Synthesis and Antiviral Activity of Peptide-Oligonucleotide Conjugates

Bioconjugate Chem. 1995, 6, 573-577

573

Synthesis and Antiviral Activity of Peptide-Oligonucleotide Conjugates Prepared by Using Na-(Bromoacetyl)peptides Khalil Arar, Anne-Marie Aubertin,+ Annie-Claude Roche, Michel Monsigny, a n d Roger Mayer* Laboratoire de Biochimie des Glycoconjugues, Centre de Biophysique Moleculaire, CNRS, rue Charles-Sadron, F-45071 Orleans Cedex 02, France, and Institut de Virologie, INSERM U 74, 3 rue Koeberle, F-67000 Strasbourg, France. Received January 10, 1995@

Antisense oligonucleotides represent an interesting tool for selective inhibition of gene expression. In order to direct oligonucleotides to specific compartments within the cell, we have investigated the possibility of coupling them to a signal peptide Lys-Asp-Glu-Leu (KDEL). This sequence should be able to convey oligonucleotides to the endoplasmic reticulum and from there to the cytosol and the nucleus where their targets are located. On this basis we prepared peptide-oligonucleotide conjugates by coupling, in a single step, a N,-bromoacetyl peptide with a n oligonucleotide bearing a thiol group, through a thioether bond. This paper deals with the definition of the optimal pH and temperature conditions leading to a n efficient synthesis of peptide-oligonucleotide conjugates: the reaction was quantitative at pH 7.5 within few hours. This method was first set up using a 5’,3’-modified dodecanucleotide and a (bromoacety1)pentapeptide as a conjugation model. Then a 5’,3’-modified pentacosanucleotide, complementary to the translation initiation region of the gag mRNA of HIV, was coupled to a (bromoacety1)dodecapeptide containing a KDEL signal sequence. The anti-HIV activity of the pentacosanucleotide was compared with that of pentacosanucleotide-dodecapeptide conjugates linked through either a thioether bond or a disulfide bridge. The conjugate with a thioether bond has a higher antiviral activity than the peptide-free oligonucleotide and the conjugate linked via a disulfide bond.

(8-10). Recently, we described a method where a N,-

INTRODUCTION

Antisense oligodeoxyribonucleotides are able to inhibit viral and cell gene expression in a sequence specific manner (1,2). Therefore, oligonucleotides are putative therapeutic agents. Their suspected site of action is either the cytosol or the nucleus. In any case, oligonucleotides have to cross a membrane as long a s they are applied extracellularly. But since they are polyanions they are not able to cross a lipid bilayer. Free oligonucleotides enter cells by endocytosis and/or pinocytosis, and consequently, they are mainly found in endosomes (3). We hypothesized that oligonucleotides may cross the membrane from either the late endosome, the golgi apparatus, the endoplasmic reticulum-golgi intermediate compartment (ERGIC), or even the endoplasmic reticulum and proposed that oligonucleotides associated with a recognition signal specific for endoplasmic reticulum could increase the amount of oligonucleotide traveling toward these compartments. One such candidate is a peptide containing the segment Lys-Asp-Glu-Leu (KDEL) in a C-terminal position since KDEL is involved in the recycling of proteins from cis-golgi and ERGIC to endoplasmic reticulum (4). On the bases of these data, we synthesized oligonucleotides substituted by a peptide containing a C-terminal KDEL sequence. The one-step synthesis of such hybrids, on solid-phase peptide or DNA synthesizers, has been reported (5-7). This method is, however, unsatisfactory due to the lack of “universal” protecting groups suitable for such a strategy and to side reactions during the coupling and the cleavage steps. Alternatively, such hybrids may be obtained by a postsynthesis conjugation

* To whom correspondence should be addressed. Tel: (33) 38 51 55 62. Fax: (33) 38 69 00 94. E-mail : mayeacnrs-orleans.fr. ’Institut de Virologie. Abstract published in Advance ACS Abstracts, July 15, @

1995.

maleimidopeptide was appended to a n oligonucleotide substituted with a thiol group (11). In this paper a postsynthesis conjugation is described by linking, through a thioether bond, in a single step, a n oligonucleotide bearing a thiol group to a N,-(bromoacetyl)peptide containing a C-terminal KDEL sequence. A dodecanucleotide, specific for Ha-rus around the point mutation in the 12th codon, was first coupled to a pentapeptide, as a short model. Then a pentacosanucleotide, complementary to the AUG initiation site of the HIV-1 gag mRNA, was coupled to a dodecapeptide. The antiviral activity of this peptide-oligonucleotide conjugate was assessed by monitoring its capacity to inhibit HIV-1 in infected human peripheral blood mononuclear cells. MATERIAL AND METHODS

1,l’-Carbonyldiimidazole (CDI), 1,8diaminohexane, NJV-dicyclohexylcarbodiimide(DCC), and anisole were purchased from Merck (Darmstadt, Germany) ; tris(2carboxyethy1)phosphine (TCEP)l from Molecular Probes (La Jolla, CAI, bromoacetic acid from Aldrich (Strasbourg, France), tert-butyloxycarbonyl amino acids, Boc-LeuPAM-resin, and N-hydroxybenzotriazole (HOBt) from Novabiochem (Laufelfingen, Switzerland), (benzotriazollyloxy)tris(dimethylamino)phosphonium hexafluorophosphate (BOP) from Richelieu Biotechnologies (Saint Hyacinthe, Canada), and fluorhydric acid (HF) from SeticLab0 (Magny-Les-Hameaux,France). Dimethylformamide was freshly distilled on (benzyloxycarbonyUglycy1 p nitrophenyl ester. The 5’,3’-modifiedanti-gag pentacosaAbbreviations: all amino acids and their derivatives are of the L configuration; Boc, tert-butyloxycarbonyl; Npys, 3-nitro2-pyridyl-sulfenyl; Py, 2-pyridyl; TCEP, tris(2-carboxyethy1)phosphine; TEAAc, triethylammonium acetate; t ~ retention , time.

1043-1802/95/2906-0573$09.00/0 0 1995 American Chemical Society

574 Bioconjugate Chem., Vol. 6, No. 5 , 1995

nucleotide phosphodiester j‘CTCTCGCACCCATCTCTCTCCTTCTywas purchased from Genosys Biotechnologies (Cambridge, England). The peptides were synthesized on a Vega 250 peptide synthesizer (Du Pont, Wilmington, DE). The purity of synthetic peptides was assessed by analytical HPLC with a Waters 660E system controller and a Waters 991 photodiode array detector (Saint-Quentin en Yvelines, France) on a reversed-phase LiChrospher 100RP-18, 5 pm, 250 x 4 mm column (Merck) using a linear gradient from 5 to 90% CH3CN in Hz0 containing 0.1% TFA within 20 min. Amino acid analysis was performed on a Supelcosil LC-M-DB, 250 x 4.6 mm column (Supelco, Bellefonte, PA), upon hydrolysis by 5.6 N HC1 a t 105 “C for 24 h, using the phenyl isothiocyanate (PITC) derivatization method, The dodecanucleotide was synthesized on an Applied Biosystems DNA synthetizer Model 381A using fast oligonucleotide deprotection (FODs) and solidphase phosphoroamidite chemistry. The purity of synthetic oligonucleotides and peptide-oligonucleotide conjugates was assessed by analytical HPLC on the column used to purify the peptide. The gradient used was linear from 5 to 30% CH3CN in 0.1 M triethylammonium acetate (TEAAc), pH 7.0, within 30 min. The ’H (300 MHz) nuclear magnetic resonance spectra were recorded on a Bruker AM-300 spectrometer and are expressed as 6 units (parts per million) relative to tetramethylsilane as internal reference in 99.95 DMSOd6 solution. Mass spectrometry analysis of the peptides and of the oligonucleotide derivatives was performed either on a Lasermat (Finnigan MAT, San Jose, CA) matrix-assisted laser desorption ionization time-of-flight mass spectrometer or a Fisons Bio-Q (Manchester, U.K.) mass spectrometer using an electrospray ionization technique (12). Synthesis of Peptides Containing a KDEL Sequence. The peptide Br-CHz-CO-Tyr-Lys-Asp-Glu-LeuOH (3) was synthesized using a Boc-Leu4phenylacetamido)methyl-substituted resin and a Boc/Bzl strategy according to Merrifield (13). The Boc protecting group was removed from the amino terminus with a solution of TFA 40% in CH2C12,followed by neutralization of the peptidyl resin with N,N-diisopropylethylamine. At the last step, bromoacetic anhydride reacted with the N,amino terminal group to form the N-(bromoacetyl)protected peptide-resin (14). The peptide was deprotected and released from the resin by treatment for 90 min a t 0 “C with 10 mL of HF in the presence of 1 mL of anisole used as scavenger. The peptide was extracted with trifluoroacetic acid and precipitated in dry diethyl ether. The peptide purity was assessed by analytical HPLC on a reversed-phase LiChrospher 100RP-18,5pm, column using a linear gradient (from 5 to 90%) of CH3CN in HzO containing 0.1% TFA in 20 min. The peptide was eluted a t 18.9 min. The purified peptide was characterized by mass spectrometry [calcd 786.2 (monoisotopic), found 787.11. Amino acid analysis: Tyr (0.901,Lys (0.961, Asp (l.lO), Glu (1.041, Leu (1.00). IH NMR spectrum in DMSO-de: 6 (ppm) 0.89 (dd, 6H, 6CH3 Leu), 1.30 (m, 2H, yCHz Lys), 1.50 (m, l H , yCH Leu), 1.51 (m, 2H, PCHz Leu), 1.52 (m, l H , P C H Lys), 1.54 (m, 2H, 6CHz Lys), 1.65 (m, l H , PCH Lys), 1.73 (m, l H , P C H Glu), 1.9 (m, l H , PCH Glu), 2.23 (m, 2H, yCH2 Glu), 2.55 (m, l H , PCH Tyr), 2.68 (m, l H , PCH Asp), 2.70 (m, l H , P’CH Tyr), 2.74 (m, 2H, E C H Lys), ~ 2.92 (m, l H , BCH Asp), 3.75 (s, 2H, CH2BrAc), 4.18 (m, lH, aCH Leu), 4.27 (m, l H , aCH Lys), 4.29 (m, l H , aCH Glu), 4.45 (m, l H , aCH Asp), 4.55 (m, l H , aCH Tyr), 6.66 (d, l H , 2-5 Tyr), 7.02 (d, 2H, 3-6 Tyr), 7.52 (m, 3H, E N HLys), ~ 7.72 (d, l H ,

Arar et al.

aNH Glu), 8.05 (d, l H , aNH Leu), 8.21 (d, l H , aNH Lys), 8.22 (d, lH, aNH Tyr), 8.35 (d, l H , aNH Asp). Using the same strategy, we have prepared the peptide

Br-CH2-CO-Tyr-Gly-Glu-Glu-Asp-Thr-Ser-Glu-Lys-AspGlu-Leu-OH corresponding to the C-terminal sequence of the glucose regulated protein (GRP 78) resident in the lumen of the endoplasmic reticulum (15).This peptide, purified by HPLC, was eluted a t 15.4 min using the same gradient system. The purified peptide was characterized by mass spectrometry [calcd 1533.5 (monoisotopic),found 1535.31. Synthesis of Y - A m i n o , 3’-Disulfide Bridge Oligonucleotide. (5’ NH2-R~-oligonucleotide-R~-S-S-R2-OH). The oligonucleotide NH2-R1-d(5’ACACCGACGGCG3’)-R2-S-SR3 with R1 = (CH2)6NHCO,RZ= O(CHZCH~O)ZCHZCH~, and R3 = (CH2CH20)3H,specific for H a m s around the point mutation in the 12th codon, was synthesized on a disulfide-derivatized solid support (10 pmol scale) as previously described (16). This oligonucleotide was purified on a reversed-phase LiChrospher 100RP-18 column using a linear gradient from 5 to 30% of CH3CN in 0.1 M triethylamine acetate (TEAAc),pH 7.0, within 30 min. The oligonucleotide was eluted a t 21.9 min. The protection of the oligonucleotide a t both 5’ and 3’ ends prevents it from degradation by exonucleases. An amino group was added a t the 5‘ end with the aim of introducing a fluorescent tag in order to study the intracellular traffic of the oligonucleotide and of the peptide-oligonucleotide conjugate. Synthesis of the 5’-NH2, 3’-Thiol Activated Group (SS-PY) Dodecanucleotide (1). The disulfide bridge of 1 pmol of 5’-NHz, 3’-disulfide bridge oligonucleotide was reduced with 1.1pmol of tris(2-carboxyethy1)phosphine (TCEP) (17) in 1 mL of 0.1 M phosphate buffer, pH 7.0, at room temperature for 1 h to give quantitatively the 12 mer 3’-thiol activated group (S-S-Py)by reaction with 10 pmol 2,2‘-dithiodipyridine. This oligonucleotide was eluted a t 21.1 min upon HPLC using the above-described system. Synthesis of Peptide-Oligonucleotide Conjugates through a Thioether Bond. According to Scheme 1, oligonucleotide-S-S-Py(1)(1pmol), in 1mL of 2 M NaC1, 0.1 M phosphate buffer pH 7.0, was reduced with 1.1 pmol of TCEP for 1 h a t room temperature under nitrogen. Without extraction of the slight TCEP excess, 5 pmol of the peptide Br-CHz-CO-Tyr-Lys-Asp-Glu-LeuOH (3) was added directly into the solution of the oligonucleotide bearing a thiol function (2). The thiol function reacted with the N-(bromoacety1)peptide within 5 h a t room temperature, pH 7.0, giving a peptideoligonucleotide conjugate in 100% yield based on the substitution of the oligonucleotide as shown on Figure 1. The same strategy was used to prepare quantitatively a dodecapeptide-pentacosanucleotide conjugate by coupling the Py-S-S-R4-d(rCTCTCGCACCCATCTCTCTCCTTCT3’)-R5-NH2oligonucleotide [with Rq = ( C H Z ) ~ P O ~ and R5 = -OCH2CH(CH20H)(CH2)4], with the Br-CH2-

CO-Tyr-Gly-Glu-Glu-Asp-Thr-Ser-Glu-Lys-Asp-GluLeu-OH peptide (Table 1). Synthesis of a Dodecapeptide -Pentacosanucleotide Conjugate through a Disulfide Bond. The oligonucleotide Py-

S-S-R4-d(’’CTCTCGCACCCATCTCTCTCCTTCT3’)-R5NHz (0.1 pmol in 1 mL of 0.1 M phosphate buffer, pH 7.0) was reduced with 0.11 pmol of TCEP at room temperature for 1 h to give the pentacosanucleotide 5’thiol derivative. The conjugate was obtained by adding 2 pmol of the dodecapeptide C(Npys)GEEDTSEKDEL into a solution of the oligonucleotide bearing a thiol

Peptide-Oligonucleotide Conjugates function in 0.1 M phosphate buffer, pH 7.0, a t room temperature under nitrogen (Table 1). Characterizationof the Conjugates. The progress of the ligation between the 3'-thiol dodecanucleotide and the (bromoacety1)pentapeptidewas followed by analytical HPLC on a reversed-phase LiChrospher 100RP-18 column (Figure 1). After purification, the peptide-oligonucleotide conjugate (compound 4) ( t =~ 20.6 min) had the expected oligonucleotide spectral characteristics and the expected amino acid composition (Tyr(O.89), Lys(1.151,Asp(0.951, Glu(l.ll), Leu(l.OO));small amounts of glycine and other amino compounds deriving from oligonucleotide degradation during acidic hydrolysis were also detected. Electrospray mass spectrometry confirmed the molecular mass calculated for the peptide-oligonucleotide conjugate (12). These methods were used to purify and characterize all the conjugates. Stability of the N,-(Bromoacety1)peptide a t Different pH. To assess the stability of the (bromoacetyl)peptide, Br-CH2-CO-Tyr-Lys-Asp-Glu-Leu-OH was dissolved in 0.1 M sodium phosphate buffer (pH 7.0) or in 0.1 M sodium bicarbonate (pH 8.5). Solutions were kept a t 25 "C, and aliquots were periodically withdrawn and subjected to HPLC analysis on a C18 column (data not shown). The (bromoacety1)peptide incubated in a phosphate buffer, pH 7.0, or a bicarbonate buffer, pH 8.5, for 0, 1, 12, or 24 h was neither degraded nor polymerized. The bromoacetyl moiety did not react with the +amino group of lysine a t any pH between 7.0 and 8.5. Assay for HIV Inhibition. The assay procedure for measuring the anti-HIV activity of peptide-oligonucleotide conjugates in peripheral blood mononuclear (PBMC) cells was based on a quantitative detection of reverse transcriptase (RT) activity in the culture supernatant. PBMC from healthy donors (HIV seronegative), isolated by centrifugation, were propagated and infected with HIV-1 (IIIB) isolate as previously described (18). Thirty min after virus adsorption, cells were washed and then cultured a t 4 x lo5 cells/mL of culture medium in the presence of the oligonucleotide derivatives. On day 3, half of the medium was removed and replaced by a fresh medium containing the appropriate oligonucleotide derivative concentrations. Seven days later, the virus released from the cells was evaluated by the RT assay. The cytotoxicity of oligonucleotide derivatives was evaluated by the MTT method (19) in parallel with their antiviral activity. The MTT assay is based on the viability of infected cells and on the capacity of mitochondrial dehydrogenase of living cells to reduce 3-(4,5dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide into formazan. The quantity of formazan produced, measured a t 540 nm, is in relation to the number of living cells.

Bioconjugate Chem., Vol. 6,No. 5, 1995 575

Scheme 1. Synthesis of a Peptide-Oligonucleotide Conjugatea NH2-Rl-ACACCGACGGCG- R 2 - S - s - p ~ (1)

I

TCEP

NHz-RI-ACACCGACGGCG-R~GH 5r-CH2-CO-Tyr-Lys-Asp-Glu-Leu-OH

(3)

(2)

I

I

pH 7.0

i ~'NH2-R1-ACACCGACGGCG-R2-S-C~~-CO-Tyr-Lys-Asp-Glu-Leu-OH

(4)

Key: TCEP, tris(2-carboxyethy1)phosphine;Py, 2-pyridyl; RI, (CH216NHCO; R2, O(CHzCHz0)2CHzCHz. a

compound 2 compound 4

I

I

1

i

1 T=5h

T=l h

T=O

II

I

11 L--'JL I

0

compound 4

10 20 time (min)

L-,*U 0

'I

L-1"

\-

10 20 time (min)

0

L

10 20 time (min)

Figure 1. HPLC analysis of the formation of a pentapeptidedodecanucleotide conjugate at pH 7.0, at 25 "C. Aliquots of the ligation reaction, taken a t t = 0, t = 1, and t = 5 h, were immediately analyzed. The progress of the ligation was followed by reversed-phase HPLC on a Lichrospher 250 x 4 mm column. Mobile phase A was 0.1 M triethylamine acetate buffer (TEAAc), pH 7.0 5% acetonitrile, and mobile phase B was acetonitrile 5% 0.1 M TEAAc. The gradient from 5% to 70% B was developed within 30 min. The flow rate was 1 m u m i n . (Compounds 1-4 are those described in Scheme 1.)

+

+

synthesis of N,-(bromoacetyl)peptides was achieved as follows: bromoacetic anhydride was prepared by condensation of 2 equiv of bromoacetic acid in the presence of 1equiv of dicyclohexylcarbodiimide;the formation of the anhydride was assessed by the two characteristic IR bands a t 1750 and 1830 cm-'. Then the anhydride reacted with the a-amino group of the protected peptide on the resin. Finally, the peptide was deprotected and released from the resin using a standard HF deprotection. RESULTS AND DISCUSSION A dodecanucleotide specific for Ha-ras around the 12th codon mutation point and bearing a thiol-activated group Synthesis Strategy. In a n attempt a t increasing on its 3' end was synthesized by solid phase synthesis their activity, antisense oligonucleotides were coupled to using a modified solid support according to Bonfils and peptides containing in a C-terminal position a Lys-AspThuong (16). The protection of the 3' end of the oligoGlu-Leu (KDEL) sequence specifically recognized by a nucleotide is requested in order to prevent exonuclease receptor allowing intracellular KDEL bearing proteins degradation. to recycle to the endoplasmic reticulum. Such peptideoligonucleotide conjugates are expected to travel inside Conjugates were formed by adding the (bromoacetyl)the cell to the endoplasmic reticulum and eventually to peptide, as a solid, to the oligonucleotide bearing a thiol pass through a membrane to enter the cytosol and the function either on its 3' or 5' end. Both the peptide and nucleus where the antisense oligonucleotide targets are the oligonucleotide were readily soluble in the reaction located. buffer. The reaction steps for the conjugation are shown The peptides Br-CH2-CO-Tyr-Lys-Asp-Glu-Leu and Brin Scheme 1. The thiol-substituted oligonucleotide reCH2-CO-Tyr-Gly-Glu-Glu-Asp-Thr-Ser-Glu-Lys-Asp-Gluacted with the N,-(bromoacetyl)peptide within 5 h a t pH Leu-OH were synthesized on a solid support according 7.0 as shown in Figure 1. The oligonucleotide-peptide to the Merrifield strategy. Both contain a n additional ligation reaction was carried out a t different pH (7.0,7.5, 7.9, and 8.5). Figure 2 shows that the linkage efficiency tyrosyl residue introduced as a radiolabelable tag. The

Arar et al.

576 Bioconjugate Chem., Vol. 6,No. 5, 1995

'pH85

i

1

2

3

4

5

6 7 8 Tine (P)

9

C ' l l i

Figure 2. Synthesis of peptide-oligonucleotide conjugate a t 25 "C, at various pH. The yield was calculated from the amount of conjugate determined upon HPLC analysis as described in , pH 8.5. Figure 1. Key: A, pH 7.0; +, pH 7.5; * pH 7.9; . 1 ic

I ++

x

40°C

c

05

1

2 2 5 3 35 Concentrat on 0.M)

'5

4

45

5

Figure 4. Anti-HIV-1 activity of peptide-free anti-gag pentacosanucleotide (A), of the anti-gag pentacosanucleotide substituted with the GEEDTSEKDEL peptide through a thioether bond (B), and through a disulfide bond (C). Infected cells were incubated with various oligonucleotide concentrations; after 3 days, half of the medium was replaced by fresh medium containing the oligonucleotide a t the same concentration. The inhibition of reverse transcriptase (RT) activity was measured after 1week of incubation in the presence of the oligonucleotide derivatives. All data represent the mean values of two independent experiments.

and a larger peptide. By this method, the peptide NuI

(bromoacetyl)Tyr-Gly-Glu-Glu-Asp-Thr-Ser-Glu-Lys-AspGlu-Leu-OH, corresponding to the C-terminal sequence

of the glucose regulated protein (GRP 781, was conjugated with an antisense 5'-thioLpentacosanucleotide specific for gag mRNA AUG site of HIV-1 (Table 1). 1 In order to study the influence of the nature of the bond 2 3 4 5 E 7 8 9 ' 3 ' 1 12 between the peptide and the oligonucleotide, a conjugate, Time (h) in which both moieties are linked through a disulfide Figure 3. Synthesis of peptide-oligonucleotide conjugate at bridge, was also prepared. This conjugate was obtained pH 7.0, at various temperatures. The yield was calculated from by coupling the thiol function carried by the anti-gag the amount of conjugate determined upon HPLC analysis as pentacosanucleotide to the dodecapeptide C(Npys)described in Figure 1. Key: 0 , 5 "C; A, 20 "C; *, 40 "C. GEEDTSEKDEL bearing a cysteine thiol activated group on its N-terminal end. The main characteristics of these of the (bromoacety1)peptide to the oligonucleotide-SH is compounds are reported in Table 1. pH-dependent. In 1 h, a t pH 8.5, the yield of the Antiviral Activity. The anti-HIV-1 activity of the peptide-oligonucleotide conjugate was 72%, but 28% of conjugates was monitored, in vitro, by measuring the the oligonucleotide was evidenced as a dimer ( t =~ 26.5 reverse transcriptase activity in the culture supernatant min). At optimal pH, ranging from 7.0 to 7.9, the yield of infected human PBMC. After 7 days, the viruses was essentially quantitative with no trace of oligonuclereleased from the cells were assessed by using a reverse otide monomer or dimer. Figure 3 shows that, a t pH 7.0, transcriptase (RT) assay. From Figure 4, it appears that the conjugation rate of the oligonucleotide with the the anti-gag pentacosanucleotide-S-CH2-CO-YGEEDTpeptide is also temperature dependent. At 40 "C, the SEKDEL conjugate (IC50= 0.61 f 0.03 pM; mean f SD) reaction was completed in less than 3 h. From these was three times more efficient than the peptide-free antidata, its appears that the thioether bond was formed gag oligonucleotide (IC50= 1.80 f 0.14pM) and 10 times quantitatively when the reaction occurred a t pH 7.5, a t more efficient than the anti-gag oligonuc1eotide-S-S40 "C. After purification, the conjugate had the spectral CGEEDTSEKDEL (IC50 > 5 pM), which contains a characteristics expected from both the oligonucleotide disulfide bridge instead of a thioether linkage. This moiety and the amino acid moiety. Electrospray mass result may be explained by the fact that the disulfide spectrometry confirmed the calculated molecular weight bridge is cleaved early (20) before reaching the cytosol of the conjugate. This procedure allowed the preparation, in quantitative or nucleus. In contrast, the 5',3' unmodified oligonucleyield, of conjugates containing a larger oligonucleotide otide was totally inactive a t 10 pM, the highest concenTable 1. Molecular Mass and Retention Time of the Compounds Analyzed by HPLC AE Described in Figure 1 0

n

i

compds anti-gag pentacosanucleotide

molecular mass calcd found

tR

(min)

PY-S-S-R~-("CTCTCGCACCCATCTCTCTCCTTCT~)-R~-NH~ 7887.9

7889

22.1

H-C(NPYS)GEEDTSEKDEL-OH anti-gig -s-S-CGEEDTSEKDEL-OH

1508.9 9132 1535.3 9234

23.9 21.8 20.1 24.1

Br-CH2-CO-YGEEDTSEKDEL-OH anti-gag-S-CH2-CO-YGEEDTSEKDEL-OH

1507.5 9129.4 1533.5 9232.5

Bioconjugate Chem., Vol. 6,No. 5, 1995 577

Peptide-Oligonucleotide Conjugates

tration tested, supporting the protective effect of the 5' and 3' spacer arms against exonuclease degradation of the oligonucleotides. Even a t the upper concentration used, the conjugates did not elicit any toxicity. In conclusion, N,-(bromoacetyl)peptides, which are easily prepared on a solid support, can be used for the efficient and reproducible preparation of peptide-oligonucleotide conjugates. At pH 7.5, the (bromoacetyl)peptide reacts with a thiol group carried by a n oligonucleotide leading, within 3 h a t 40 "C, to a peptideoligonucleotide conjugate, in a quantitative yield. Under these conditions, there was no evidence of reaction between the bromoacetyl group and either the phenol group of tyrosine or the €-amino group of lysine residue of the peptide. (Bromoacety1)peptides have been used to prepare conformationally constrained cyclic or polymeric peptides and peptide-carrier conjugates (21, 22). The l-(p (bromoacetamido)benzyl)-EDTA was used for specific conjugation of BSA on its single free thiol group (23,241. The reaction selectivity of the bromoacetyl group toward a sulfhydryl group a t pH 7.5 is comparable to that of the iodoacetamido group and is significantly greater than that of maleimido or chloroacetyl groups (21). The use of TCEP as a reducing agent allows a one-pot preparation of a peptide-oligonucleotide conjugate; neither the extraction of the slight excess of TCEP nor the purification of the oligonucleotide mercaptan intermediate is required. In addition, oligonucleotide dimerization does not occur. The addition of an endoplasmic reticulum retention KDEL signal peptide to the pentacosanucleotide significantly enhances its anti-HIV activity. Data concerning the comparison between the intracellular traffic of the conjugate and of the peptide-free oligonucleotide will be described elsewhere. ACKNOWLEDGMENT

We thank Dr. A. Van Dorsselaer and Ms. N. Potier, LSMBO, Strasbourg, France, for electrospray mass spectra determination and Ms. E. Martin for her skillful assistance in synthesis and amino acid analysis. This work was partly funded by the Agence Nationale de Recherche sur le SIDA (ANRS) and the Association de Recherche sur le Cancer (ARC 6132). K.A. received a fellowship from the Ministere de 1'Enseignement et de la Recherche Scientifique. A.C.R. and A.M.A. are both Research Directors of the Institut National de la Sante et de la Recherche Medicale. R.M. is Research Director of the Centre National de la Recherche Scientifique, and M.M. is Professor of Biochemistry a t the University of Orleans. LITERATURE CITED (1) Helene, C., and Toulme, J. J. (1990) Specific Regulation of

Gene by Antisense, Sense and Antigene Nucleic Acids.

Biochim. Biophys. Acta 1049, 99-125. (2) Uhlmann, E.,and Peyman, A. (1990) Antisense Oligonucleotides: A New Therapeutic Principle. Chem. Rev. 90, 544-584. (3) Zhao, Q.,Matson, S., Herrera, C. J., Fisher, E., Yu, H., and Krieg, A. M. (1993) Comparison of cellular binding and uptake of antisense phosphodiester, phosphorothioate and mixed phosphorothioate and methylphosphonate oligonucleotides. Antisense Res. Develop. 3, 53-66. (4) Munro, S.,and Pelham, H. R. B. (1987) A C-Terminal Signal Prevents Secretion of Luminal ER Proteins. Cell 48, 899907. (5) Juby, C. D., Richardson, C. D., and Brousseau, R. (1991)

Facile Preparation of 3' Oligonucleotide-Peptide Conjugates. Tetrahedron Lett. 32, 879-882. (6) Haralambidis, J.,Duncan, L., and Tregear, G. W. (1987) The Solid Phase Synthesis of Oligonucleotides Containing a 3'Peptide Moiety. Tetrahedron Lett. 28, 5199-5202. (7) Haralambidis, J., Duncan, L., Angus, K., and Treagear, G. W. (1990) The Synthesis of Polyamide-Oligonucleotide Conjugate Molecules. Nucleic Acids Res. 18, 493-499. (8) Tung, C. H., Rudolph, M. J.,and Stein, S. (1991) Preparation of Oligonucleotide-Peptide Conjugates. Bioconjugate Chem. 2,464-465. (9) Zhu, T., Wei, Z., Tung, C. H., Dickerhof, W. A., Breslauer, K. J., Georgopoulos, D. E., Leibowitz, M. J., and Stein, S. (1993) Oligonucleotide-Poly-L-Ornithine Conjugates: Binding to Complementary DNA and RNA. Antisense Res. Develop. 3, 265-275. (10) Tong, G., Lawlor, J. M., Treagear, G. W., and Haralambidis, J. (1993) The Synthesis of Oligonucleotide-Polyamide Conjugates Molecules Suitable as PCR Primers. J. Org. Chem. 58, 2223-2231. (11) Arar, K., Monsigny, M., and Mayer, R. (1993) Synthesis of Oligonucleotide-Peptide Conjugates Containing a KDEL Signal Sequence. Tetrahedron Lett. 34, 8087-8090. (12) Potier, N., Van Dorsselaer, A,, Cordier, Y., Roch, O., and Bischoff, R. (1994) Negative electrospray ionization mass spectrometry of synthetic and chemically modified oligonucleotides. Nucleic Acids Res. 22, 3895-3903. (13) Merrifield, R. B. (1963) Solid Phase Peptide Synthesis. I. The Synthesis of a Tetrapeptide. J . Am. Chem. SOC.85,21492154. (14) Robey, F. A.,and Fields, R. L (1989) Automated Synthesis of N-Bromoacetyl-Modified Peptides for the Preparation of Synthetic Peptide Polymers, Peptide-Protein Conjugates, and Cyclic Peptides. Anal. Biochem. 177, 373-377. (15) Sorger, P. K., and Pelham, H. R. B. (1987). The glucoseregulated protein grp94 is related to heat shock protein hsp90. J . Mol. Biol. 194, 341-344. (16) Bonfils, E., and Thuong, N. T. (1991) Solid Phase Synthesis of 5', 3'-Bifunctional Oligodeoxyribonucleotides Bearing a Masked Thiol Group at the 3'-End. Tetrahedron Lett. 35, 3053-3056. (17) Burns, J. A., Bulter, J. C., Moran, J., and Whitesides, G. M. (1991) Selective reduction of disulfides by tris-(2-carboxyethy1)phosphine. J. Org. Chem. 56, 2648-2650. (18) Schinazi, R. F., Mcmillan, A., Cannon, D., Mathis, R., Lloyd, R. M., Peck, A., Sommadossi, J. P., Clair, M. S., Wilson, J., Furman, P. A., Painter, G., Choi, W.-B., and Liotta, D. C. (1992) Selective Inhibition of Human Immunodeficiency Viruses by Racemates and Enantiomers of cis-5-Fluoro-l[2-(Hydroxymethyl)-l,3-Oxathiolan-5-yll Cytosine. Antimicrob. Agents Chemother. 36, 2423-2431. (19) Pauwels, R., Balzarini, J., Baba, M., Snoeck, R., Schols, D., Herdewijn, P., Desmyter, J., and De Clercq, E. (1988) Rapid and Automated Tetrazolium-Based Colorimetric Assay for the Detection of Anti-HIV Compounds. J . Virol. Methods 20, 309-321. (20) Feener, E. P., Shen, W., Ryser, H. J. (1990) Cleavage of Disulfide Bonds in Endocytosed Macromolecules. A Processing not Associated with Lysosomes or Endosomes. J. Biol. Chem. 265, 18780-18785. (21) Bernatowicz, M. S.,and Matsueda, G. R. (1986) Preparation of Peptide-Protein Immunogens Using N-Succinimidyl Bromoacetate as a Heterobifunctional Crosslinking Reagent. Anal. Biochem. 155, 95-102. (22) Inman, J. K.,Highet, P. F., Kolodny, N., and Robey, F. A. (1991) Synthesis of Na-(tert-Butoxycarbonyl)-Nc-[N-(Bromoacetyl)-P-Alanyl]-L-Lysine:Its Use in Peptide Synthesis for Placing a Bromoacetyl Cross-Linking Function at any Desired Sequence Position. Bioconjugate Chem. 2, 458-463. (23) Rana, T. M., and Meares, C. F. (1990) Specific Cleavage of a Protein by an Attached Iron Chelate. J . Am. Chem. SOC. 112, 2457-2458. (24) Rana, T. M., and Meares, C. F. (1991) Iron Chelate Mediated Proteolysis: Protein Structure Dependence. J . Am. Chem. SOC.113, 1859-1861. BC9500431