Subscriber access provided by UNIVERSITY OF ADELAIDE LIBRARIES
Article
Surface Plasmon Resonance Imaging Detection of sub-fM MicroRNA Feichi Hu, Jiying Xu, and Yi Chen Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.7b02838 • Publication Date (Web): 21 Aug 2017 Downloaded from http://pubs.acs.org on August 22, 2017
Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.
Analytical Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.
Page 1 of 8
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Analytical Chemistry
Surface Plasmon Resonance Imaging Detection of sub-fM MicroRNA Feichi Hu,†,‡ Jiying Xu,*,† and Yi Chen*,†,‡,§ †
Key Laboratory of Analytical Chemistry for Living Biosystems; CAS Research/Education Center for Excellence in Molecular Sciences; Institute of Chemistry, Chinese Academy of Sciences, Beijing 100190, China
‡
University of Chinese Academy of Sciences, Beijing 100049, China
§
Beijing National Laboratory for Molecular Science, Beijing 100190, China
ABSTRACT: MicroRNA (miRNA) is a promising new type of biomarkers but at a low fM level and hard to be analyzed. Herein proposed is an innovated surface plasmon resonance imaging (SPRi) method merged with a novel in-plane and vertical signal amplification strategy, i.e. orthogonal signal amplification, in order to enable a direct determination of sub-fM miRNA-15a (a multiple tumor diagnostic biomarker). The core idea is to add more mass on a target sample spot first along the surficial direction, then upwards from the surface. In detection of miRNA, this was realized by coupling a miRNA-initiated surficial cyclic DNA-DNA hybridization reaction with a DNA-initiated upward cyclic polymerization reaction. A perfect SPRi sensing chip with isolated gold islands bordered by hydrophobic CYTOP was fabricated and used to obtain high-quality chip with low fabrication difficulty. As a result, SPRi contrast largely increases, able to reach a limit of detection and limit of quantification down to 0.56 fM and 5fM for miRNA-15a, about 107-fold improvement of sensitivity compared with a common SPRi detection. The method could quantify standard miRNA-15a spiked in human serum with an ideal recovery ranging from 98.6 % to 104.9 % and was validated to be applicable to the direct determination of miRNA15a in healthy and cancer human serums. The orderly and controllable in situ sensitizing strategy is powerful and readily extendable to detection of other miRNAs.-
An alternation to DNA chip technology is to explore and use surface plasma resonance imaging (SPRi) which is labelfree and can in situ, real-time and high-throughput detect intact biomolecules in physiological conditions. In fact, SPRi has been proven to be powerful for simultaneous observations of molecular interactions and interfacial reaction behaviors of various bio-molecules, including miRNA.15,16 It can presently reach a limit of detection (LOD) down to nM for intact miRNAs. In the detection of proteins,17-19 the LOD can further be improved by amplification of the signals through the use of nanometer materials,20-22 enzyme catalysis reaction,23-25 sandwich immunoassays,26,27 and surface-initiated polymerization.28 They are in theory conveyable to the detection of miRNAs as has been demonstrated by Corn et al. who could detect 10 fM miRNA by SPRi after signal amplification with nanoparticles combined with poly(A) polymerase reaction.10 Similarly, Vaisocherova et al. could detect 0.5 pM multiple miRNAs in erythrocyte lysate.29 However, further sensitize the SPRi to detect sub-fM miRNAs has not yet been reported, possibly due to the difficulty to further amplify the signals by any a single strategy. It is known that adding more mass onto a target analyte through
MicroRNAs (miRNAs) are non-protein coding RNA molecules playing essential roles in gene expression and regulation of biological processes.1,2 Recently, increasing evidences have backed some specific miRNA sequences as next-generation diagnostic biomarkers for many critical illnesses, such as cardiovascular disease, diabetes, chronic lymphocytic leukemia.3,4 Sensitive and accurate detection of miRNAs is critical to elucidate the pathogenesis of cancers to achieve early clinical diagnosis and treatment.5 Nevertheless, miRNAs feature low abundance, short size, sequence similarity, and are prone to degradation, seriously challenging the analytical methodology.1,2 In order to conquer the challenges, various novel analytical methods and techniques have been tried and exploited such as sensors,6 complex segregation analysis,7-9 and chips.10 Among them optic biosensors,11 nanometer,12 and electrochemistry13 remains short of throughput while the complex segregation analysis7-9 may consume too much of samples. DNA Chips look better in respect of selectivity and throughput, but they need labeling techniques to enable detection of non-fluorescent analytes, remaining inevitable to the mainstream of commercial miRNA analysis.10,14 1
ACS Paragon Plus Environment
Analytical Chemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
either analyte-related polymerization reaction30 or direct linkage of a large molecule or particle22,31 can significantly increase the SPRi signals but normally within a factor of about 1000 folds. This may be resulted from the stochastic addition of the mass. We thus tried to sensitize the detection by an orderly addition strategy. An ideal order technique looks hard to be established by means of reactions but somewhat order strategy should not be that difficult to find. In this paper, we are discussing a strategy what we termed orthogonal signal amplification (OSA), aiming at the direct determination of real sub-fM miRNAs in human bloods. The strategy separates the amplification operation into two directions, in-plane and vertical. Supposing each direction can gain an above-mentioned 1000-folds increase of a signal, the total two directions will obtain a net increase of the signal for 106 folds. This core idea behind the in-plane and vertical signal amplification strategy is actually to make a more effective use of the 3D space on and above a sample spot. To demonstrate, OSA-based SPRi determination of miRNA-15a (a multiple tumor diagnostic biomarker) in both healthy and cancer human serums was performed. The in-plane addition of mass was realized through miRNA-initiated DNA-DNA hybridization32 and vertical addition of mass was achieved by upward elongation of the duplex DNA through DNA-initiated polymerization. As theoretical expectation, SPRi acquired almost 107-fold improvement of its sensitivity, able to directly detect down to 0.56 fM miRNA15a. Its real applicability was validated by reliable determination of the miRNA-15a in real human serum samples from both healthy volunteer and cancer patient.
Page 2 of 8
Table 1. Summary of all DNA and RNA probes used. Sequence (5' to 3')ɑ
Name miRNA-15a
UAGCAGCACAUAAUGGUUUGUG
Hairpin 1
CACATAATGGTTTGTGCTCAATAGCAGCACACAAACCATTAT GTGCTGCTAAAATTTTT-SH
Hairpin 2
TGCTCAATAGCAGCACATAATGGTTTGTGTGCTGCTATTGA GCACAAACCTAAAATTT-NH2
DNA 1
TGGGCTGGCCAAACT
(50% complementary to 5'-side of H1)
DNA 2
TGGGCGGGCCAAACT
(47% complementary to 5'-side of H1)
nc-miRNA
UUGUACUACACAAAAGUACUG (57% complementary to 5'-side of H1)
ɑ
The bold and italic bases are the complementary sites. The italic bases in DNA1, DNA2 and nc-miRNA are complementary sites to 5'-side of H1.
Preparation of a SPRi chip. A perfect SPRi sensing chip with isolated gold islands bordered by hydrophobic CYTOP was fabricated by a stepwise procedure including vacuumed deposition of gold film, chemical etching of the unwanted gold and coating of the etched parts with CYTOP. The detailed procedure was shown in Figure S1A and specified section S1 in the Supplementary Information (SI) together with waterinduced image (Figure S1B) to trace the gold arrays and the hydrophobic CYTOP borders. The fabricated chip can facilitate spotting various aqueous samples by self-confining the liquid within the gold islands (Figure S1C and S6). Just before use, a chip was sequentially washed with acetone, pure water, ethanol, and pure water again for about 20 sec each under sonication. After dried by N2 and activated by air plasma in PDC-MG (Chengdu Mingheng S&T Co., Ltd.) for 3 min, the chip was spotted with 2 µM hairpin-structured DNA probe H1 (S2), and incubated in a water-vapor-saturated incubator for 4 h at room temperature to assemble a monolayer of H1 on the gold island surface via Au−S bond. The chip was cleaned by water, immersed in 10 mM aqueous MCH for 2 h to block nonspecific adsorption sites, and washed again with water. After drying under a N2 stream, the chip was ready for further use. Direct capture of miRNA-15a. The chip was installed onto SPRi imager to record a signal preferentially. Then, solutions containing different concentrations of miRNA-15a were dropped onto the H1-modified spots and incubated for 2 h at 37 oC in the incubator. After flushed with wash buffer and water and dried under a N2 stream, the hybridizing signals were obtained by SPRi measurement. In-plane signal amplification. A solution containing excessive (2 µM) hairpin-structured DNA H2 (S2) complementary to H1 was dropped onto each H1-spot together with miRNA-15a at variable concentrations and incubated for 2 h at 37 o C in the incubator. The chip was thoroughly flushed with wash buffer and water, and dried under a N2 stream and amounted onto SPRi imager to record the hybridizing signals. Vertical signal amplification. To further conduct vertical signal amplification, the H2 was previously tagged with a polymerizing-initiator at its 3'-end (S3 and S4). Just after the inplane amplification signal were measured on SPRi imager, in situ polymerization was initiated by online pumping a polymerizing monomer solution (S5) into the flow cell where atom-transfer radical polymerization (ATRP) starts from the initiators at the upper end of H2. After reaction at room temperature for a certain time (optimized at 12 min), the unreacted monomer solution was replaced by pumping in methanol/water (1:1, v/v). The polymerization was resumed cycli
EXPERIMENTAL SECTION Materials and reagents. 1-Ethyl-3-(3dimethyllaminopropyl) carbodiimide (EDC) hydrochloride was purchased from Sigma (St. Louis, Mo, USA), 11Mercaptoundecanoic acid (MUA) from Aldrich (Milwaukee, WI, USA), 6-mercapto-1-hexanol (MCH) from J&K Scientific Ltd. (Beijing, China), and amorphous fluoropolymer CYTOP from Asahi Glass Co., Ltd. (Tokyo, Japan). NaCl, MgCl2, NaCO3, NaHCO3, H2SO4, H2O2, ethanol, acetone, ethylenediaminetetraacetic acid (EDTA), dimethylformamide (DMF), and tris (hydroxylmethyl) aminomethane (Tris) were of analytical reagent grade from Beijing Chemical Works (Beijing, China). 2-Hydroxyethyl methacrylate (HEMA), 2bromoisobutyryl bromide (BIBB), CuBr, 2,2′-bipyridyl (bpy), L-ascorbic acid (AA), triethylamine (TEA), Nhydroxysuccinimide (NHS), and 1,4-dioxane were obtained from Aladdin Chemistry Co. Ltd. (Shanghai, China). Human serum containing 0.02% NaN3 and serum from a colon cancer patient were from Beijing BioDee Biotechnology Co. Ltd. (Beijing, China). All oligonucleotides of biochemical reagent grade (shown in Table 1) were custom-synthesized by Sangon Biotech. Co. Ltd. (Shanghai, China). All oligonucleotide solutions were prepared in 10 mM TrisHCl at pH 8.0 (1 × TE buffer). miRNA hybridization was conducted in TE buffer (added with 0.2 M NaCl and 10 mM MgCl2) while DNA hybridization in 10 mM Tris-HCl at pH 7.0. Wash buffer was composed of 2.0 mM MgCl2 and 0.1 M phosphate buffered saline (PBS) at pH 7.0. All the buffers were prepared with germicidal ultrapure water (specific resistance of 18 MΩ•cm).
2
ACS Paragon Plus Environment
Page 3 of 8
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Analytical Chemistry detection of a captured miRNA, but it also opens another route for SPRi to sensitively detect the miRNA by further addition of H2 to the sample spot where H2 will hybridize with the miRNA-opened H1. The hybridization is designed to start from the free end of H1 (Scheme 1), progresses to its lower end and finally “squeezes” the partial hybrid of H1-miRNA off the H1 chain to form a more stable H1-H2 duplex. The liberated miRNA can now attack another H1 hairpin to open it. This initiates a cyclic hybridization reaction and the miRNA plays now a catalytic role for more sensitive but no loss detection of the catalyst-like miRNA. By a given amount of H1 in a sample spot and excessive H2, the miRNA can be sensed by just determining the formed amount of H1-H2 at a given reaction time (which makes the duplexes depend on the initial concentration of the given miRNA). To further amplify the SPRi signals along the vertical direction, a reaction able to upwards lengthen the hybridized DNA was introduced by in situ grafting a polymer on the upper end of the DNA. To facilitate the detection of biomolecules, a mild reaction based on ATRP was performed at room temperature. The ATRP was initiated by a polymerizing initiator tagged at the 3′-end of H2 (S3 and S4) and proceeded by alternatively pumping in polymerizing monomer solution (S5) and methanol-water, which is another type of cyclic reaction used in this study. Validity and basic features of the OSA-based SPRi method. Three ways are readily available by the design: direct detection of a H1-captured miRNA, indirect detection of H1H2 duplexes induced by miRNA (in-plane signal amplification), and indirect detection of the upward-lengthened H1-H2 duplexes (OSA). All the three ways were confirmed to be applicable to the detection of miRNA-15a but the sensitivity was significantly different. Figure 1A illustrates that the spots of H1 itself have only negligible image contrast from the background (0 nM), even in the presence of H2 followed by vertical polymerization, giving only 3.2 a.u. increment due to non-specific adsorption. The image remains unrecognizable after addition of 10 pM miRNA-15a but become significant by either increase of the miRNA-15a up to over 10 nM (Figure 1A) or adding excessive H2 into the reaction system to induce an in-plane signal amplification (Figure 1B). By OSA, the signal could easily be recognized even if the miRNA is lowered to 10 fM (Figure 1C). The related LOD was 3 nM, 5 pM, and 0.56 fM (Figure 1) for the direct detection, in-plane amplification, and OSA, respectively. Compared with the direct detection, the inplane amplification improved the detection sensitivity for more than three orders of magnitudes while OSA-based method improved the sensitivity for even a striking factor of about 107 folds, as are respectively illustrated in Figure 1. This makes SPRi able to directly determine the target miRNA in a blood sample. To the best of our knowledge, this is the first time that SPRi can reach such a high sensitivity in the detection of miRNAs. Table 2 shows a comparison of this method with several other sensitive methods used in miRNA analysis.10,20,33-38 The new method has the widest linear range and the lowest LOD. Furthermore, this OSA-based SPRi method was also validated to be suitable for quantitative analysis of miRNA-15a in a real sample such as human bloods (to be discussed a bit later). Improving the performance. Clearly the two major steps involved in an OSA-based method have to be optimized to
cally by alternatively pumping in the polymerizing monomer solution and methanol/water until the signals become sufficiently sensitive. SPRi measurement. All SPRi measurements were performed on a laboratory-built SPR imager, model SPRiTX7100. It was designed and fabricated based on the Kretschmann configuration, with a temperature-controllable flow cell adjustable from 2 oC to 95 oC. Solutions were pumped across the chip sensing surface through the flow cell by injection pump. The imaging and other data were recorded in real time by charge-coupled device (CCD, WAT-902B, Watec Co., Ltd., Japan) and analyzed by a laboratory-edited imaging workstation, v 1.0.
RESULTS AND DISCUSSION Design of an OSA-based SPRi method to detect miRNA15a. To explore an ultra-sensitive SPRi method based on OSA strategy, we need a reaction able to use the surficial area as more as possible within the border of a sample spot and a reaction able to lengthen the sample spot upwards. Aiming at measuring the miRNA-15a, DNA hybridization reaction was considered. A single strand DNA H1 with a section of sequence complementary to the target miRNA at near its 3'-end was used as a probe to capture the miRNA. In order to suppress the interference from other RNA or DNA, the probe was designed to have self-complementary sequence at its both ends so that it can easily form a hairpin structure (S2) and cannot be opened without the right sequence. H1 was thiolated at its 3'end to facilitate its immobilization on gold surface. Its detailed structure and sequence was shown in Table 1, together with the target miRNA-15a and another single strand DNA H2. H2 is fully complementary to H1 and itself is hence also easily to form a hairpin structure (S2). Scheme 1. Schematic illustration of orderly in-plane and vertical amplification, i.e. orthogonal signal amplification for SPRi detection of miRNA-15a.
Once immobilized on gold chip, H1 will turn its ends down and hairpin loop up, so that a large complementary DNA like H2 is of steric hindrance toward H1, only very small molecules such as the miRNA-15a can reach the low space, opens the self-hybridized section on the hairpin stem and occupies its complementary sequence. This is often adopted in the direct 3
ACS Paragon Plus Environment
Analytical Chemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 4 of 8
Figure 1. Comparison of SPRi images and response measured from direct detection (A), in-plane signal amplification (B), and OSA (C) of miRNA-15a at a concentration ranging from 3.33 × 10−8 M to 3.33 × 10−16 M. Both the spotting concentration of H1 and H2 are 2 µM. The dashed lines stand for signal-to-noise ratio of three times (3SD).
Table 2. Analytical performance comparison of our strategy with other SPR methods. SPR platform
Amplification strategy
Linear range
Detection limit
Ref.
Biacore X
streptavidin complex amplification
--
17 pM
33
Biacore X
streptavidin and supersandwich amplification
10 pM―1 μM
9 pM
34
Biacore X
streptavidin and CHA amplification
5 pM―100 nM
1 pM
35
SPR
rGO and DSN amplification
10 fM―100 pM
3 fM
36
SPR
GO–AuNPs hybrids amplification
0.1 pM―50 pM
1 fM
37
SPR
multiple amplification strategy
--
0.6 fM
38
SPRi
silica nanoparticles and polymerase amplification
100 fM―10 pM
100 fM
20
SPRi
AuNPs and polymerase amplification
10 fM―500 fM
10 fM
10
SPRi
orthogonal signal amplification
5 fM―0.5 nM
0.5 fM
This work
improve the performance. The first step of in-plane amplification should be conducted within the border of a sample spot. Its amplification efficiency is expected to largely depend on the surface density of the immobilized H1, its hybridized ratio and the original length of H1 and H2 as well. A long DNA chain will facilitate SPRi detection, but H1 (and H2 as well) cannot be over lengthened to keep its hairpin structure at a proper stability to make the target miRNA able to open it. Considering a miRNA has a length of around 20 bases (Table 1), the H1 should have a length of about 60 bases (Table 1), 20 bases for loop and 40 bases for both side chains to hybridize into a loop stem. Such a hairpin structure was proved to be proper for the target miRNA to open it but prevent the H2 from direct hybridization with H1. A longer H1 made the miRNA unable to open the hairpin structure, resulting in signal decreasing rather than increasing. H2 can be very long but too long a H2 also easily bends down to retard its hybridization. In this study, it is found that the length of H2 is better equal to that of H1, not longer than 10 %. The surface density of H1 is determined by the initial concentration of a H1 solution used for immobilization, which was optimized at 2 µM (Figure S2), while the hybridized ratio
of H1 is in theory dependent on the concentration of H2 and reaction time. H2 has to be added excessively, and the ratio is thus determined only by the reaction time. It should however be noted that the present hybridization reaction is fairly slow, which makes online flow-through reaction not a good choice to save instrument time, reactants and other reagents. We thus tried either stop-flow technique or simply offline hybridization. The latter way was finally adopted because it allowed a treatment of each spot with different reactive solutions or is addressable. To prevent the chip from dryness, it was kept in a water vapor-saturated incubator during reaction. It was then mounted onto the SPR imager to measure the hybridizing signals, which suggested that the H1 and H2 hybridization needs 2 h to reach the high plateau (Figure S3). Simply after this in-plane amplification, SPRi could detect fairly trace miRNA-15a at a concentration ranging from 50 nM down to 5 pM (Figure S4), much wider than a common SPRi detection. By use of resonant angle (S9) instead of the imaging intensity, even wider miRNA concentration range was obtained, covering about 5 orders of magnitude as shown in Figure S5. 4
ACS Paragon Plus Environment
Page 5 of 8
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Analytical Chemistry
Unfortunately, the sensitivity remains not enough for direct detection of the ultra-trace (fM) miRNA-15a in a blood sample. The second step of vertical signal amplification was further conducted through effectively and efficiently grafting a suitably rigid or elastic polymer on the upper end of the H1H2 duplexes. Among our tested polymers (S10), PHEMA gave the best result (Figure S6). The polymerization was ordered to initiate from the 3′-end of H2 (S3 and S4) by ATRP under mild conditions. To acquire as higher SPRi signals as possible, we gave up the commonly used one-step polymerization and tried out a cyclic polymerizing technique to benefit from the initial concentration of reactants that trigs the fastest reaction at the early stage. The cyclic polymerization was easily realized by alternatively pumping in fresh reactive monomer solution and methanol/water. Figure 2A illustrates that, for an effective time of 60 min, SPRi increases its signals with
signals quickly reduced while above it, the signal increase was nearly negligible. The cyclic polymerization-caused improvement of SPRi signal was attributed to faster reaction rate benefited from the initial reactant concentration and to the renewal of radical reagent which decreases with time and is also consumed by the dissolved O2 and passivation reactions. Washing between two reactions with solvents may also expose some buried reactive sites to facilitate next step of polymerization. In short, cyclic polymerization is better than non-cyclic in SPRi detections. The effectiveness of OSA-based method was also confirmed by checking the chip surface morphology using AFM (S11). The morphological changes from bare gold to in-plane signal amplification, and to OSA are easily differentiated by the AFM images (Figure S7). Selectivity of OSA-based SPRi method. As mentioned already, the designed method is sequence-specific (Table 1) so that it can resist all no specific RNA and DNA to react, except for the non-specific adsorption. This selectivity was confirmed first by comparison of the target signals with the interferential RNA and DNA with around 50 % sequence complementary to the 5′-side of probe H1 and other background and/or control signals as shown in Figure 3. The SPRi background signal of a probe-free spot was normally kept within 1.1 a.u., scarcely
Figure 3. Selectivity test in SPRi detection of background (a), H1 (b), H1 and miRNA-15a (0.1 nM) (c), H1 and H2 (d), three interferents of 10 pM DNA1 (e), 10 pM DNA2 (f) and 10 pM nc-RNA (g), and 1 pM target miRNA-15a (h) with H1 and H2 by OSA. Figure 2. Impact of cyclic times of polymerization on SPRi signals at a given reaction duration of 36 min, 60 min and 90 min (A), and variation of SPRi signal with cycle span acquired via tricyclic polymerization (B).
increased to 1.3 a.u. even after the immobilization of probe H1 or to 2.0 a.u. after addition of miRNA-15a below its LOD (e.g., 0.1 nM). This suggests the chip-caused non-specific adsorption has been suppressed effectively. However, the addition of H2 itself (no miRNA and no signal amplification occurred) could increase the background signal up to 3.2 a.u. which is ascribed to its light adsorption on H1 because of their sequence complementary and the latter polymerization. Similar to H2, the method could resist small DNA and RNA with sequence complementary to H1 up to about 60 % (Table 1) at a level up to 10 pM DNA1, DNA2 or nc-RNA, in the detection of 1 pM miRNA-15a. Figure 3 also shows that the sequence-caused interference is parallel to the complementary degree, that is, DNA2 ≤ DNA1 < nc-RNA. These data suggest that more attention has to be paid to the sequence-induced interference.
the cycles. The signals after three (127.6 a.u. in 3×20 min) and four (128.7 a.u. in 4×15 min) polymerizing cycles are nearly 1.4 times that of one cycle or common method (95.5 a.u. in 1×60 min). The curve is upward asymptotic, with a turning corner at about the second cycle and the highest time efficiency at third cycle by taking into account of 2 min washing time in each cycle (95.5/(60+2)) = 1.54 < 120/(2(30+2)) = 1.88 < 127.6/(3(20+2)) = 1.93 > 128.7/(4(15+2)) = 1.89). A similar observation was obtained by shortening the effective reaction time to 36 min (Figure 2A) which was later proved to be the optimum cyclic reaction time (Figure 2B). Below it the SPRi 5
ACS Paragon Plus Environment
Analytical Chemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 6 of 8
Figure 4. (A) SPRi image (the concentration of miRNA-15a range from 5.0 × 10-16 M to 5.0 × 10-10 M), (B) variation of the imaging intensity along the dashed line denoted in (A), (C) a calibration curve plotted by SPRi binding intensity vs. the logarithm of concentration of miRNA-15a, and (D) measured level of miRNA-15a in blood samples from five healthy persons and one (but five measures) early stage colon cancer patient.
5 fM (S/N=10). By spiking miRNA-15a into 10 % diluted commercial normal human sera at four levels of 7.5×10-12 M, 7.5×10-13 M, 5.0×10-14 M and 7.5×10-15 M, the recovery was measured in a range between 98.6 % and 104.9 % with relative standard deviation (RSD) of content between 1.9 % and 5.4 % (Table 3). This is excellent if considering the analyte is at an ultra-trace level. The real applicability of the method was further validated by determination miRNA-15a in blood samples from healthy volunteer and an early stage colon cancer patient. The measured concentrations were about 3.46 and 10.5 fM in 40 % diluted patient and healthy serum (Table S1), respectively. The signal intensity of miRNA-15a in cancer patient is clearly down-regulated for nearly 2 folds compared with the healthy (Figure 4D), which is similar to the reported data measured from colorectal cancer tissues.39
Table 3. Recovery of miRNA-15a added in 10 % diluted normal human serum. Sample
Added(M)
Found(M)
Recovery(%)
RSD(%)
1
7.5×10-12
(7.4±0.2)×10-12
98.6
2.1
2
-13
7.5×10
(7.3±0.3)×10
-13
98.4
3.6
3
5.0×10-14
(5.0±0.3)×10-14
100.1
5.4
4
7.5×10-15
(7.8±0.2)×10-15
104.9
1.9
Validation and application. The method has been shown to be extremely sensitive, and herein we demonstrate that it is also precise, suitable for quantitative analysis. To demonstrate, miRNA-15a standard solutions at a concentration ranging from 0.50 fM to 0.50 nM were measured under the optimized experimental conditions. Figure 4A shows the concentrationdependent images of miRNA-15a. Their gray value shows a clear linear variation with the spot location which was designed to depend on the concentration of miRNA-15a (Figure 4B). The better linear calibration curve was plotted by the imaging intensity against the logarithm of concentration of analyte (Figure 4C), covering a concentration range over 6 orders of magnitude (where the first point was a bit below LOD and was presently excluded). The linear correlation coefficient was above 0.99 and low limit of quantification down to
CONCLUSION The serious challenge to SPRi determination of the ultra-trace miRNAs in human blood samples can now be largely alleviated by use of our newly explored OSA-based SPRi method. In this study, the OSA strategy has been validated to be able to guide the design and establishment of an extremely sensitive SPRi method for the determination of ultra-trace miRNAs. The practical method exploited based on OSA was demon6
ACS Paragon Plus Environment
Page 7 of 8
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Analytical Chemistry (8) Persat, A.; Santiago, J. G. Anal. Chem. 2011, 83, 2310-2316. (9) Persat, A.; Chivukula, R. R.; Mendell, J. T.; Santiago, J. G. Anal. Chem. 2010, 82, 9631-9635. (10) Fang, S.; Lee, H. J.; Wark, A. W.; Corn, R. M. J. Am .Chem. Soc. 2006, 128, 14044-14046. (11) Liao, R.; He, K.; Chen, C.; Chen, X.; Cai, C. Anal. Chem. 2016, 88, 4254-4258. (12) Li, S.; Xu, L.; Ma, W.; Wu, X.; Sun, M.; Kuang, H.; Wang, L.; Kotov, N. A.; Xu, C. J. Am .Chem. Soc. 2016, 138, 306-312. (13) Yang, C.; Shi, K.; Dou, B.; Xiang, Y.; Chai, Y.; Yuan, R. ACS Appl. Mater. Interfaces 2015, 7, 1188-1193. (14) Wang, W.; Kong, T.; Zhang, D.; Zhang, J.; Cheng, G. Anal. Chem. 2015, 87, 10822-10829. (15) Spoto, G.; Minunni, M. J. Phys. Chem. Lett. 2012, 3, 26822691. (16) Fasoli, J. B.; Corn, R. M. Langmuir 2015, 31, 9527-9536. (17) Vance, S. A.; Sandros, M. G. Sci. Rep. 2014, 4, 5129. (18) Walgama, C.; Al Mubarak, Z. H.; Zhang, B.; Akinwale, M.; Pathiranage, A.; Deng, J.; Berlin, K. D.; Benbrook, D. M.; Krishnan, S. Anal. Chem. 2016, 88, 3130-3135. (19) Singh, V.; Rodenbaugh, C.; Krishnan, S. ACS sens. 2016, 1, 437-443. (20) Zhou, W. J.; Chen, Y. L.; Corn, R. M. Anal. Chem. 2011, 83, 3897-3902. (21) Kwon, M. J.; Lee, J.; Wark, A. W.; Lee, H. J. Anal. Chem. 2012, 84, 1702-1707. (22) Hu, W. H.; He, G. L.; Zhang, H. H.; Wu, X. S.; Li, J. L.; Zhao, Z. L.; Qiao, Y.; Lu, Z. S.; Liu, Y.; Li, C. M. Anal. Chem. 2014, 86, 4488-4493. (23) Lee, H. J.; Wark, A. W.; Corn, R. M. Langmuir 2006, 22, 5241-5250. (24) Knez, K.; Spasic, D.; Delport, F.; Lammertyn, J. Biosens. Bioelectron. 2015, 67, 394-399. (25) Seefeld, T. H.; Zhou, W. J.; Corn, R. M. Langmuir 2011, 27, 6534-6540. (26) Zhao, Q.; Lu, X.; Yuan, C. G.; Li, X. F.; Le, X. C. Anal. Chem. 2009, 81, 7484-7489. (27) Doldan, X.; Fagundez, P.; Cayota, A.; Laiz, J.; Tosar, J. P. Anal. Chem. 2016, 88, 10466-10473. (28) Barbey, R.; Lavanant, L.; Paripovic, D.; Schuwer, N.; Sugnaux, C.; Tugulu, S.; Klok, H. A. Chem. Rev. 2009, 109, 54375527. (29) Vaisocherova, H.; Sipova, H.; Visova, I.; Bockova, M.; Springer, T.; Ermini, M. L.; Song, X.; Krejcik, Z.; Chrastinova, L.; Pastva, O.; Pimkova, K.; Dostalova Merkerova, M.; Dyr, J. E.; Homola, J. Biosens. Bioelectron. 2015, 70, 226-231. (30) Liu, Y.; Dong, Y.; Jauw, J.; Linman, M. J.; Cheng, Q. Anal. Chem. 2010, 82, 3679-3685. (31) Liu, C.; Wang, X.; Xu, J.; Chen, Y. Anal. Chem. 2016. (32) Huang, J.; Su, X.; Li, Z. Anal. Chem. 2012, 84, 5939-5943. (33) Ding, X.; Yan, Y.; Li, S.; Zhang, Y.; Cheng, W.; Cheng, Q.; Ding, S. Anal. Chim. Acta. 2015, 874, 59-65. (34) Li, J.; Lei, P.; Ding, S.; Zhang, Y.; Yang, J.; Cheng, Q.; Yan, Y. Biosens. Bioelectron. 2016, 77, 435-441. (35) Zhang, D.; Yan, Y.; Cheng, W.; Zhang, W.; Li, Y.; Ju, H.; Ding, S. Microchimi. Acta 2013, 180, 397-403. (36) Qiu, X.; Liu, X.; Zhang, W.; Zhang, H.; Jiang, T.; Fan, D.; Luo, Y. Anal. Chem. 2015, 87, 6303-6310. (37) Wang, Q.; Li, Q.; Yang, X.; Wang, K.; Du, S.; Zhang, H.; Nie, Y. Biosens. Bioelectron. 2016, 77, 1001-1007. (38) Liu, R.; Wang, Q.; Li, Q.; Yang, X.; Wang, K.; Nie, W. Biosens. Bioelectron. 2017, 87, 433-438. (39) Xiao, G., Tang, H., Wei, W., Jian, L., Ji, L., & Jie, G. Gastroent. Res. Pract. 2014, 364549.
strated to be capable of selective determination of standard miRNA-15a spiked in human serum samples, with LOD down to 0.56 fM and ideal recovery between 98.6% and 104.9%. The method was also validated by quantification of miRNA15a in real samples such as those from healthy person and cancer patient. Furthermore, the method is readily extendable to the determination of other miRNAs, requiring only change the sequence of H1 and hence H2 to match the new sequence of target miRNAs. Similarly, the OSA strategy has also a potential to guide the design and establishment of other sensitive analytical methods, not confining only within the SPRi field.
ASSOCIATED CONTENT Supporting Information The Supporting Information is available free of charge on the ACS Publications website at DOI: Preparation of SPRi chip with gold islands isolated by hydrophobic CYTOP and performance of chip by hydrophilic sample; self-hybridization of single strand DNA H1 and H2 into hairpin structure; synthesis of bromoisobutyryl NHS active ester initiators (NHS-Br); tagging H2 at its 3′-end with polymerizing initiator; optimization of probe H1 concentration and H1-H2 hybridization; in-plane amplification of either SPRi or SPR signals; preparation of polymerizing monomer solution and selection of polymers for vertical amplification; AFM characterization of SPRi chips (PDF).
AUTHOR INFORMATION Corresponding Author *Tel.: 86-10-82615622. E-mail:
[email protected]. *Fax: 86-10-62559373. Tel.: 86-10-62618240. E-mail:
[email protected].
Author Contributions The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript.
Notes The authors declare no competing financial interest.
ACKNOWLEDGMENT The financial supports from NSFC (Nos. 21235007, 21475136, and 21621062) and CAS (No. QYZDJ-SSW-SLH034) are gratefully acknowledged by the authors.
REFERENCES (1) Graybill, R. M.; Bailey, R. C. Anal. Chem. 2016, 88, 431-450. (2) Dong, H.; Lei, J.; Ding, L.; Wen, Y.; Ju, H.; Zhang, X. Chem. Rev. 2013, 113, 6207-6233. (3) Bovell, L., Katkoori, V. R., Shanmugam, C., Lee, C. H., Meleth, S., & Bumpers, H. L. Cancer Res. 2011, 70, 4037-4037. (4) Li, F.; Mahato, R. I. Mol. Pharm. 2014, 11, 2539-2552. (5) Ibrahim, A. F.; Weirauch, U.; Thomas, M.; Grunweller, A.; Hartmann, R. K.; Aigner, A. Cancer Res. 2011, 71, 5214-5224. (6) Laurenti, M.; Paez-Perez, M.; Algarra, M.; Alonso-Cristobal, P.; Lopez-Cabarcos, E.; Mendez-Gonzalez, D.; Rubio-Retama, J. ACS Appl. Mater. Interfaces 2016, 8, 12644-12651. (7) Khan, N.; Cheng, J.; Pezacki, J. P.; Berezovski, M. V. Anal. Chem. 2011, 83, 6196-6201.
7
ACS Paragon Plus Environment
Analytical Chemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Table of Contents artwork 216x163mm (300 x 300 DPI)
ACS Paragon Plus Environment
Page 8 of 8
