buffer, the biochip was scanned in Biotek microplate reader and the fluorescence intensity was recorded. The baseline fluorescence was quenched due to the close proximity of the fluorophore and GNRs. Upon hybridization with the complementary 7 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 23

ssDNA target of varying concentrations from 0.01 nm to 100 nM at 70 oC for 40 min, the fluorophore was extended away from the GNR array surface. This caused the increase in fluorescence intensity that is directly correlated to the target ssDNA concentration.

Results and discussion Characterization of orderly GNR vertical assembly on substrate It is known that GNR exhibits optical properties dictated by aspect ratio (length to width ratio). While the transverse band is insensitive to the size change, longitudinal SPR (LSPR) is red-shifted largely from visible to infrared region with increase in aspect ratio. In this study, the longitudinal spectral band was tuned from 631 to 826 nm depending on the aspect ratio (Fig. S1). To construct a chip based GNR array platform, nanorods were orderly assembled on glass substrates as the optical transducer of biological binding events for LSPR biosensing. Fig. 1A shows the schematic of fabricating ordered GNR array on glass substrate where fluorophore molecules can be placed nearby at desired distances controlled by the spacer thickness. The nanoarray pattern was achieved by controlling the evaporation of aqueous nanorod colloidal solution. This approach can be precisely adjusted to attain nanostructure assembly with highly ordered morphology and density. Additionally, this technique is suitable for a large scale substrate fabrication with homogeneous coverage of GNR cluster. Fig. S2 shows the picture of nanorod array assembly of ~5 mm in diameter and zoom-in SEM image of 200 × 200 µm to demonstrate the uniformity on glass substrate. As shown in Fig. 1B, for all the GNR array of different sized nanorods (denoted as GNR631 to GNR826 representing the respective LSPR band), nanoparticle monolayer was orderly assembled in vertical standing format exposing the 8 ACS Paragon Plus Environment

Page 9 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. A: Schematic of the fabrication of ordered arrays of standing gold nanorods on glass surface by controlled evaporation, followed by the fluorophore conjugate. The spacer thickness is tunable to adjust the distance between the fluorophore and nanorod surface. B: Electron microscopic images (top view) of the GNR nanoarray of varying sizes with the respective LSPR peak wavelength as noted.

nanorod tips. The temporal process of ordered assembly was recorded in SEM images (Fig. S3). The “vertically-standing” fashion was preferred to “horizontally-laying” because a bigger contact area was more favorable in terms of interaction energy.28 The dominant van der Waal’s force between GNRs and the substrate ensures a stable assembly.29 As such, the resulting GNR arrays were found to be highly stable to withstand the solutions used for subsequent functionalizations. The extinction spectrum of the vertically aligned nanorods showed a broaden LSPR band (Fig. S4). This is because the GNRs were assembled in the closed packed form similar to GNR aggregates (Fig. 2 inset). As a comparison, the nanorods in random deposition retained the typical two LSPR peaks in the spectrum as they were still separately immobilized on the substrate (Fig. S4 and S5-A).26



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 23

It was noted that the light extinction by GNRs results from both absorption and scattering.30,31 Due to the SPR effect, both light absorption and scattering of gold nanoparticles are strongly enhanced.32 The local electric field has its maximum enhancement on the surface and decays exponentially within ca. 30 nm along the light polarization direction. It has been reported that the gold half-shell arrays generate strong electric fields (hot sites) at the gap between two adjacent particles.33 Our simulation study also suggested the presence of “hot spots”

Figure 2. Simulation results showing the electric field distribution of the GNR nanoarray. A: side view and B: top view. The incident light wavelength was 664 nm and the excitation polarization direction was along the long axis of GNR (z direction) with the electric intensity of 1e8 V/m. The amplied surface plasmon intensity "hot spot" is located at the tips of the nanorod cluster. Inset: SEM image of the GNR array revealing the close packed hexgonal structure of adjacent nanorods.


Page 11 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


along the nanogaps of neighboring rods and the electrical intensity of these hot spots is dependent on the interparticle (nanogap) distance (Fig. S6). Due to the anisotropic shape of nanorod where the tips exhibit a strong antenna effect, it is interesting that the signals at GNR tips are also significantly intensified to cause a larger SPR enhancement effect.34 Therefore, when GNRs are assembled vertically on the substrate, the exposing tips in the nanoarray can further amplify the SPR signals at neighboring particles collectively. Additionally, it is known that the fluorescence molecule is more favorably attached to the tip rather than the side of GNRs.35 As such, unique to this study, we appropriately investigated the effect of SPR enhancement at the nanorod tips instead of gaps along the nanorod sides on the fluorescence enhancement. In order to probe the relevance to our GNR array, FEM calculations were performed to estimate electric field distribution on the GNR array surface under the irradiation of 664 nm incident light (Fig. 2). It was conformed that all GNRs formed 2D close-packed hexagonal arrays in the cluster assembly (inset). As shown in the simulation results (panel A and B), hot spots with amplified LSPR are indeed present at the tips of the GNR nanoarray. The electric field enhancement factors at hot spots of GNR664 are more than four fold. Therefore, it is expected that the ordered GNR array with enhanced LSPR would contribute to dramatic improvement in plasmonic applications as compared to the conventional GNR biochip in a random fashion in the subsequent study.

Fluorescence quenching and enhancement on GNR nanoarrays According to the mechanisms of MEF and Förster resonance energy transfer (FRET), nanoparticles can enhance or quench fluorescence under different conditions.14,36 Herein, two major factors were investigated: (1) the distance between fluorescence and plasmonic 11 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 23

nanoparticle and (2) spectral relationship between LSPR of GNR nanoarray and the fluorescence excitation and emission wavelengths. Fluorescence labeled DNA duplex were introduced in proximity to GNR surface via Au-S bonds in both the orderly and random GNR assembly. Fluorescence intensities of these two assembly patterns were then measured respectively. The fluorophore/glass acted as a control sample as it is free of the enhancement/quenching effect of GNRs. Fig. 3 summarizes the effects of GNR664 assembly pattern and the distance on the fluorescence enhancement and quenching. Based on the definition of fluorescence enhancement factor (EF; equation 1), a positive value of EF indicates enhancement while a negative EF means fluorescence quenching, as compared to the control sample. GNR assembly in random fashion on the substrate resulted in fluorescence quenching at all distances. This is because the practical fluorescence enhancement coupled by LSPR effect is dependent on the results of competition between the enhancement and quenching effects of metal nanoparticles. Gold surface is known to be strong quenchers of molecular

Figure 3. Comparison of the ordered GNR array with the random assembly on substrate for the distance dependent fluorescence enhancement. Inset: schematic of the fluorophore nearby the GNR surface with different spacer thickness.


Page 13 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


excited states due to FRET.37,38 In random assembly, GNRs were laterally laid on the substrate (Fig. S5-A). The rod side facets rather than the tips were readily exposed for fluorescence attachment. As shown in simulation in Fig. S5-B, the intensified local electric field is centered around the tips of GNR, while the local electric field along the sides is relatively weak. Therefore, a dominant FRET effect resulted in fluorescence quenching (i.e. negative EF value). In contrast, in vertically standing GNR array, the tips of anisotropic rods were favorably attractive for fluorescence molecule attachment.35 As such, the homogeneous “hot spots” surface generating uniformly intensified electric fields resulted in plasmon induced fluorescence enhancement. The fluorescence intensity increase was found to be a function of the GNR-fluorescence distance. The inset of Fig.3 depicts the distance controlled by varying the number of base pairs in the DNA duplex. The distance is theoretically calculated based on the thickness of 0.34 nm per base and the length of 0.15 nm for the carbon-carbon bond in the methylene linker.39 Based on the theoretical simulation, the distance range was chosen to be within 30 nm where LSPR hot spot is present. In this study, the maximum fluorescence enhancement was observed at a distance of 16.2 nm. At a short distance (7.1 nm), the energy transfer from photo-excited fluorophore to gold surfaces efficiently occur over this small distance, leading to the fluorescence quenching. As such, the enhancement was dampened due to the competition between quenching and enhancing effect. Nevertheless, the enhancement induced by the proximity of the fluorophore to the plasmonic surface was enough to offset the quenching to achieve ~30% signal amplification. As a comparison, at a longer distance (29.5 nm), the attached fluorophore emitted comparable intensity as the control (free fluorophore without GNRs) because both quenching and enhancing effect were diminished at this range.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 23

Previous study showed that the fluorescence enhancement from fluorophores located near to a single silver nanostructure is very sensitive to the degree of spectral overlap between the LSPR bands and the excitation and the emission wavelengths of the fluorophore.40 When the extinction spectrum of GNR overlaps with the excitation spectrum of the fluorophore, Rayleigh scattering by nanorod is enhanced due to SPR effect, which results in maximum light absorption at the excitation wavelength of the fluorophore. When the extinction of GNR overlaps with the emission spectrum, the tip edge of anisotropic rod shape leads to effective coupling of LSPR to far-field radiation, which results in an increased emission rate and quantum yield. Our results corroborated with the theoretical prediction. The emission wavelength of the fluorophore Quasar670 (λem = 670 nm) in this measurement overlaps with the LSPR bands of the GNR, 664 nm. Thus, fluorescence enhancement occurs because of an increase in the radiative decay rate of excited fluorophore. Fig. 4 shows the Quasar670 fluorescence intensity enhancement by the vertical arrays of GNR631, GNR664, GNR693, GNR718, GNR775, and GNR826, respectively at a distance of ~ 16.2 nm from the GNR surfaces. While all the GNR arrays showed

Figure 4. Effect of spectral overlap of the gold nanoparticles with the excitation/emission wavelengths of Quasar670 on the fluorescence enhancement.


Page 15 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


fluorescence enhancement, the GNR664 array resulted in the highest intensity increase, followed by the GNR693 array. The inset shows the relation between the LSPR peak wavelength and the excitation/emission wavelength of the fluorophore. The GNR664 plasmonic spectrum consistently matches the excitation/emission wavelength of Quasar670. The GNR693 array shows a slightly less induction of an enhancement in excitation and emission from the LSPR band. Either blue shift to shorter LSPR wavelength (GNR631) or red shift to longer LSPR wavelength (GNR718-826) leads to a significant mismatch. To further verify, fluorescein (FAM: λex = 494 nm; λem = 520 nm) was conjugated to gold nanoparticles with a wide range LSPR wavelengths. As expected, GNS520 demonstrated a significant enhancement as the excitation and emission from the FAM were effectively enhanced by the surface plasmon around 520 nm. The fluorescence enhancement was dampened gradually as the LSPR band moves away from the overlapping region (Fig. S7).

Figure 5. Practical use of the ordered GNR array chip for DNA detection based on surface plasmon enhanced fluorescence upon hybridization.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 23

DNA detection based on the GNR nanoarray biochip Herein, we demonstrate the practical use of the orderly GNR array as a metal-enhanced fluorescence detection platform to develop a DNA biochip. Fig. 5 shows the schematic of the ordered GNR array chip for enhanced DNA detection based on molecular beacon (MB). It is noteworthy that the nanorod cluster can be fabricated as periodic pattern on substrate in a microarray fashion. When the hairpin structured ssDNA probe is conjugated to the GNR664 nanoarray, the fluorescence is minimal due to quenching by GNRs in close proximity. However, the fluorophore extended away from the GNR array surface is restored while MB hybridizing with the complementary ssDNA target. Fig. 6A shows the fluorescent intensity change when the target ssDNA sample was introduced to the GNR664 array (blue curve). Compared with control sample in which same amount of free fluorophore on substrate without GNRs(red curve), the Quasar670 intensity was ~32% lower, indicating quenching by the GNR array. Upon hybridization to the complementary ssDNA, the hairpin loop was opened up by the formation of duplex DNA structure (45-nucleotide-long), thereby extending the Quasar670 molecule ~16 nm away from the array surface. This led to a doubling of the fluorescence intensity. The fluorescence increase is quantitatively a function of the target ssDNA concentration with a linear relationship from 10 pM to 10 nM (Fig. 6B). With the fluorescence enhancement by the GNR array chip, the detection limit was determined to be 10 pM, which is significantly lower than conventional LSPR aptasensors based on the spectral shift only.41-43 In discussion, one of the most specific molecular recognition events happens when a strand of nucleic acid anneals to its complement. This process is very beneficial in the exploration of gene organization and function and is now being applied to the medical diagnosis. However, the rather small measurable change in the physical properties of nucleic acids that occur upon 16 ACS Paragon Plus Environment

Page 17 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6. A: Quasar670 fluorescence intensity change during hybridization from the GNR664 nanoarray biochip (♦) and comparison to that from control sample (■). B: Calibration curve of the GNR nanoarray based DNA chip as a function of the increasing target ssDNA concentration (r2 = 0.99). hybridization is a challenge for sensitive detection. Fluorescence signaling in molecular beacon has proven to be useful to improve the sensitivity. In this study, the ordered arrays of vertical nanorods on the substrate shows intensified “hot spots” within the neighboring nanoparticle tips. The generation of highly confined local electric fields induced by the LSPR of the “hot spots” results in excitation enhancements and increase in the radiative decay rate of fluorophores, which further improved the fluorescence intensity. Our enhancement factor appears to be less than the



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 23

enhancement of upconversion luminescence of NaYF4:Yb3+, Er3+ nanocrystals by GNR cluster array.44 This can be attributed to the NaYF4:Yb3+, Er3+/MoO3/GNR hybrid system in which both upconversion nanoparicle and MoO3 spacer had strong coupling with the underlying GNR vertical array. Nevertheless, our design provides a simple GNR substrate preparation for effective enhancement of molecular fluorescence detection by plasmonic-photonic nanostructure assembly. Finally, we would like to comment on the flexibility of the GNR nanoarray chip as a metal enhanced fluorescence platform with desired spectroscopic functionality to accommodate fluorophore of choice. Gold nanorods can be easily synthesized to fine tune the LSPR band from visible to NIR region. It was reported in the literature that the longitudinal plasmon band can be extended to ~1,350 nm.25 This wide spectral tunability enables a universal nanoarray assembly with matching LSPR band to the excitation and emission wavelengths of commonly used fluorophores in optical sensing and imaging applications. Moreover, the nanorod array fabrication in periodic pattern similar to microarray design is promising as a new paradigm for a high throughput nano-biochip development with superb sensitivity for proteomics, genomics and molecular analysis.

Conclusions We have demonstrated the development of an ordered array of gold nanorod cluster with morphological stability. Insertion of interlaying spacer with an appropriate thickness between fluorophore and the GNR array surface resulted in plasmon coupled enhancement in the fluorescence signal up to ca. 30 nm. The enhancement correlates with the spectral overlap between the fluorophore excitation/emission wavelengths and the plasmonic band. As the


Page 19 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


overlap can be easily tuned by controlling the GNR size, such plasmonic nanoarray structures could be relevant for building fluorescence-based sensing devices with optimized efficiency for a given fluorophore. The results can impact the proper selection of the working fluorescence nanoplatform from visible to NIR spectrum in order to achieve maximal amplification for sensing and imaging applications. From a practical point of view, we have developed a molecular beacon detection technique in a chip based format using the ordered GNR arrays for ultra-sensitive DNA analysis. The fluorescence enhancement by the coupling gold nanoarray was shown to significantly lower the detection limit as compared to traditional LSPR biosensor.

Acknowledgement This work was in part supported by the National Heart, Lung, and Blood Institute of the National Institutes of Health (SC1HL115833) and US Department of Agriculture (2015-38422-24059). The authors thank the Kleberg Advanced Microscopy Center at the University of Texas at San Antonio for the use of electron microscopes.

Supporting information Experimental for GNR assembly and fluorophore conjugation. SEM images of the temporal process of vertical GNR assembly. The respective absorption spectra of GNR random deposition and ordered array on substrate. Local electric field simulation at the nanogaps in orderly GNR assembly and random assembly. This material is available free of charge via the Internet at http://pubs.acs.org.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 23

References (1) Wang, Y.; Tang, L. Biosens. Bioelectron. 2015, 67, 18-24. (2) Tian, L.; Morrissey, J. J.; Kattumenu, R.; Gandra, N.; Kharasch, E. D.; Singamaneni, S. Anal. Chem. 2012, 84, 9928-9934. (3) Mejard, R.; Thierry, B. PLoS One 2014, 9, e107978. (4) Islam, N.; Shen, F.; Gurgel, P. V.; Rojas, O. J.; Carbonell, R. G. Biosens. Bioelectron. 2014, 58, 380-387. (5) Mayer, K. M.; Hafner, J. H. Chem. Rev. 2011, 111, 3828-3857. (6) Lee, K. S.; El-Sayed, M. A. J. Phys. Chem. B 2006, 110, 19220-19225. (7) Zou, K.; Gao, Z.; Deng, Q.; Luo, Y.; Zou, L.; Lu, Y.; Zhao, W.; Lin, B. Electrophoresis 2016, 37, 786-789. (8) Cunningham, J. C.; Scida, K.; Kogan, M. R.; Wang, B.; Ellington, A. D.; Crooks, R. M. Lab Chip 2015, 15, 3707-3715. (9) Tang, L.; Casas, J.; Venkataramasubramani, M. Anal. Chem. 2013, 85, 1431-1439. (10) Zhu, Y.; Hu, X. C.; Shi, S.; Gao, R. R.; Huang, H. L.; Zhu, Y. Y.; Lv, X. Y.; Yao, T. M. Biosens. Bioelectron. 2016, 79, 205-212. (11) Yuan, C.; Zhang, K.; Zhang, Z.; Wang, S. Anal. Chem. 2012, 84, 9792-9801. (12) Sato, Y.; Tian, J.; Ichihashi, T.; Chinda, Y.; Xu, Z.; Pang, Y.; Nishizawa, S.; Teramae, N. Anal. Chim. Acta 2010, 675, 49-52. (13) Li, Y. Q.; Guan, L. Y.; Zhang, H. L.; Chen, J.; Lin, S.; Ma, Z. Y.; Zhao, Y. D. Anal. Chem. 2011, 83, 4103-4109. (14) Gryczynski, Z.; Malicka, J.; Gryczynski, I.; Matveeva, E.; Geddes, C. D.; Aslan, K.; Lakowicz, J. R. Proc SPIE Int Soc Opt Eng 2004, 5321, 275-282. 20 ACS Paragon Plus Environment

Page 21 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(15) Geddes, C. D.; Parfenov, A.; Lakowicz, J. R. Appl. Spectrosc. 2003, 57, 526-531. (16) Aslan, K.; Gryczynski, I.; Malicka, J.; Matveeva, E.; Lakowicz, J. R.; Geddes, C. D. Curr. Opin. Biotechnol. 2005, 16, 55-62. (17) Xie, F.; Baker, M. S.; Goldys, E. M. Chem. Mater. 2008, 20, 1788-1797. (18) Deng, W.; Goldys, E. M. Langmuir 2012, 28, 10152-10163. (19) Gerber, S.; Reil, F.; Hohenester, U.; Schlagenhaufen, T.; Krenn, J. R.; Leitner, A. Phys. Rev. B 2007, 75. (20) Dragan, A. I.; Golberg, K.; Elbaz, A.; Marks, R.; Zhang, Y.; Geddes, C. D. J. Immunol. Methods 2011, 366, 1-7. (21) Corrigan, T. D.; Guo, S. H.; Szmacinski, H.; Phaneuf, R. J. Appl. Phys. Lett. 2006, 88. (22) Farcau, C.; Astilean, S. Appl. Phys. Lett. 2009, 95. (23) Litorja, M.; Haynes, C. L.; Haes, A. J.; Jensen, T. R.; Van Duyne, R. P. J. Phys. Chem. B 2001, 105, 6907-6915. (24) Sugawa, K.; Tamura, T.; Tahara, H.; Yamaguchi, D.; Akiyama, T.; Otsuki, J.; Kusaka, Y.; Fukuda, N.; Ushijima, H. ACS Nano 2013, 7, 9997-10010. (25) Ye, X.; Zheng, C.; Chen, J.; Gao, Y.; Murray, C. B. Nano Lett. 2013, 13, 765-771. (26) Wang, Y.; Tang, L. Anal. Chim. Acta 2013, 796, 122-129. (27) Peng, B.; Li, G.; Li, D.; Dodson, S.; Zhang, Q.; Zhang, J.; Lee, Y. H.; Demir, H. V.; Ling, X. Y.; Xiong, Q. ACS Nano 2013, 7, 5993-6000. (28) Love, J. C.; Estroff, L. A.; Kriebel, J. K.; Nuzzo, R. G.; Whitesides, G. M. Chem. Rev. 2005, 105, 1103-1169. (29) Bishop, K. J.; Wilmer, C. E.; Soh, S.; Grzybowski, B. A. Small 2009, 5, 1600-1630. (30) Huang, X.; El-Sayed, M. A. J. Adv. Res. 2010, 1, 13-28.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 23

(31) Mercatelli, R.; Romano, G.; Ratto, F.; Matteini, P.; Centi, S.; Cialdai, F.; Monici, M.; Pini, R.; Fusi, F. Appl. Phys. Lett. 2011, 99. (32) Jain, P. K.; Lee, K. S.; El-Sayed, I. H.; El-Sayed, M. A. J. Phys. Chem. B 2006, 110, 72387248. (33) Farcau, C.; Astilean, S. J.Phys.Chem. C 2010, 114, 11717-11722. (34) Dodson, S.; Haggui, M.; Bachelot, R.; Plain, J.; Li, S.; Xiong, Q. J Phys Chem Lett 2013, 4, 496-501. (35) Gao, J. X.; Bender, C. M.; Murphy, C. J. Langmuir 2003, 19, 9065-9070. (36) Massey, M.; Algar, W. R.; Krull, U. J. Anal. Chim. Acta 2006, 568, 181-189. (37) Barazzouk, S.; Kamat, P. V.; Hotchandani, S. J. Phys. Chem. B 2005, 109, 716-723. (38) Dulkeith, E.; Ringler, M.; Klar, T. A.; Feldmann, J.; Munoz Javier, A.; Parak, W. J. Nano Lett. 2005, 5, 585-589. (39) Peng, H. I.; Strohsahl, C. M.; Leach, K. E.; Krauss, T. D.; Miller, B. L. ACS Nano 2009, 3, 2265-2273. (40) Chen, Y.; Munechika, K.; Ginger, D. S. Nano Lett. 2007, 7, 690-696. (41) Feng, C. J.; Dai, S.; Wang, L. Biosens. Bioelectron. 2014, 59, 64-74. (42) Singh, R.; Das Mukherjee, M.; Sumana, G.; Gupta, R. K.; Sood, S.; Malhotra, B. D. Sens. Actuators, B-Chemical 2014, 197, 385-404. (43) Park, J. H.; Byun, J. Y.; Mun, H.; Shim, W. B.; Shin, Y. B.; Li, T.; Kim, M. G. Biosens. Bioelectron. 2014, 59, 321-327. (44) Yin, Z.; Zhou, D.; Xu, W.; Cui, S.; Chen, X.; Wang, H.; Xu, S.; Song, H. ACS Appl. Mater. Interfaces 2016, 8, 11667-11674.


Page 23 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


For TOC only


Surface-Plasmon-Coupled Fluorescence Enhancement Based on

Recommend Documents