Synthesis and Evaluation of a Triplex-Forming Oligonucleotide

Bioconjugate Chem. 2004, 15, 1182−1192

1182

Synthesis and Evaluation of a Triplex-Forming Oligonucleotide-Pyrrolobenzodiazepine Conjugate Zhanna V. Zhilina,† Amy J. Ziemba,† John O. Trent,‡ Michael W. Reed,§,| Vladimir Gorn,§ Qun Zhou,†,⊥ Wenhu Duan,†,⊥ Laurence Hurley,† and Scot W. Ebbinghaus†,* Arizona Cancer Center, University of Arizona, Tucson, Arizona 85724-5024, James Graham Brown Cancer Center, University of Louisville, Louisville, Kentucky 40202, and Epoch Biosciences, Bothell, Washington 98021.. Received June 9, 2004; Revised Manuscript Received August 25, 2004

In most cases, unmodified oligonucleotides designed as antigene molecules are incapable of binding to DNA with sufficient stability to prevent gene expression. To stabilize binding to a polypurine tract in the HER-2/neu promoter, a triplex forming oligonucleotide (TFO) was conjugated to a pyrrolo[1,4]benzodiazepine (PBD), desmethyltomaymycin, and site-specific DNA binding was evaluated. An activated ester of the PBD moiety was conjugated by an acylation reaction to a free primary amine on a 50-atom aliphatic linker at the 5′ end of the TFO. This long aliphatic linker was designed to provide a bridge from the major groove binding site of the TFO to the minor groove binding site of the PBD. Triplex formation by the resulting TFO-PBD conjugate occurred more slowly and with a nearly 30fold lower affinity compared to an unconjugated TFO. PBD binding to the triplex target was demonstrated by protection from restriction enzyme digestion, and covalent binding to the exocyclic amino group of guanine was inferred by substituting specific guanines with inosines. Although the binding of the TFO was less efficient, this report demonstrates that in principle, TFOs can be used to direct the binding of a PBD to specific location. Further optimization of TFO-PBD conjugate design, likely involving optimization of the linker and perhaps placing a PBD at both ends of the TFO, will be needed to make gene modification robust.

INTRODUCTION

The sequence-specificity of triplex forming oligonucleotides (TFOs1) gives these molecules tremendous potential as tools to alter gene expression (1). TFOs can potentially regulate gene expression by several different mechanisms including recombination, mutagenesis, and inhibition of RNA transcription (2, 3). Interstrand DNA triplex formation occurs through the binding of a TFO in the major groove of a polypurine:polypyrimidine tract of DNA (4, 5) by forming base specific Hoogsteen hydrogen bonds (6, 7). While TFOs have been successfully used to regulate gene expression in several model systems, a number of cellular barriers still limit the ability of TFO * Corresponding author: Scot W. Ebbinghaus, 1515 North Campbell Ave., Tucson, AZ 85724-5024. Tel: (520) 626-3424. Fax: (520) 626-3754. E-mail: [email protected]. † University of Arizona. ‡ University of Louisville. § Epoch Biosciences. | Current affiliation: Bioconjugate Consulting, Seattle, WA. ⊥ Current affiliation: Shanghai Institute of Materia Medica, Chinese Academy of Sciences, Shanghai, China. 1 Abbreviations: TFO, triplex forming oligonucleotide; PAM, phenylacetic acid mustard; PBD, pyrrolo[1,4]benzodiazepine; 5′Pu-G-Pu, purine-guanine-purine; MGB, minor groove binding compounds; CPI, cyclopropapyrroloindoles; PEG, poly(ethylene glycol) wraparound linker; MALDI, matrix-assisted laser desorption/ionization; TOF, time-of-flight; FAB, fast atom bombardment; TFA, trifluoroacetic acid; PDA, photodiode array; ODN, oligodeoxyribonucleotide; DMSO, dimethyl sulfoxide; TEA, triethylammonium; PAM, phenyl acetic acid mustard; PPG, the pyrazolopyrimidine analogue of guanine; EMSA, electrophoretic mobility shift assay; TBM, tris-borate-magnesium buffer; Kd, dissociation constant; DMS, dimethyl sulfate; MPE-Fe, methidiumpropyl EDTA-Fe(II).

to inhibit target gene expression in living cells. One of these barriers is removal of the TFO by the DNA repair machinery or by DNA helicases (8-11). To improve the stability of triplex formation within cells, DNA-reactive agents can be conjugated to the ends of TFOs to covalently bind the third strand to the target sequence (12). For example, psoralen, reactive minor groove binders (MGBs), bromoacetyl, nitrogen mustard, and aziridinyl quinone residues have been conjugated with TFOs and shown to react with target sites (13-17). The HER-2/neu oncogene is a good target for triplex formation because it has two polypurine tracks capable of triplex formation with a third strand (18, 19) and because HER-2/neu directed therapies have established the principle that preventing the expression or function of the HER-2/neu gene product can induce the regression of metastatic tumors that overexpress HER-2/neu (20, 21). The HER-2/neu promoter has served as a good model for evaluating triplex formation by TFO-alkylator conjugates in previous studies (11, 22) as well as in the present report. The triplex target site is located from -218 to -245 upstream of the first codon (+1) in a region of HER-2/neu promoter that is necessary for the efficient initiation of HER-2/neu transcription (Figure 1). Previous studies demonstrated that a preformed triple helix with an unmodified DNA oligonucleotide as the third strand was undetectable 24 h after transfection of a reporter plasmid bearing the target sequence, demonstrating the limited stability of the triple helix in cells. Conjugation to nitrogen mustards greatly improved the stability of third strand binding, and a TFO conjugated to phenylacetic acid mustard (PAM) at both ends efficiently suppressed HER-2/neu expression from a reporter plasmid. The ability of DNA unwinding by polymerases and

10.1021/bc0498673 CCC: $27.50 © 2004 American Chemical Society Published on Web 10/30/2004

Oligonucleotide−Pyrrolobenzodiazepine Conjugate

Bioconjugate Chem., Vol. 15, No. 6, 2004 1183

Figure 1. Triplex formation in the HER-2/neu promoter with TFO5. (A) Schematic representation of the HER-2/neu promoter with the triplex target sequence located from -245 to -218 relative to the first codon. TFO5 is an antiparallel GT motif TFO conjugated to desmethyltomamycin (PBD) with a PEG wraparound linker that allows the PBD to bind in the minor groove at an adjacent 5′Pu-G-Pu site. TFO5 is designed to direct PBD binding to the AGG (-219 to -221) or the GGG (-218 to -220) sequences that are just downstream of the triple helix, which ends at -223. A covalent adduct is formed with the central guanine in the PBD binding site (circled). Additional PBD binding sites at the GGA (-221 to -223) or the AGG (-222 to -224) at the duplex-triplex junction are also predicted by molecular modeling studies. (B) Molecular models of triplex formation and PBD binding to the HER-2/neu promoter. The models consists of 15 bp of the HER-2/neu promoter from -215 to -229 (purine strand, red; pyrimidine strand, blue) with seven base triplets from the 5′ end of the TFO (-223 to -229, magenta), the PEG wraparound linker (yellow), and the PBD (atom colors) binding in the minor groove and forming adducts with guanines at positions (i) -219, (ii) -220, (iii) -222, or (iv) -223.

helicases to displace a TFO has been reported and can be prevented by triplex formation coupled with covalent modification of the DNA (8, 9, 11, 19, 23-30). Nitrogen mustards have a mechanism of DNA alkylation involving the spontaneous formation of a highly reactive aziridinium cation intermediate in aqueous solution followed by the electrophilic attack of the relatively nucleophilic N7 of guanine (31). Short TFOs conjugated to a nitrogen mustard can drive DNA alkylation to near completion, as shown by the site-specific alkylation of an isolated genomic DNA target using 12mer TFOs (32). The electrophilic aziridinium cation can also react with other nucleophiles or with water to give degradation products that are incapable of guanine alkylation, and in permeabilized cells or isolated nuclei, triplex directed alkylation by a nitrogen mustard is much less efficient (32, 33). The short half-live of the aziridinium cation in aqueous solution presents a potential barrier to the effectiveness of a TFO conjugated to nitrogen mustard in gene targeting in living cells (34). In the present report, we wished to develop TFOalkylator conjugates with an alkylating agent that does not become inactive in aqueous solution. We selected the pyrrolo[1,4]benozdiazepines (PBDs) as a class of DNA alkylating agents that would not be as unstable in water as the nitrogen mustards. Anthramaycin, tomaymycin, sibiromycin, and the neothramycins are members of a potent group of antitumor antibiotics, the PBDs, initially isolated from various Streptomyces species (35). The DNA binding reaction of the PBDs initially proceeds through reversible, noncovalent binding in the minor groove of DNA that positions the reactive C11 of the B ring of the PBD facing into the minor groove for covalent binding to the exocyclic amino group of a guanine (Scheme 1). The aminal bond that forms is labile and potentially reversible to regenerate an active PBD (36). The forma-

Scheme 1. Covalent Adduct Formation by a PBD with the 2-Amino Group of Guanine

tion of a PBD-DNA adduct at purine-guanine-purine (5′Pu-G-Pu) sequences has been shown to block RNA polymerase, and anthramycin and tomaymycin are the most potent blockers of transcription (37). The formation of a DNA-PBD adduct can interfere with the linear translocation of DNA-processing enzymes or inhibit their recognition of specific DNA sequences (38). The cytotoxicity and antitumor activity of the PBDs is related to their ability to inhibit DNA and RNA synthesis; however, the binding of PBDs at the large number of 5′Pu-G-Pu sites throughout the genome may explain the high level of toxicity observed with this class of compounds. For this reason, several groups have investigated ways to improve the site-specificity of PBD binding by using PBD dimers, PBDs conjugated to other MGBs, or PBDs conjugated to polyamides (39-42). In the current report, we have taken advantage of potential PBD binding sites in the polypurine tract of the HER-2/neu promoter to use a TFO to direct the binding of a PBD to a specific location adjacent to the triple helix (Figure 1). TFOs conjugated to PBDs could have some advantages over TFOs conjugated to spontaneously reactive nitrogen mustards and improve the specificity of the PBD.

1184 Bioconjugate Chem., Vol. 15, No. 6, 2004

Zhilina et al.

Scheme 2. Synthesis of Desmethyltomaymycin-TFO Conjugate, TFO5

A challenge for the design and synthesis of TFO-PBD conjugates is the fact that the TFO binds in the major groove while the PBD binds in the minor groove. In other studies of TFOs conjugated to MGBs such as cyclopropapyrroloindoles (CPI), this challenge was addressed with a long, poly(ethylene glycol) “wrap-around” linker (PEG) to form a bridge from the major groove to the minor groove (43, 44). The long flexible linker will allow the MGB to wrap around the DNA duplex to find a binding site within 4-8 bp of the TFO terminus. In this report we describe the design and synthesis of a novel bioconjugate of desmethyltomaymycin to a DNA TFO and demonstrate the site-specific interaction of the PBD with the intended target site in the HER-2/neu promoter. EXPERIMENTAL PROCEDURES

Materials. Solvents and chemicals obtained from commercial sources were analytical grade or better and were used without further purification. Solvents for HPLC analysis were obtained as HPLC grade and were filtered (0.2 µM) prior to use. Spectral Analysis. 1H NMR spectra were obtained on a Bruker AVANCE (300 MHz) instrument. Matrixassisted laser desorption/ionization (MALDI) mass spectra of oligonucleotides were measured on a BrukerReflex-III MALDI-time-of-flight (MALDI-TOF) mass spectrometer. 3-Hydroxypicolinic acid (0.1 M) with 0.1% ammonium tartrate was used as the matrix, and a conventional N2 laser (337 nm) was used to generate ions. Fast atom bombardment (FAB) mass spectra of desmethyltomaymacin were determined on a JEOL HX110A instrument using a matrix of 50% glycerol, 25% thioglycerol, and 25% m-nitrobenzyl alcohol containing 0.1% of trifluoroacetic acid (TFA). Preparative HPLC purification was performed on a Varian ProStar system equipped with a photodiode array (PDA) detector. Molecular Modeling. Modeling of triplex formation and PBD binding was performed using methods that have been previously described (45, 46). Briefly, molecular mechanics and dynamics were performed using Macromodel 7.0 (47) with an implicit solvent algorithm (GB/SA water solvation) using the AMBER* force field. The models were initially minimized (1000 steps steepest

decents followed by 1000 steps Polak-Ribier conjugate gradient) followed by molecular dynamics simulations (100 ps equilibrium phase and 500 ps production phase, 1.5 fs time step, 300 K, followed by averaging 25 samples of the last 50 ps, with subsequent minimization as above). Models of the HER-2/neu promoter triple helix and PBD binding site included 15 bp of the target duplex, d(GGAGGAGGAGGGCTG)-d(CAGCCCTCCTCCTCC) and seven bases of the TFO from the 5′ end, d(GGTGGTG). Multiple simulations were completed using the chiral S configuration of the PBD based on a reported structure (48). Covalent adducts of the PBD with G-223, G-222, G-220, and G-219 are illustrated in Figure 1B. Synthesis of Desmethyltomaymycin p-Nitrophenyl Ester. The C8 substituted tomaymycin analogue 1 (Scheme 2) was synthesized starting from vanillic acid and using the thioacetal method described by Thurston and co-workers (49). The intermediate compound 1 was then converted to the active p-nitrophenyl ester 2, deprotected with Pd(PPh3)4, PPh3, and pyrrolidine to afford compound 3 in 60% yield as a yellow oil, and crystallized from Et2O to afford 3 as a yellow solid. 1H HMR (d6-acetone) δ2.32 (m, 2H, (CH2)3), 2.87 (t, 2H, (CH2)3, J ) 6.7), 2.94 (d, 1H, H1a, J ) 16.1), 3.12 (dd, 1H, H1b, J ) 15.8, J ) 8.3), 3.87-3.89 (m, 1H, H11a), 3.93 (s, 3H, OCH3), 4.18 and 4.22 (2m, 2H, H3), 4.29 (s, 2H, (CH2)3), 5.17 and 5.20 (2x br s, 2H, CdCH2), 6.84 (s, 1H, H9), 7.30 (d, 2H, Ph, J ) 8), 7.52 (s, 1H, H6), 7.70 (d, 1H, H11), 8.27 (d, 2H, Ph, J ) 8); m/z (FAB) 466 (M + 1). Synthesis and Purification of Oligonucleotides. DNA oligonucleotides (ODNs) used for conjugation to the PBD (TFO3, TFO4, and TFO5) were prepared by our group (TFO sequences are given in Table 1). ODNs were synthesized on an Expedite System Model 8909 synthesizer using 1 µmol phosphoramidite protocols supplied by the manufacturer and phosphoramidite reagents from Glen Research. TFO5 also contained a 3′ hexanol modification, introduced into TFO4 and TFO5 during automated DNA synthesis using a hexanol-modified CPG support from Glen Research. The linker was composed of hexa(ethylene glycol) phosphate groups and a C6amino group (Scheme 2), synthesized by adding two

Oligonucleotide−Pyrrolobenzodiazepine Conjugate Table 1. Triplex Forming Oligonucleotides Used in This Reporta

a PAM, phenylacetic acid mustard; PEG, poly(ethylene glycol) wraparound linker; PBD, pyrrolo[1,4]benzodiazepine; G, pyrazolopyrimidine analogue of guanine (underlined).

Spacer Phosphoramidite 18 groups and an N-MMThexanolamine phosphoramidite to the 5′ end of the oligonucleotide during automated synthesis (linker phosphoramidites were from Glen Research). ODNs were cleaved and deprotected in ammonium hydroxide, purified by HPLC, detritylated, precipitated, and suspended in deionized water. The concentrations of all ODNs were determined from UV absorbance at 260 nm in water. MALDI-TOF MS analysis of starting TFO4 for C260H351N89O166P25 [M + H]+: calculated 8154.5, found 8154.4. All ODNs were analyzed by reverse phase HPLC (C18 HPLC) using a 250 × 4.6 mm C18 column equipped with a guard column (Alltech Adsorbosil, 5 µm particle size). A gradient of 2 to 60% solvent B over 20 min was used. Solvent B was acetonitrile (flow rate 1 mL/min), and solvent A was 0.1 M triethylammonium acetate in water (pH 7.5). The triethylammonium (TEA) salt of the ODN was eluted from the column. Detection was carried out by UV absorbance at 260 nm. All ODNs were greater than 95% pure by C18 HPLC. TFO2 was synthesized with the pyrazolopyrimidine analogue of guanine (PPG, 8-aza7-deazaguanine) in place of guanines and was conjugated at both ends to phenylacetic acid mustard (PAM) as previously described (11). Unmodified ODNs (TFO1 and synthetic target sequences) were purchased from commercial sources and gel-purified before use. The sequences of the synthetic duplex DNA target sequences are HNP36 d(TCACAGGAGAAGGAGGAGGTGGAGGAGGAGGGCTGC)-d(GCAGCCCTCCTCCTCCTCCACCTCCTCCTTCTCCTGTGA); HNP40-ApaI d(TCACAGGAGAAGGAGGAGGTGGAGGAGGAGGGCCCCTTGA)d(TCAAGGGGCCCTCCTCCTCCTCCACCTCCTCCTTCTCCTGTGA); HNP40-inosine d(TCACAGGAGAAGGAGGAGGTGGAGGAGGAIIICTGCTTGA)-d(TCAAGCAGCCCTCCTCCTCCTCCACCTCCTCCTTCTCCTGTGA). Synthesis of the ODN-PBD Conjugate. TFO4 (37 nmol, 0.3 mg), bearing the PEG wraparound linker ending in a C6-amino group, was redried, and the residue was dissolved in 0.1 mL of dimethyl sulfoxide (DMSO) with 15 µL of triethylamine. A 2 mg/100 µL solution of 3 in DMSO was prepared, and 17 µL (0.34 mg, 7.4 µmol) was added to the ODN. The mixture was incubated for 21 h at 37 °C with occasional shaking. The product was precipitated with NaClO4/acetone, the pellet was sonicated with 2 mL of acetone, recentrifuged, and dried in a vacuum, and the crude product was stored at -20 °C. The product then was analyzed by C18 HPLC using the gradient described above. The product peak was collected and precipitated with ethanol, and the pellet was sonicated with 2 mL of ethanol, recentrifuged, and dried in a vacuum. The purified ODN-PBD conjugate, TFO5, was dissolved in water. MALDI-TOF MS analysis of TFO5


for C278H369N91O170P25 [M + H]+: calculated 8483.1, found 8483.8. The yield of TFO5 was 41% (0.12 mg). Electrophoretic Mobility Shift Assay (EMSA) Analysis of Triplex DNA Formation. TFOs were incubated with the 36-base pair HER-2/neu duplex target sequence end-labeled on the pyrimidine strand. Reaction mixtures included increasing concentrations of the TFO with 0.01 µM target duplex in 1× TBM buffer (90 mM Tris pH 7.4, 90 mM borate, 10 mM MgCl2) for 24, 48, and 72 h at 37 °C before nondenaturing gel electrophoresis with 1× TBM in both the gel and running buffer. Dissociation constants (Kd) were calculated to compare binding affinities of the TFOs by plotting the fractional yield (y) of triplex [triplex/(triplex + duplex)] as a function of the oligonucleotide concentration (45). It should be mentioned that the Kd is not a true dissociation constant for a reversible reaction at steady state, since the PBD may form a covalent bond with guanine, but remains a useful numerical representation of these data. Roughly, Kd is a TFO concentration under which 50% formation of triplex occurred; that is why we decided not to use the term Kd but use C50 instead. Restriction Enzyme Protection Reactions. Triplex formation was performed as described above, but with a 40-base pair HER-2/neu duplex that was mutated to contain an ApaI site (5′GGGCTG3′f 5′GGGCCC3′) adjacent to the polypurine tract and PBD binding site. Triplex mixtures (5 µL) were digested with ApaI for 2 h at 37 °C by adding 30 units of ApaI, restriction enzyme buffer (final concentration 10 mM Tris, pH 7.5, 10 mM MgCl2), and water to bring reaction volumes up to 50 µL. Reactions were terminated with 30 µL of formamide loading buffer, denaturated for 2′ at 95 °C, and separated on a 12% denaturing gel. Chemical and Enzymatic Footprinting. A 250 bp PstI/XmaI fragment of the pGL3/HNP410 plasmid containing a 410 bp HER-2/neu promoter within the PGL3 basic luciferase promoter plasmid (Promega) was used to create an end-labeled template by Klenow filling. To compare native versus inosine-substituted PBD binding sites, synthetic oligonucleotides were 5′-labeled on the purine-rich strand, annealed, and gel-purified prior to use. Triplex formation was performed in 1× TBM at 37 °C for 24 h. For dimethyl sulfate (DMS) footprinting, samples (10 µL) were mixed with 4 µg of sonicated salmon sperm DNA and treated with 0.5 µL of 10% ethanol solution of dimethyl sulfate (DMS) for 5 min. The reaction was stopped by the addition of 5 µL of DMS stop solution mixture. The DNA samples were ethanol-precipitated and lyophilized. Piperidine cleavage was performed by heating the DNA pellet with 50 µL of 10% piperidine for 20 min at 90 °C followed by ethanol-precipitation. Samples were suspended in water and an equal volume of formamide gel loading buffer and denatured at 95 °C for 2 min before electrophoresis. For DNaseI footprinting, samples (10 µL) were mixed with 2 µL poly(dI-dC)(1 mg/ mL), 4 µL DNaseI binding buffer (Roche), and 15 µL of a mixture of 10 mM CaCl2 and 10 mM MgCl2. The samples were digested with 1 µL of Dnase I (0.1 U/µL) for 30 s, and the reactions were stopped by adding 25 µL formamide gel loading buffer and heating to 95 °C for 2 min. Footprinting reactions were separated on 10% denaturing gels. Transient Transfections. HeLa cells were obtained from the American Type Culture Collection and cultured according to supplier guidelines. The pGL3/HNP410 plasmid (2 µg) containing the HER-2/neu promoter was incubated in 1× TBM at 37 °C with 10 µM TFO1, TFO3, or TFO5 for 48 h or with 1 µM of TFO2 for 4 h. Unbound


TFO was removed using 1× TBM equilibrated Chromaspin-100 columns (Clontech). Transfection was accomplished with Lipofectamine 2000 (Invitrogen) and included 20 ng of an internal control plasmid (pRL/SV40, Promega). Cell lysates were obtained at 24 h, and dual luciferase assays (Promega) were performed. Data from at least three assays were averaged, were normalized for transfection efficiency, and are presented as a percentage of luciferase activity from plasmid without TFO treatment. RESULTS

Design of the TFO-PBD Conjugate. The ODN selected for conjugation to a PBD is a 23-mer GT antiparallel motif TFO, TFO3, that will form a triple helix with the polypurine tract in the HER-2/neu promoter, but will leave the last 5 bp of the tract available adjacent to the end of the triple helix for PBD binding (Figure 1). TFO sequences are given in Table 1. A 28mer GA motif TFO (TFO1, Table 1) was shown to bind with high affinity to that region and prevent transcription in vitro (Ebbinghaus 1993), but required modification at both ends with a nitrogen mustard (TFO2, Table 1) to suppress the expression of HER-2/neu from a reporter plasmid in tumor cells (11). Substitution of guanines with the pyrazolopyrimidine analogue of guanine (PPG) in TFO2 prevents self-association of guanine rich oligonucleotides and improves triplex formation in physiological buffers (32). Studies comparing GA and GT motif TFOs for this target sequence showed similar binding affinities slightly favoring the GT motif (45). Tomaymycin is one of the most potent representatives of the PBD antitumor antibiotic family, and like all PBDs, it has a sequence preference for 5′Pu-G-Pu and forms a covalent bond with the exocyclic amino group of the central guanine of its binding sequence (Scheme 1). There are multiple potential PBD binding sites in the polypurine tract, and we selected a site at the downstream end of the polypurine tract for PBD binding. The synthetic PBD compound used in this study is structurally similar to the naturally occurring tomaymycin, but lacking a methyl group at the unsaturated C2-exo position. The unsaturation at the C2-exo position causes a flattening of the C ring and leads to a better fit in the minor groove. At the same time, an alkyl substituent at the C8-position of the A ring might reduce both DNA-binding affinity and cytotoxicity by a small degree (50), but this modification provides the bridge for conjugation with the ODN. Two hexa(ethylene glycol) chain linkers with one internal phosphodiester bond in each plus a 6-aminohexyl tail were introduced at the 5′end of TFO3 (resulting in TFO4, Table 1) to make a linker that is 50 atoms in length to allow for effective interaction of the PBD with the minor groove adjacent to the triple helix (Figure 1). The molecular models in Figure 1B show the triple helix, wraparound linker, and PBD bound to 5′Pu-G-Pu sites in the duplex region adjacent to the triple helix (Figure 1B, i and ii), or the duplex-triplex junction (Figure 1B, iii and iv) forming a covalent adduct with G-219 (i), G-220 (ii), G-222 (iii), or G-223 (iv). These models predict that triplex formation by the TFO-PBD conjugate (TFO5, Table 1) with the relatively long flexible linker will allow the PBD to reach the minor groove by wrapping around one DNA strand to bind at nearby 5′Pu-G-Pu binding sites. Conjugation of the PBD to an Oligonucleotide. A mild method to introduce a nucleophilic alkylamine group on the end of the ODN for conjugation with an electrophilic derivative of the drug was employed, using

Zhilina et al.

DMSO as the solvent (51). The TEA salt of the ODN is soluble in DMSO and allows the lipophilic PBD moiety to be successfully conjugated in an organic solvent. The amine-containing linker was added to the growing ODN sequence during automated synthesis, resulting in TFO4. The TEA salt of the HPLC purified ODN was modified with the PBD as shown in Scheme 2. The p-nitrophenyl ester of desmethyltomaymycin was chosen as the activated moiety of the PBD for conjugation. p-Nitrophenyl esters are traditionally used in acylation reaction with amine-containing molecules to give amide bonds. pNitrophenyl esters can be purified by column chromatography and have slow rates of hydrolysis compared to some other activated esters. The activated ester of desmethyltomaymycin 3 was prepared as shown in Scheme 2. Anhydrous DMSO is a polar aprotic solvent that is useful for ODN conjugation chemistry. Generally the conjugation process requires an aqueous base to dissolve the ODN and to increase the nucleophilicity of the alkylamine linker. At the same time an organic cosolvent is needed in the system to increase the solubility of the liphophilic electrophiles. Although the PBD is stable in aqueous conditions, deactivation of the ester moiety might result in a lower yield of conjugation reaction and require a large excess of the PBD. In addition, desmethytomaymycin is lipophilic and has poor solubility in aqueous solutions. For these reasons, anhydrous conditions were used for synthesis of the ODNPBD conjugate. The progress of the conjugation reaction was monitored by HPLC and UV absorbance as shown in Figure 2. A PDA detector simplifies analysis because the PBD is a unique chromophore. The absorption spectra of the p-nitrophenyl ester of desmethyltomaymycin has a broad absorbance maximum at 225-240 nm.The HPLC chromatogram (Figure 2A) shows that 25 min after beginning, the reaction mixture contains an excess of starting unconjugated PBD (retention time 21 min), TFO4 (unconjugated ODN-linker), and a small peak of conjugated product, TFO5, close to TFO4 (retention time 13.3 and 12.9 min, respectively). After 21 h of incubation, the amount of unconjugated PBD is considerably decreased while the conjugated product, TFO5, represents the major peak in the chromatogram. UV absorbance monitoring (Figure 2B) demonstrates a very unique absorbance curve for the conjugated product, and the intensity of the absorbance of TFO5 is increased dramatically after 6 h of incubation. After 21 h of incubation, TFO5 was precipitated from the DMSO by adding sodium perchlorate in acetone. The resulting crude mixture was purified by reverse phase HPLC, and the identity of the conjugate was confirmed by mass spectral analysis. Detection of Triplex Formation and Calculation of Binding Affinities by EMSA. The binding of TFO5 to the triplex target site in the HER-2/neu promoter was evaluated by EMSA (Figure 3A). Triplex mixtures were incubated in 1× TBM buffer for 24-72 h. After 24 h, triplex formation with TFO5 proceeds with a C50 ) 3.2 µM that is very poor compared to TFO3 (C50 ) 0.015 µM). Longer incubation with TFO5 improves the binding so that after 48 h the formation of triplex proceeds with C50 ) 2.1 µM, and after 72 h with C50 ) 0.9 µM. This experiment demonstrates that the presence of the PBD on the end of the TFO slows the process of triplex formation, but also shows that the PBD remains active for at least 72 h. The TFO itself may have potential PBD binding sites, and intramolecular interaction of the PBD with the TFO or self-association of the guanine rich oligonucleotides might account for the poor binding to the


Figure 2. HPLC and UV monitoring of the TFO-PBD conjugation reaction. (A) HPLC analysis monitoring the conjugation between TFO4 and PBD ester 3. The top chromatogram shows unconjugated TFO4 at time zero, tR ) 12.9 min. The middle chromatogram shows the reaction mixture after 25 min with a large peak for the unconjugated PBD ester 3, tR ) 21 min, and a small peak for TFO5, tR ) 13.3 min. The bottom chromatogram shows the reaction mixture after 21 h, with a large peak for TFO5 at 13.3 min. (B) UV monitoring of the conjugation reaction between TFO4 and the PBD ester 3. Top panels, UV spectra of TFO4 (left) and the PBD p-nitrophenyl ester 3 (right). Bottom panels, UV spectra of the conjugation reaction at monitoring of progress in conjugation reaction at 5 min, 6 h, and 20 h.

target sequence. EMSAs were performed with increasing concentrations of TFO5 alone for up to 72 h, and no selfassociation of TFO5 was observed by methylene blue staining (not shown). Because the triplex target sequence contains many potential PBD binding sites, we speculate that the process of PBD docking in the minor groove in the triplex target sequence is interfering with the formation of the triple helix within major groove. The structure and length of the TFO and linker might cause sterical obstacles for positioning the drug in the desired location adjacent to the TFO binding site and may be amenable to further optimization (44). Enzymatic and Chemical Footprinting. To precisely determine the binding site for TFO5, we used DNase I footprinting. DNase I has been used extensively to footprint TFOs and some MGBs such as distamycin, netropsin, Hoechst 33258, and berenil. These MGBs cause clear changes in the DNase I digestion patterns, but no simple footprints (52). In contrast, the PBD analogue DC-81 does not alter DNase I cleavage patterns, and among the PBDs, tomaymycin binding produces the least distortion of the duplex (39, 53). Our DNaseI footprinting experiment with TFO3, TFO4 (not shown), and TFO5 demonstrated that all three TFOs protect the


Figure 3. Triplex formation by TFOs with and without PBD. (A) EMSAs showing triplex formation at 24, 48, and 72 h. Apparent dissociation constants (Kd) for TFO3 and TFO5 calculated from these EMSAs are shown below each time point. (B) DNaseI footprints showing the binding of TFO3 and TFO5 to the HER-2/neu promoter. A stronger footprint is observed for TFO5. (C) DMS footprints showing the binding of TFO3 and TFO5 to the triplex target sequence. Note the hypersensitivity of G(-222) at the duplex-triplex junction in the absence of PBD binding with TFO3, and the hypersensitivity of G(-218) in the presence of PBD binding with TFO5. Also note partial protection of G(-219) and G(-220) in the presence of PBD binding with TFO5.

duplex from cleavage by DNase I, with identical binding sites for the TFO with and without the PBD conjugate (Figure 3B). We do not observe an altered cleavage pattern due to the PEG linker or PBD interaction with the DNA template, in accord with previous observations of the absence of altered DNase I cleavage patterns produced by tomaymycin. At the same time, these footprints demonstrate that TFO5 provides greater protection of the duplex than TFO3, suggesting that PBD binding stabilizes triplex formation between duplex and TFO5 conjugate. Triplex formation was also evaluated with DMS footprinting (Figure 3C). DMS can be used to determine the accessibility of the N7 position of guanines, and protection from DMS alkylation occurs due to the Hoogsteen bonds formed by the TFO. DMS cleavage patterns can also reflect changes in the nucleophilicity of the N7 of guanine, which can be influenced by flanking bases and drug binding to DNA in the vicinity of the guanine (54). Thus, although the PBD binds in the minor groove and reacts with the exocyclic amino group of guanine, changes in the DMS cleavage pattern adjacent to the triple helix would be indicative of PBD binding. The DMS footprints in Figure 3C show that both TFO3 and TFO5 protect the guanines in the triple helix. TFO3 binding produces a hypersensitive guanine immediately adjacent to the triple


Figure 4. PBD binding adjacent to the triple helix protects the target sequence from restriction enzyme digestion with ApaI. (A) Schematic representation of the location of the engineered ApaI site in the HER-2/neu promoter relative to the triple helix formed by TFO3, TFO4, and TFO5. (B) The cleavage products of ApaI digestion before and after triplex formation by TFO2TFO5 were resolved on a denaturing gel and quantified by densitometry.

helix at G(-222) that is not observed with the binding of TFO5, indicating that either the wraparound linker blocks the accessibility of the N7 of this guanine to DMS or that PBD binding alters its reactivity to DMS. TFO5 binding also decreases the reactivity of G(-220) and G(219) while inducing a hypersensitive guanine at G(-218). Interestingly, a guanine at the opposite end of the triple helix from the expected PBD binding site, G(-244), is also more reactive with TFO5 compared to TFO3, perhaps due to a 3′ hexanol modification in TFO5. Agents that bind to the minor groove have been shown to alter DMS cleavage patterns over a fairly long range so that assignment of explicit drug binding sites is difficult (54). Nonetheless, these footprints suggest that the PBD moiety of TFO5 binds to either the AGG (-221 to -219) or the GGG (-220 to -218) 5′Pu-G-Pu PBD binding sites adjacent to the triple helix. Restriction Endonuclease Protection Analysis. To provide further evidence for PBD binding adjacent to the triple helix formed by TFO5, we evaluated the ability of PBD binding to prevent restriction endonuclease cleavage adjacent to the triple helix (Figure 4). For this assay, we modified two bp of the HER-2/neu promoter downstream of the polypurine tract to form an ApaI (native sequence: 5′GGGCTG3′f ApaI mutant sequence: 5′GGGCCC3′) so that PBD binding would protect this sequence from ApaI cleavage (Figure 4A). TFO3, TFO4, and TFO5 were added to the ApaI mutant sequence at a final concentration of 1 µM and incubated for 48 h, while TFO2 was incubated with the duplex for 4 h at a concentration of 0.1 µM. Figure 4B shows the cleavage products of ApaI digestion after triplex formation with TFOs with and without a PBD conjugate. Of these, only TFO5 containing the PBD conjugate inhibited ApaI digestion. The triple helix itself does not prevent ApaI cleavage, since nearly complete digestion is seen with TFO3 (unmodified TFO). Similarly, the 50-atom linker does not appear to sterically inhibit ApaI recognition or cleavage, since nearly complete digestion is seen with TFO4 (TFO with the linker). TFO2, a slightly longer TFO conjugated to PAM, com-

Zhilina et al.

pletely prevented ApaI digestion, while restriction endonuclease protection by TFO5 was incomplete, suggesting that PBD binding at the ApaI site is either less efficient or less stable than PAM binding; however, it is important to note that the triple helix formed by TFO2 overlaps the ApaI site, whereas the triple helix formed by TFO5 does not, and ODN binding in the major groove may more effectively block the restriction site than PBD binding in the minor groove. PBD binding to DNA has been previously demonstrated by methidiumpropyl EDTAFe(II) (MPE-Fe) cleavage (37, 53), but our attempts to obtain a differential cleavage pattern between TFOs with and without the PBD (TFO3 and TFO5) using MPE-Fe were not successful, perhaps because tomaymycin produces the least distortion of the double helix of any member of the PBD family. Nonetheless, the combination of DMS footprinting and endonuclease protection studies clearly demonstrates that TFO5 directs the binding of the PBD moiety to a PBD binding site adjacent to the triple helix. DMS Footprints with an Inosine-Substituted PBD Binding Site. The 2-amino (exocyclic amino) group of guanine is a critical element in the sequence-specific recognition of DNA through the minor groove, where most small molecules bind (55, 56). For this reason, footprinting studies performed on DNA fragments containing inosine in place of guanine are useful for demonstrating minor groove binding by proteins and small molecules. Inosine (I) is a guanine analogue that lacks the exocyclic amino group (Figure 5A) and is therefore not able to donate a hydrogen bond nor form a covalent bond with a PBD. Inosine-substituted oligonucleotides were used in studies that showed the aminal bond formed between the C11 of tomamycin and the exocyclic amino group of guanine (57). We compared the DMS footprints produced by TFO3, TFO4, and TFO5 in a duplex target with three inosine substitutions I(-218), I(-219), and I(-220) in the PBD binding site. EMSA analysis demonstrates that inosine substitution at these positions does not significantly alter the ability of the TFOs to form a triple helix with the target sequence (Figure 5B). The DMS cleavage pattern adjacent to the triple helix again demonstrates that PBD binding in the native sequence greatly reduces the reactivity of a hypersensitive guanine, G-222, at the duplex-triplex junction (Figure 5C, left panel). In contrast, in the inosine-substituted sequence, the DMS reactivity of G-222 is essentially identical for TFO3, TFO4, and TFO5 (Figure 5C, right panel). In addition, the DMS reactivity of the guanine at -218 is again reduced by PBD binding to the native sequence, while the DMS reactivity of all three inosine bases is essentially identical for TFO3, TFO4, and TFO5. These data clearly demonstrate the interaction between the PBD molecule and the guanines adjacent to the triple helix and, taken together with prior studies (57), provide inferential evidence for a covalent PBD interaction with a guanine in the PBD binding site. Transient Transfection Assays. To determine whether PBD binding sufficiently stabilized triplex formation to prevent HER-2/neu transcription initiation, we performed transient transfection assays with a HER-2/ neu promoter-luciferase reporter plasmid. Triple helix formation by TFOs with and without 5′ and 3′ PAM groups (TFO1 and TFO2) was compared to triplex formation by TFOs with and without a 5′PBD (TFO3 and TFO5). For these experiments, the plasmid was treated with the TFO under ideal binding conditions, purified from unbound, excess TFO by column chromatography, and transfected into HeLa cells. Figure 6 shows HER-2/



Figure 6. Transient transfection analysis of the effects of triplex formation by unmodified TFOs (TFO1 and TFO3) and TFO conjugates (TFO2 and TFO5) on HER-2/neu expression. HeLa cells were transfected with a firefly luciferase plasmid controlled by a 410 bp HER-2/neu promoter and treated with TFOs prior to transfection, and luciferase activity was measured at 24 h.

reproduce our earlier findings (11). Triplex formation and PBD binding (TFO5) failed to suppress HER-2/neu transcription in these studies, even though the binding conditions for TFO5 in this experiment were shown to yield complete binding to the target sequence by the TFO and at least reasonably efficient binding by the PBD in other assays. We have previously shown that guanine adduct formation at only one end of the triple helix by a nitrogen mustard was inefficient at preventing HER-2/ neu transcription in this assay system, and the present results are in accord with our findings that covalent binding at both ends of the HER-2/neu triplex target sequence is probably needed to prevent HER-2/neu transcription by a TFO in cells. DISCUSSION

Figure 5. The PBD binding site adjacent to the triple helix was demonstrated with DMS footprints on an inosine-substituted, synthetic HER-2/neu promoter fragment. (A) Structure of hydrogen-bonded guanine-cytosine and guanine-inosine base pairs. (B) EMSA demonstrating that the amount of triplex formation by TFO3-TFO5 is equivalent between the inosinesubstituted (HNP-40-inosine) and native (HNP-36) synthetic HER-2/neu promoter fragments. Inosines were substituted for guanines at the putative PBD binding site (-218 to -220). (C) DMS footprints demonstrating identical cleavage patterns for TFOs with (TFO5) and without (TFO3, TFO4) a PBD in the inosine-substituted HER-2/neu promoter fragment. Note the hypersensitivity of G(-222) at the duplex-triplex junction in the absence of PBD binding seen with all TFOs in the inosinesubstituted sequence, but only for TFO3 and TFO4 in the native sequence.

neu driven luciferase activity at 24 h after treatment with TFOs, presented as relative expression compared to untreated plasmid and normalized for transfection efficiency by a cotransfected reporter plasmid. These data demonstrate that triplex formation by itself (TFO1 and TFO3) is incapable of preventing HER-2/neu transcription, while triplex formation and covalent adduct formation at both ends of the triple helix with a nitrogen mustard (TFO2) is capable of suppressing transcription from the HER-2/neu promoter by approximately 60% and

We report the synthesis of a novel oligonucleotidepyrrolo[1,4]benzodiazepine conjugate by a versatile method. This TFO-PBD conjugate is capable of forming a triple helix with the HER-2/neu promoter and directing the site-specific binding of the PBD adjacent to the triple helix. Conceptually, this strategy could improve the binding of the TFO and direct the biological activity of the PBD to a single gene of interest. However, our results demonstrate some of the challenges to this strategy that may be amenable to further optimization. First, the presence of the PBD moiety on the TFO slows the process of triplex formation, since the TFO alone completely binds to the target sequence after 4 h at 37 °C. PBDs are known to initially bind slowly and reversibly to DNA, and binding may be incomplete even after 48 h at 37 °C (58-60). Alternately, the linker between the major groove binding TFO and the minor groove binding PBD may be critical to the activity of the conjugate. The long, flexible linker used in this study may allow the PBD to bind to any available PBD binding site before the TFO binds, until an optimal TFO-PBD binding site is finally encountered. The HER-2/neu promoter is rich in potential PBD binding sites, and we speculate that reversible PBD binding at unintended PBD binding sites prevents binding by the TFO and initially slows binding by the TFO-PBD conjugate. Once the TFO binds, the high local concentration of the PBD adjacent to the triple helix may actually improve covalent bond formation by the PBD and improve overall binding by the conjugate. Conjugation of the PBD to a minor groove binding polyamide carrier improves PBD binding to DNA and antiproliferative activity in tissue culture, suggesting that the presence of the alkylating moiety and the carrier


in the same minor groove of DNA can create a more stable drug-DNA interaction (39, 61). The CPIs are another class of MGBs that have been tethered to TFOs. CPIs appear to bind more rapidly, and in the context of a TFO-CPI conjugate, triplex formation is the ratelimiting step in the binding of the conjugate (43). Studies of TFO-CPI conjugates also demonstrate the importance of the linker between the major groove and the MGB and suggest that an aromatic molecule capable of intercalating into the DNA and threading the duplex may be a more robust means of using a TFO to direct the site of the MGBs (44). Second, the interaction of the TFO-PBD conjugate with the HER-2/neu promoter is not sufficient to prevent HER-2/neu expression from a reporter plasmid. It is likely that the triple helix formed by the TFO-PBD conjugate is not sufficiently stable in cells, even though the TFO-PBD conjugate produces a stronger DNaseI and DMS footprint, indicative of an improvement in binding, compared to the unconjugated TFO. Our previous studies with TFOs conjugated to PAM at one or both ends demonstrated that a mono-conjugate was practically inactive at suppressing transcription within cells, while a bis-conjugate significantly suppressed HER-2/neu expression in this assay system and was the least susceptible to displacement by a recombinant DNA helicase (11). Similarly, TFO-psoralen conjugates that create a single locus of DNA damage are efficiently repaired in cells while triplex-directed cross-links at both ends of the triple helix are not (62). Helicase activity is present in many of the enzymes that process DNA, including replication, transcription, and repair. DNA interactive small molecules differ in their ability to inhibit DNA helicase translocation and unwinding, and nogalamycin is one of the most potent helicase inhibitors, because it intercalates and binds in both the major and minor grooves into both grooves of DNA (63). MGBs including distamycin and netropsin can also block DNA helicase (64). PBD-DNA adducts, however, are stable only as long as the double helix structure of DNA is maintained (65) and thus may be unable to remain bound to DNA in the face of an advancing helicase. C8 linked PBD dimers, which form interstrand cross-links, are able to resist the repair process in cells for more than 48 h (66). A single tomaymycin molecule on the end of the TFO may be unable to resist displacement by helicases, and conjugation to a PBD dimer capable of forming cross-links or to a PBD molecule at both ends of the TFO would likely be more active in this regard. In conclusion, we report the first example of an ODNPBD conjugate and demonstrate that triplex formation by the ODN directs the PBD to a specific location adjacent to the triple helix. Although our studies did not directly demonstrate covalent PBD binding to the target sequence, the lack of PBD binding to an inosinesubstituted target sequence demonstrates the need for the exocyclic amino group of guanine in accord with previous data that demonstrate covalent PBD binding to guanine. This study demonstrates the conceptual feasibility of site-specific PBD targeting by a TFO, but shows that further optimization of the design of this bioconjugate will be needed to address the obstacles of slow binding to DNA and instability of the interaction within cells. ACKNOWLEDGMENT

This work was supported by grants from the NIH (CA85306) and the Flinn Foundation (1580). The authors

Zhilina et al.

gratefully acknowledge the Lajos Szabo for assistance with HPLC analysis and David Milesi for assistance with the conjugation reactions. NOTE ADDED AFTER ASAP POSTING

In the version of the manuscript posted October 30, 2004, “Pyrrolobenzodiazepine” replaces “Tomaymycin” in the manuscript title. In line 19 of the first paragraph of the Results section, “Desmethyltomaymycin” is replaced by “Tomaymycin”. In line 29 of the same paragraph, the phrase “but lacking a methyl group at the unsaturated C2-exo position” is inserted. Finally, a corrected Scheme 1 has been inserted into the second page. The corrected version of the manuscript was posted November 9, 2004. LITERATURE CITED (1) Knauert, M. P., and Glazer, P. M. (2001) Triplex forming oligonucleotides: sequence-specific tools for gene targeting. Hum. Mol. Genet. 10, 2243-2251. (2) Praseuth, D., Guieysse, A. L., and Helene, C. (1999) Triple helix formation and the antigene strategy for sequencespecific control of gene expression. Biochim. Biophys. Acta 1489, 181-206. (3) Vasquez, K. M., and Glazer, P. M. (2002) Triplex-forming oligonucleotides: principles and applications. Q. Rev. Biophys. 35, 89-107. (4) Le Doan, T., Perrouault, L., Praseuth, D., Habhoub, N., Decout, J. L., Thuong, N. T., Lhomme, J., and Helene, C. (1987) Sequence-specific recognition, photocrosslinking and cleavage of the dna double helix by an oligo-[alpha]-thymidylate covalently linked to an azidoproflavine derivative. Nucleic Acids Res. 15, 7749-7760. (5) Moser, H. E., and Dervan, P. B. (1987) Sequence-specific cleavage of double helical dna by triple helix formation. Science 238, 645-650. (6) Frank-Kamenetskii, M. D., and Mirkin, S. M. (1995) Triplex DNA structures. Annu. Rev. Biochem. 64, 65-95. (7) Felsenfeld, G., Davies, D. R., and Rich, A. (1957) Formation of a three-stranded polynucleotide molecule. J. Am. Chem. Soc. 79, 2023-2024. (8) Maine, I. P., and Kodadek, T. (1994) Efficient unwinding of triplex DNA by a DNA helicase. Biochem. Biophys. Res. Commun. 204, 1119-1124. (9) Brosh, R. M., Jr., Majumdar, A., Desai, S., Hickson, I. D., Bohr, V. A., and Seidman, M. M. (2001) Unwinding of a DNA triple helix by the Werner and Bloom syndrome helicases. J. Biol. Chem. 276, 3024-3030. (10) Vasquez, K. M., Christensen, J., Li, L., Finch, R. A., and Glazer, P. M. (2002) Human XPA and RPA DNA repair proteins participate in specific recognition of triplex-induced helical distortions. Proc. Natl. Acad. Sci. U. S. A 99, 58485853. (11) Ziemba, A. J., Reed, M. W., Raney, K. D., Byrd, A. B., and Ebbinghaus, S. W. (2003) A bis-alkylating triplex forming oligonucleotide inhibits intracellular reporter gene expression and prevents triplex unwinding due to helicase activity. Biochemistry 42, 5013-5024. (12) Asseline, U. (1999) in Triple Helix Forming Oligonucleotides (Malvy, C., Harel-Bellan, A., and Pritchard, L. L., Eds.) pp 63-73, Kluwer Academic Publishers, Boston. (13) Reed, M. W., Wald, A., and Meyer, R. B. (1998) TriplexDirected Interstrand DNA Cross-Linking by Diaziridinylquinone-Oligonucleotide Conjugates. J. Am. Chem. Soc. 120, 97299734. (14) Lukhtanov, E. A., Podyminogin, M. A., Kutyavin, I. V., Meyer, R. B., and Gamper, H. B. (1996) Rapid and efficient hybridization-triggered cross-linking within a DNA duplex by an oligodeoxyribonucleotide bearing a conjugated cyclopropapyrroloindole. Nucleic Acids Res. 24, 683-687. (15) Vasquez, K. M., Wensel, T. G., Hogan, M. E., and Wilson, J. H. (1996) High-efficiency triple-helix-mediated photocrosslinking at a targeted site within a selectable mammalian gene. Biochemistry 35, 10712-10719.

Oligonucleotide−Pyrrolobenzodiazepine Conjugate (16) Povsic, T. J., Strobel, S. A., and Dervan, P. B. (1992) Sequence-specific double-strand alkylation and cleavage of DNA mediated by triple-helix formation. J. Am. Chem. Soc. 114, 5934-5941. (17) Kutyavin, I. V., Gamper, H. B., Gall, A. A., and Meyer, R. B. (1993) Specific intrastrand cross-linking of double stranded DNA by a chlorambucil-modified triplex forming oligonucleotide. J. Am. Chem. Soc. 115, 9303-9304. (18) Ebbinghaus, S. W., Gee, J. E., Rodu, B., Mayfield, C. A., Sanders, G., and Miller, D. M. (1993) Triplex formation inhibits HER-2/neu transcription in vitro. J. Clin. Invest 92, 2433-2439. (19) Ebbinghaus, S. W., Fortinberry, H., and Gamper, H. B., Jr. (1999) Inhibition of transcription elongation in the HER2/neu coding sequence by triplex-directed covalent modification of the template strand. Biochemistry 38, 619-628. (20) Agus, D. B., Bunn, P. A., Jr., Franklin, W., Garcia, M., and Ozols, R. F. (2000) HER-2/neu as a therapeutic target in nonsmall cell lung cancer, prostate cancer, and ovarian cancer. Semin. Oncol. 27, 53-63. (21) Meric, F., Hung, M. C., Hortobagyi, G. N., and Hunt, K. K. (2002) HER2/neu in the management of invasive breast cancer. J Am. Coll. Surg. 194, 488-501. (22) Ziemba, A., Derosier, L. C., Methvin, R., Song, C. Y., Clary, E., Kahn, W., Milesi, D., Gorn, V., Reed, M., and Ebbinghaus, S. (2001) Repair of triplex-directed DNA alkylation by nucleotide excision repair. Nucleic Acids Res. 29, 4257-4263. (23) Young, S. L., Krawczyk, S. H., Matteucci, M. D., and Toole, J. J. (1991) Triple helix formation inhibits transcription elongation in vitro. Proc. Natl. Acad. Sci. U.S.A. 88, 1002310026. (24) Sastry, S. S., and Hearst, J. E. (1991) Studies on the interaction of T7 RNA polymerase with a DNA template containing a site-specifically placed psoralen cross- link. II. Stability and some properties of elongation complexes. J. Mol. Biol. 221, 1111-1125. (25) Sastry, S. S., and Hearst, J. E. (1991) Studies on the interaction of T7 RNA polymerase with a DNA template containing a site-specifically placed psoralen cross- link. I. Characterization of elongation complexes. J. Mol. Biol. 221, 1091-1110. (26) Duval-Valentin, G., Thuong, N. T., and Helene, C. (1992) Specific inhibition of transcription by triple helix-forming oligonucleotides. Proc. Natl. Acad. Sci. U.S.A. 89, 504-508. (27) Skoog, J. U., and Maher, L. J. (1993) Relief of triple-helixmediated promoter inhibition by elongating rna polymerases. Nucleic Acids Res. 21, 4055-4058. (28) Samadashwily, G. M., and Mirkin, S. M. (1994) Trapping DNA polymerases using triplex-forming oligodeoxyribonucleotides. Gene 149, 127-136. (29) Diviacco, S., Rapozzi, V., Xodo, L., Helene, C., Quadrifoglio, F., and Giovannangeli, C. (2001) Site-directed inhibition of DNA replication by triple helix formation. FASEB J. 15, 2660-2668. (30) Kopel, V., Pozner, A., Baran, N., and Manor, H. (1996) Unwinding of the third strand of a DNA triple helix, a novel activity of the SV40 large T-antigen helicase. Nucleic Acids Res. 24, 330-335. (31) Povirk, L. F., and Shuker, D. E. (1994) DNA damage and mutagenesis induced by nitrogen mustards. Mutat. Res. 318, 205-226. (32) Belousov, E. S., Afonina, I. A., Kutyavin, I. V., Gall, A. A., Reed, M. W., Gamper, H. B., Wydro, R. M., and Meyer, R. B. (1998) Triplex targeting of a native gene in permeabilized intact cells: covalent modification of the gene for the chemokine receptor CCR5. Nucleic Acids Res. 26, 1324-1328. (33) Ebbinghaus, S. W., Vigneswaran, N., Mayfield, C. A., Curiel, D. T., and Miller, D. M. (1999) in Triple Helix Forming Oligonucleotides (Malvy, C., Harel-Bellan, A., and Pritchard, L. L., Eds.) pp 117-127, Kluwer Academic Publishers, Boston. (34) Reed, M. W., Lukhtanov, E. A., Gorn, V. V., Kutyavin, I. V., Gall, A. A., Wald, A., and Meyer, R. B. (1998) Synthesis and reactivity of aryl nitrogen mustard- oligodeoxyribonucleotide conjugates. Bioconjugate Chem. 9, 64-71.

Bioconjugate Chem., Vol. 15, No. 6, 2004 1191 (35) Hurley, L. H. (1994) The minor groove covalent reactive drugs anthramycin and (+)-CC-1065 and their interstrand cross-linking derivatives. IARC Sci. Publ. 295-312. (36) Hurley, L. H., Reck, T., Thurston, D. E., Langley, D. R., Holden, K. G., Hertzberg, R. P., Hoover, J. R., Gallagher, G., Jr., Faucette, L. F., Mong, S. M., and. (1988) Pyrrolo[1,4]benzodiazepine antitumor antibiotics: relationship of DNA alkylation and sequence specificity to the biological activity of natural and synthetic compounds. Chem. Res. Toxicol. 1, 258-268. (37) Puvvada, M. S., Forrow, S. A., Hartley, J. A., Stephenson, P., Gibson, I., Jenkins, T. C., and Thurston, D. E. (1997) Inhibition of bacteriophage T7 RNA polymerase in vitro transcription by DNA-binding pyrrolo[2,1-c][1,4]benzodiazepines. Biochemistry 36, 2478-2484. (38) Kamal, A., Rao, M. V., Laxman, N., Ramesh, G., and Reddy, G. S. (2002) Recent developments in the design, synthesis and structure-activity relationship studies of pyrrolo[2,1-c][1,4]benzodiazepines as DNA-interactive antitumour antibiotics. Curr. Med. Chem. Anti. -Canc. Agents 2, 215-254. (39) Baraldi, P. G., Balboni, G., Cacciari, B., Guiotto, A., Manfredini, S., Romagnoli, R., Spalluto, G., Thurston, D. E., Howard, P. W., Bianchi, N., Rutigliano, C., Mischiati, C., and Gambari, R. (1999) Synthesis, in vitro antiproliferative activity, and DNA-binding properties of hybrid molecules containing pyrrolo[2,1-c][1,4]benzodiazepine and minor-groovebinding oligopyrrole carriers. J. Med. Chem. 42, 5131-5141. (40) Reddy, B. S., Sharma, S. K., and Lown, J. W. (2001) Recent developments in sequence selective minor groove DNA effectors. Curr. Med. Chem. 8, 475-508. (41) Mountzouris, J. A., Wang, J. J., Thurston, D., and Hurley, L. H. (1994) Comparison of a DSB-120 DNA interstrand crosslinked adduct with the corresponding bis-tomaymycin adduct: an example of a successful template-directed approach to drug design based upon the monoalkylating compound tomaymycin. J. Med. Chem. 37, 3132-3140. (42) Kumar, R., and Lown, J. W. (2003) Recent developments in novel pyrrolo[2,1-c][1,4]benzodiazepine conjugates: synthesis and biological evaluation. Mini. Rev. Med. Chem. 3, 323-339. (43) Lukhtanov, E. A., Mills, A. G., Kutyavin, I. V., Gorn, V. V., Reed, M. W., and Meyer, R. B. (1997) Minor groove DNA alkylation directed by major groove triplex forming oligodeoxyribonucleotides. Nucleic Acids Res. 25, 5077-5084. (44) Dempcy, R. O., Kutyavin, I. V., Mills, A. G., Lukhtanov, E. A., and Meyer, R. B. (1999) Linkers designed to intercalate the double helix greatly facilitate DNA alkylation by triplexforming oligonucleotides carrying a cyclopropapyrroloindole reactive moiety. Nucleic Acids Res. 27, 2931-2937. (45) Basye, J., Trent, J. O., Gao, D., and Ebbinghaus, S. W. (2001) Triplex formation by morpholino oligodeoxyribonucleotides in the HER-2/neu promoter requires the pyrimidine motif. Nucleic Acids Res. 29, 4873-4880. (46) Trent, J. O. (2001) Molecular modeling of drug-DNA complexes: an update. Methods Enzymol. 340, 290-326. (47) Mohamadi, F., Richards, N. G., Guida, W. C., Liskamp, R., Lipton, M., Caufield, C., Chang, G., Hendrickson, T., and Still, W. C. (1990) MacroModel - an integrated software system for modeling organic and bioorganic molecules using molecular mechanics. J. Comput. Chem. 11, 440-455. (48) Jenkins, T. C., Hurley, L. H., Neidle, S., and Thurston, D. E. (1994) Structure of a covalent DNA minor groove adduct with a pyrrolobenzodiazepine dimer: evidence for sequencespecific interstrand cross-linking. J. Med. Chem. 37, 45294537. (49) Thurston, D. E., Bose, D. S., Thompson, A. S., Howard, P. W., Leoni, A., Croker, S. J., Jenkins, T. C., Neidle, S., Hartley, J. A., and Hurley, L. H. (1996) Synthesis of SequenceSelective C8-Linked Pyrrolo[2,1-c][1,4]benzodiazepine DNA Interstrand Cross-Linking Agents. J. Org. Chem. 61, 81418147. (50) Thurston, D. E., Bose, D. S., Howard, P. W., Jenkins, T. C., Leoni, A., Baraldi, P. G., Guiotto, A., Cacciari, B., Kelland, L. R., Foloppe, M. P., and Rault, S. (1999) Effect of A-ring

1192 Bioconjugate Chem., Vol. 15, No. 6, 2004 modifications on the DNA-binding behavior and cytotoxicity of pyrrolo[2,1-c][1,4]benzodiazepines. J. Med. Chem. 42, 1951-1964. (51) Milesi, D., Kutyavin, I., Lukhtanov, E. A., Gorn, V. V., and Reed, M. W. (2000) Synthesis of oligonucleotide conjugates in anhydrous dimethyl sulfoxide. Methods Enzymol. 313, 164-173. (52) Brown, P. M., and Fox, K. R. (1996) Minor groove binding ligands alter the rotational positioning of DNA fragments on nucleosome core particles. J. Mol. Biol. 262, 671-685. (53) Hertzberg, R. P., Hecht, S. M., Reynolds, V. L., Molineux, I. J., and Hurley, L. H. (1986) DNA sequence specificity of the pyrrolo[1,4]benzodiazepine antitumor antibiotics. Methidiumpropyl-EDTA-iron(II) footprinting analysis of DNA binding sites for anthramycin and related drugs. Biochemistry 25, 1249-1258. (54) Shelton, C. J., Harding, M. M., and Prakash, A. S. (1996) Enzymatic and chemical footprinting of anthracycline antitumor antibiotics and related saccharide side chains. Biochemistry 35, 7974-7982. (55) Bailly, C., Mollegaard, N. E., Nielsen, P. E., and Waring, M. J. (1995) The influence of the 2-amino group of guanine on DNA conformation. Uranyl and DNase I probing of inosine/ diaminopurine substituted DNA. EMBO J. 14, 2121-2131. (56) Waring, M. J., and Bailly, C. (1994) The purine 2-amino group as a critical recognition element for binding of small molecules to DNA. Gene 149, 69-79. (57) Boyd, F. L., Stewart, D., Remers, W. A., Barkley, M. D., and Hurley, L. H. (1990) Characterization of a unique tomaymycin-d(CICGAATTCICG)2 adduct containing two drug molecules per duplex by NMR, fluorescence, and molecular modeling studies. Biochemistry 29, 2387-2403. (58) Hurley, L. H. (1977) Pyrrolo(1,4)benzodiazepine antitumor antibiotics. Comparative aspects of anthramycin, tomaymycin and sibiromycin. J. Antibiot. (Tokyo) 30, 349-370.

Zhilina et al. (59) Hurley, L. H., Gairola, C., and Zmijewski, M. (1977) Pyrrolo(1,4)benzodiazepine antitumor antibiotics. In vitro interaction of anthramycin, sibiromycin and tomaymycin with DNA using specifically radiolabelled molecules. Biochim. Biophys. Acta 475, 521-535. (60) Farmer, J. D., Jr., Gustafson, G. R., Conti, A., Zimmt, M. B., and Suggs, J. W. (1991) DNA binding properties of a new class of linked anthramycin analogs. Nucleic Acids Res. 19, 899-903. (61) Kumar, R., and Lown, J. W. (2003) Design, synthesis and in vitro cytotoxicity studies of novel pyrrolo [2,1][1,4] benzodiazepine-glycosylated pyrrole and imidazole polyamide conjugates. Org. Biomol. Chem. 1, 3327-3342. (62) Sandor, Z., and Bredberg, A. (1995) Deficient DNA repair of triple helix-directed double psoralen damage in human cells. FEBS Lett. 374, 287-291. (63) Tuteja, N., Phan, T. N., Tuteja, R., Ochem, A., and Falaschi, A. (1997) Inhibition of DNA unwinding and ATPase activities of human DNA helicase II by chemotherapeutic agents. Biochem. Biophys. Res. Commun. 236, 636-640. (64) Soderlind, K. J., Gorodetsky, B., Singh, A. K., Bachur, N. R., Miller, G. G., and Lown, J. W. (1999) Bis-benzimidazole anticancer agents: targeting human tumour helicases. Anticancer Drug Des. 14, 19-36. (65) Hurley, L. H., Chandler, C., Garner, T. F., Petrusek, R., and Zimmer, S. G. (1979) DNA binding, induction of unscheduled DNA synthesis, and excision of anthramycin from DNA in normal and repair-deficient human fibroblasts. J. Biol. Chem. 254, 605-608. (66) Smellie, M., Kelland, L. R., Thurston, D. E., Souhami, R. L., and Hartley, J. A. (1994) Cellular pharmacology of novel C8-linked anthramycin-based sequence-selective DNA minor groove cross-linking agents. Br. J. Cancer 70, 48-53.

BC0498673

Synthesis and Evaluation of a Triplex-Forming Oligonucleotide

Recommend Documents