Synthesis of Polymerizable Protein Monomers for Protein-Acrylamide

May 19, 2009 - using tobacco etch virus NIa (TEV) protease cleavage. The 4-vinylbenzyl functionalized proteins were good substrates for immobilizing p...
0 downloads 0 Views 1MB Size
Download PDF
Biomacromolecules 2009, 10, 1939–1946

1939

Synthesis of Polymerizable Protein Monomers for Protein-Acrylamide Hydrogel Formation Junpeng Xiao† and Thomas J. Tolbert*,†,‡ Interdisciplinary Biochemistry Graduate Program and Department of Chemistry, Indiana University, Bloomington, Indiana 47405 Received March 24, 2009; Revised Manuscript Received April 24, 2009

A novel method to produce protein polymer conjugates for protein-acrylamide hydrogel formation is described. Alkenes are incorporated onto the N-terminus of expressed proteins to produce polymerizable protein monomers that can be utilized in protein-acrylamide copolymerization. A 4-vinylbenzoic acid thioester was synthesized and attached to the N-termini of two protein models, the immunoglobulin-binding protein Protein G and the bacterial enzyme xanthine-guanine phosphoribosyltransferase (GPRT), utilizing native chemical ligation. N-terminal cysteine containing proteins utilized in native chemical ligation reactions were generated from His-tagged fusion proteins using tobacco etch virus NIa (TEV) protease cleavage. The 4-vinylbenzyl functionalized proteins were good substrates for immobilizing proteins into polyacrylamide hydrogels via free radical induced protein-acrylamide copolymerization. The protein copolymerization procedures developed in this report are mild enough to allow proteins to retain measurable biological activity as demonstrated by the retention of immunoglobulin binding ability by immobilized Protein G and enzymatic activity of immobilized GPRT.

Introduction Conjugation of polymers to peptides and proteins can alter their physical properties and biological activities and has many useful applications in medicine and biotechnology.1,2 A major application of peptide and protein polymer conjugates in medicine is the addition of polyethylene glycol (PEG) to therapeutic peptides and proteins, which increases their molecular weight, reduces immunogenicity, and increases in vivo half-lives.3-5 Other medical uses of peptide and protein polymer conjugates include production of polymers with pendant antigenic peptides for vaccine development,6-8 and the grafting of peptide ligands to polymers to produce coatings that promote cell adhesion for use in medical implants.9 In biotechnological applications of peptide and protein polymer conjugates, the immobilization of enzymes in polymers has wide application in the recycling of enzymes used for industrial enzymatic transformations,10 and recently there has been great interest in the use of protein polymer conjugates in the construction of protein microarrays.11-15 A wide variety of approaches have been utilized to produce peptide and protein polymer conjugates. For peptides that are small enough to be produced by solid phase peptide synthesis, reactive groups that can be used to link peptides to polymers can be incorporated during peptide synthesis. This strategy has been utilized to produce N-terminally acryloylated peptides that can be subsequently used in free radical induced copolymerization with acrylamide7 and for PEGylation of synthetic peptides.4 While this method works well for small peptides, its application to larger peptides and proteins is restricted by the size limitations of solid phase peptide synthesis. Strategies for the production of polymer conjugates to larger peptides and proteins can be divided into two categories, those that utilize biosynthetic incorporation of reactive groups into proteins for * To whom correspondence should be addressed. Tel.: 812-856-1887. Fax: 812-855-8300. E-mail: [email protected]. † Interdisciplinary Biochemistry Graduate Program. ‡ Department of Chemistry.

subsequent polymer conjugation and those that incorporate reactive groups or polymers onto proteins after the proteins have already been synthesized.16 Methods that utilize biosynthetic incorporation of reactive groups into proteins include multisite replacement of specific amino acid residues using auxotrophic bacterial strains and site-selective tRNA suppressor technologies.17,18 These biosynthetic approaches to incorporation of reactive groups into proteins hold great promise for the future but are developing technologies. The more frequently used strategy to produce protein polymer conjugates is the attachment of reactive groups or polymers onto protein side chains after the proteins have been synthesized. This strategy has been utilized for PEGylation of therapeutic proteins to improve pharmacodynamics,5,19 to attach initiators to proteins to form macroinitiators of polymerization,20-22 and to attach alkenes to proteins for subsequent polymerization.12,13 Incorporation of reactive groups or polymers into proteins after they have been synthesized is straightforward and works well, however most examples of this approach utilize random protein modification reactions to conjugate polymers onto proteins. Random modification of proteins has the potential of inactivating proteins through modification of critical amino acid residues and produces heterogeneous mixtures that are hard to characterize, and because of this, it is undesirable in many applications. To overcome the drawbacks of random protein modification in the production of protein polymer conjugates, we have taken the approach of using a chemoselective reaction, native chemical ligation,23,24 to incorporate alkenes site-selectively onto proteins. Such an approach has the advantages of reducing losses of protein activity caused by random modification and produces homogeneous alkene functionalized proteins that can be characterized prior to polymerization. Herein, we describe this novel approach to site-specifically attach alkene groups onto the N-terminus of recombinant proteins to produce alkene-functionalized, polymerizable protein monomers. Once formed, these polymerizable protein monomers can be immobilized into polyacrylamide hydrogels through free radical induced protein-

10.1021/bm900339q CCC: $40.75  2009 American Chemical Society Published on Web 05/19/2009

1940

Biomacromolecules, Vol. 10, No. 7, 2009

acrylamide copolymerization, and proteins immobilized in this manner retain measurable biological activity. By incorporating alkenes onto proteins before copolymerization reactions, we avoid complications that can occur during conjugation of proteins to hydrogels such as inefficient conjugations of proteins to hydrogels caused by diffusional limitations and reactive groups being left in the hydrogel due to incomplete conjugation to proteins. Such complications have been observed when producing protein dendrimers with four proteins attached to a core linker and are likely to be more severe for conjugation of proteins to hydrogels with potentially hundreds of conjugation sites.25

Experimental Section Materials. 4-Pentenoic acid, 4-vinylbenzoic acid, 1,3-diisopropylcarbodiimide (DIC), betaine, sodium 2-mercaptoethanesulfonate, guanine, 5-phospho-D-ribose 1-diphosphate (PRPP), and fluorescein isothiocyanate (FITC) were purchased from Sigma-Aldrich. Bovine serum albumin (BSA) was purchased from New England BioLabs. Anhydrous solvents were purchased and used without purification. 1H and 13C NMR spectra were obtained using a 400 MHz Varian Inova NMR spectrometer. High resolution ESI mass spectrometry was performed on a Waters/Micromass LCT Classic. High resolution EI mass spectrometry was performed on a Thermo Electron Corporation MAT 95XP-Trap. Low resolution of ESI mass spectrometry was performed on an API III. MALDI-TOF mass spectrometry was performed on a Bruker Biflex III. Samples for MALDI-TOF mass spectrometry were prepared by mixing 1 µL of desalted protein solution with 5 µL of a 10 mg/mL solution of R-cyano-4-hydroxycinnamic acid (CCA) matrix. A total of 1 µL of this mixture was deposited onto the target and air-dried for analysis. Synthesis of 2-(4-Pentenoylthio)acetic Acid 1c. 4-Pentenoic acid 3c (47.6 mg, 0.48 mmol), t-butyl mercaptoacetate 226 (142.3 mg, 0.96 mmol), and DIC (121.2 mg, 0.96 mmol) were dissolved in CH2Cl2 anhydrous (20 mL). After stirring at room temperature for 24 h under N2, the solvent was removed by rotavapor. The residue was purified by flash chromatography (ethyl acetate/hexane 5:95) and afforded 91.9 mg of t-butyl 2-(4-pentenoylthio)acetate 4c (84% yield). 1H NMR (400 MHz, CDCl3): δ 5.801 (m, 1H), 5.071 (d, J ) 16.8 Hz, 1H), 5.020 (d, J ) 10 Hz, 1H), 3.620 (s, 2H), 2.700 (t, J ) 7.2 Hz, 2H), 2.441 (q, J ) 6.8 Hz, 2H), 1.459 (s, 9H); 13C NMR (400 MHz, CDCl3): δ 191.017, 167.866, 136.105, 116.149, 82.350, 42.919, 32.594, 29.419, 28.084. t-Butyl 2-(4-pentenoylthio)acetate 4c (91.9 mg, 0.40 mmol) was dissolved in 95% TFA (5 mL) and stirred at room temperature for 30 min. The TFA and water were then removed by rotavapor to afford 66.2 mg of 2-(4-pentenoylthio)acetic acid 1c (95% yield). 1H NMR (400 MHz, CDCl3): δ 5.796 (m, 1H), 5.073 (d, J ) 17.2 Hz, 1H), 5.026 (d, J ) 10.4 Hz, 1H), 3.743 (s, 2H), 2.728 (t, J ) 7.2 Hz, 2H), 2.436 (q, J ) 6.8 Hz, 2H); 13C NMR (400 MHz, CDCl3): δ 196.842, 174.667, 135.741, 116.159, 42.718, 31.028, 29.166. HR-ESI-MS (m/ z): Calcd for C7H10O3S (M + Na)+, 197.0248; obsd, 197.0245. Synthesis of 2-(4-Vinylbenzoylthio)acetic Acid 1d. 4-Vinylbenzoic acid 3d (50.0 mg, 0.34 mmol), t-butyl mercaptoacetate 2 (100.8 mg, 0.68 mmol), and DIC (85.8 mg, 0.68 mmol) were dissolved in CH2Cl2 anhydrous (20 mL). After stirring at room temperature for 24 h under N2, the solvent was removed by rotavapor. The residue was purified by flash chromatography (ethyl acetate/hexane 5:95) and afforded 84.9 mg of t-butyl 2-(4-vinylbenzoylthio)acetate 4d (90% yield). 1H NMR (400 MHz, CDCl3): δ 7.940 (d, J ) 8.4 Hz, 2H), 7.470 (d, J ) 8.4 Hz, 2H), 6.741 (dd, J ) 17.6, 10.8 Hz, 1H), 5.873 (d, J ) 17.6 Hz, 1H), 5.402 (d, J ) 10.8 Hz, 1H), 3.807 (s, 2H), 1.484 (s, 9H); 13C NMR (400 MHz, CDCl3): δ 189.583, 167.789, 142.706, 135.792, 135.434, 127.765, 126.376, 117.005, 82.315, 32.584, 27.960. t-Butyl 2-(4-vinylbenzoylthio)acetate 4d (84.9 mg, 0.30 mmol) was dissolved in 95% TFA (5 mL) and stirred at room temperature for 30 min. The TFA and water were then removed by rotavapor to afford

Xiao and Tolbert 61.9 mg of 2-(4-vinylbenzoylthio)acetic acid 1d (93% yield). 1H NMR (400 MHz, CDCl3): δ 7.932 (d, J ) 8.4 Hz, 2H), 7.478 (d, J ) 8.4 Hz, 2H), 6.743 (dd, J ) 17.6, 11.2 Hz, 1H), 5.883 (d, J ) 17.6 Hz, 1H), 5.418 (d, J ) 10.8 Hz, 1H), 3.915 (s, 2H); 13C NMR (400 MHz, CDCl3): δ 189.461, 174.504, 143.057, 135.731, 134.961, 127.887, 126.467, 117.265, 31.149. HR-EI-MS (m/z): Calcd for C7H11O3S (M + H)+, 223.0423; obsd, 223.0424. Cloning of Protein G Fusion Protein. The following DNA encoding for the C2 domain of Protein G with an N-terminal TEV protease cleavage site and cysteine was synthesized with E. coli optimized codons by EZBiolab Inc. (Westfield, IN) and inserted into pUC57: GAATTCGAAAACCTGTACTTCCAGTGCGGTGGTACCCCGGCTGTTACCACCTACAAACTGGTTATCAACGGTAAAACCCTGAAAGGTGAAACCACTACCGAAGCTGTTGACGCAGCTACCGCAGAAAAGGTTTTCAAACAGTACGCTAACGACAACGGTGTTGACGGTGAATGGACCTACGATGACGCAACCAAAACTTTCACCGTTACCGAATAAAAGCTT. The Protein G encoding DNA was excised from pUC57 by restriction digestion with EcoRI and HindIII, ligated into pET-28a (Novagen, Madison, WI) using the same restriction sites, and then transformed into Top10F′ E. coli (Invitrogen, Carlsbad, CA) to produce pProteinG. Expression and Purification of Protein G Fusion Protein. E. coli Rosetta 2 (Novagen) transformed with pProteinG was inoculated into 5 mL of lysogeny broth (LB) medium containing 25 µg/mL kanamycin and incubated with shaking at 37 °C overnight. The culture was added into 1 L of LB medium containing 25 µg/mL kanamycin and incubated at 37 °C with shaking. Protein expression was induced by addition of isopropyl β-D-1-thiogalactopyranoside (IPTG; 0.2 mM) at OD600 nm ) 0.6. Cells were harvested after 8 h induction by centrifugation at 4 °C, 5378 g for 15 min. The cell pellet was resuspended in 30 mL of 50 mM sodium phosphate pH 7.5/5 mM β-mercaptoethanol (β-ME) and then sonicated on ice. The cell lysate was centrifuged at 4 °C, 17640 g for 30 min. The supernatant was loaded on a Ni2+-NTA-agarose column (5 mL bed volume, pre-equilibrated with 50 mM sodium phosphate pH 7.5/5 mM β-ME). The column was washed with 50 mL of 50 mM sodium phosphate pH 7.5/10 mM imidazole/300 mM NaCl/5 mM β-ME. The fusion protein was eluted with 50 mM sodium phosphate pH 7.5/250 mM imidazole/5 mM β-ME and dialyzed against 20 mM sodium phosphate pH 7.5/ 2 mM β-ME at 4 °C overnight. General Procedure for TEV Protease Cleavage and Generation of N-terminal Cysteines. TEV protease was obtained by bacterial expression.27 Protein G was expressed and purified as described above, and a His-tag fused GPRT fusion protein was expressed and purified as described previously.27 4 mg/mL of Protein G fusion protein or GPRT fusion protein was placed into a dialysis bag and 200 units of TEV protease were added. The dialysis bag was placed into 1 L of 20 mM sodium phosphate buffer pH 7.5 containing 2 mM β-ME. The TEV protease cleavage reaction was gently stirred and incubated at room temperature for 24 h to generate the N-terminal cysteine. General Procedure for Native Chemical Ligation. A total of 800 µL of the cleaved N-terminal cysteine Protein G or GPRT produced as described above was dialyzed into 1 L of ligation buffer (5 mM betaine, 20 mM sodium phosphate at pH 7.5) at 4 °C for 12 h and then transferred into an eppendorf tube for native chemical ligation. The ligation reaction was initiated by adding 100 µL of 40 mM thioester 1 (4 mM final concentration) and 100 µL of 300 mM sodium 2-mercaptoethanesulfonate (30 mM final concentration) into the protein solution, and this mixture was incubated at room temperature for 24 h. After the ligation, the mixture was dialyzed into 1 L of 20 mM sodium phosphate pH 7.5 containing 2 mM β-ME at 4 °C for 12 h to remove the excess thioester. Protein Immobilization and Electrophoresis Under Native Conditions. A total of 25 µL of protein solution (3 mg/mL) containing 1% β-ME was mixed with 25 µL of 30% acrylamide/bis solution (29: 1). Then 1 µL of 10% ammonium persulfate (APS) and 0.1 µL of N,N,N,′N′-tetramethylethylenediamine (TEMED) were added into the mixture to initiate the free radical copolymerization (final protein

Synthesis of Polymerizable Protein Monomers concentrations were approximately 220 µM for Protein G and 87 µM for GPRT). After thorough mixing, 20 µL of this mixture was quickly loaded into the sample well of a polyacrylamide native gel and incubated for 1 h to form protein-acrylamide hydrogels. Then the entire polyacrylamide native gel was electrophoresed with native running buffer (5 mM tris-base, 38 mM glycine, pH ) 8.8). The protein gels were stained with coomassie brilliant blue to visualize the location of proteins. Then gels were scanned and protein bands were quantified by gel densitometry using ImageJ (National Insitutes of Health software, http://rsb.info.nih.gov/ij/) to determine the gel density of immobilized and migrated proteins.28 The protein immobilization percentage was then calculated by the following equation:

immobilization% ) immobilized protein density/(immobilized + migrated) protein density Protein Immobilization and Electrophoresis Under Denaturing Conditions. Proteins were immobilized using the same procedure as described above for native conditions except that the type of gel used was a SDS-PAGE gel rather than a native gel. The entire SDS-PAGE gel was then electrophoresed with SDS denaturing running buffer (25 mM Tris-base, 192 mM glycine, 0.1% SDS, pH ) 8.8). After electrophoresis, gels were stained with coomassie brilliant blue and analyzed by gel densitometry as described above for native conditions. Expression and Purification of IgG Fc. The antibody fragment IgG Fc was expressed in the methylotrophic yeast Pichia pastoris utilizing a methanol inducible IgG Fc expressing strain of Pichia pastoris. A 2 mL culture (YPD: 1% yeast extract, 2% peptone, and 2% glucose, + 100 µg/mL Zeocin) was grown at 25 °C for 48 h and then was inoculated into 50 mL of culture (YPD + 100 µg/mL Zeocin) to grow at 25 °C for another 48 h. The 50 mL of dense culture was then inoculated into a spinner flask containing 1 L of BMGY (1% yeast extract, 2% peptone, 1.34% YNB, 1% glycrol, 4 × 10-5% biotin, and 0.004% histidine) with air flowing. The 1 L culture was grown at 25 °C for 24 h to allow the culture to grow to density. Thereafter, 50 mL of 20% methanol was added into the 1 L culture to 1% final concentration every 24 h for 3 days. The 1 L culture supernatant was collected by centrifugation at 4 °C, 5378 g for 15 min. The pH of the supernatant was adjusted to 7 and the supernatant chilled to 4 °C for 2 h and then filtered. The filtered supernatant was loaded onto a protein G column (5 mL bed volume, pre-equilibrated with 20 mM sodium phosphate pH 7.0). The column was washed with 50 mL of 20 mM sodium phosphate pH 7.0. The IgG Fc was eluted with 0.1 M glycine pH 2.7 and dialyzed against 20 mM sodium phosphate pH 7.0 at 4 °C overnight. FITC Labeling IgG Fc. A total of 800 µL of 3 mg/mL of IgG Fc was dialyzed into 1 L of 20 mM sodium phosphate pH 7.4 at 4 °C for 12 h and was then transferred into an eppendorf tube. The labeling reaction was then initiated by adding 8 µL of 10 mg/mL of FITC in DMSO and incubated at room temperature for 24 h. After the reaction, the FITC labeled IgG Fc was dialyzed into 1 L of 20 mM tris-base buffer pH 7.0 at 4 °C for 24 h to remove the excess FITC. In-Gel Binding Assay. Protein G was first immobilized and electrophoresed under native conditions as described previously (see Protein Immobilization and Electrophoresis Under Native Conditions). Then 10 µL of FITC-IgG Fc (3 mg/mL) was loaded into each sample well and the gel was electrophoresed for another 3 h. After that, the migration of FITC-IgG Fc was visualized under UV light. Cysteine Alkylation. An aliquot of 900 µL of cleaved GPRT (3 mg/mL) was transferred into an eppendorf tube. Then 100 µL of 100 mM iodoacetamide was added into the tube and mixed thoroughly (10 mM final concentration). The reaction was incubated at room temperature for 12 h and was then terminated by adding 10 µL of 1 M dithiothreitol (DTT). Then the mixture was dialyzed into 1 L of 20 mM sodium phosphate pH 7.5 containing 2 mM β-ME at 4 °C for 12 h to remove the small molecules.

Biomacromolecules, Vol. 10, No. 7, 2009

1941

GPRT Enzymatic Activity Assay. The specific activities of the unmodified and vinylbenzyl-modified forms of GPRT were determined in solution by a continuous spectrophotometric assay.29-31 The protein concentration was determined by UV absorption at 280 nm using the extinction coefficient calculated on the basis of protein sequence.32,33 The enzymatic activities of immobilized GPRT proteins were determined as described below. A total of 500 µL of reaction buffer (110 mM Tris-HCl, pH 7.5, 11 mM MgCl2) and 25 µL of 50 mM PRPP solution in water were mixed in a 2 mL scintillation vial. The Beckman DU 530 spectrophotometer used in this experiment was blanked by this mixture at 257.5 nm. An aliquot of 15 µL of 2.5 mM guanine solution in water (pH adjusted to 12 to solubilize the guanine) was added into the vial. An aliquot of 20 µL of 0.075 mg/mL of unmodified or vinylbenzyl modified GPRT containing 1% β-ME was mixed with 20 µL of 30% acrylamide/bis solution (29:1). Then 1 µL of 10% APS and 0.1 µL of TEMED were added into the mixture to initiate the free radical copolymerization. After thorough mixing, 10 µL of this mixture was quickly loaded into the sample well of a polyacrylamide native gel and incubated for 1 h to form a protein-acrylamide hydrogel. Then the polyacrylamide native gel was electrophoresed with native running buffer for 2 h. After electrophoresis, the protein-acrylamide hydrogel was cut from the sample well and added into the vial to initiate the enzymatic reaction. The reaction was gently stirred at room temperature for 20 min and the UV absorbance of the reaction solution was taken at 257.5 nm every 2 min to monitor the formation of guanosine monophosphate (GMP). Initial reaction rates were determined in absorbance units per min (∆Abs/min). Under these experimental conditions, the difference in extinction coefficients (∆ε) between GMP and guanine is 5340 M-1 cm-1. Initial rates in absorbance units per min were converted to specific activities (moles per min per mg) by the following equation:

specific activity ) (initial rate × reaction volume) / (∆ε × mg of protein) Results and Discussion Strategy for the Synthesis of Polymerizable Protein Monomers. Our approach for the site-specific incorporation of alkenes into expressed proteins utilizes native chemical ligation to ligate alkene-containing thioesters onto protein N-terminal cysteines (Figure 1). In these ligations, internal cysteines are not modified and, therefore, proteins containing single or multiple cysteine residues can be functionalized site-selectively on the N-terminus using this strategy. The target proteins were first expressed as fusion proteins that contain a TEV protease cleavable His-tag at the N-terminus. Treatment of the fusion proteins with TEV protease produced proteins with N-terminal cysteines suitable for ligation.27 Alkene-containing thioesters 1 were then ligated onto the N-terminal cysteines via native chemical ligation to produce alkene-functionalized, polymerizable protein monomers. Synthesis of Alkene-Containing Thioesters. Synthesis of alkene-containing thioesters involved coupling t-butyl mercaptoacetate 2 with alkene-containing carboxylic acids in the presence of DIC to form protected alkene-containing thioesters, which were then deprotected by treatment with 95% TFA to afford water-soluble alkene-containing thioesters (Table 1). Working on the basis of previously reported research where acrylic acid and acrylamide modified polypeptides were used to produce peptide-polymer conjugates,6,7 we first attempted to produce an alkene-containing thioesters using acrylic acid (Table 1, entry 3a). Unfortunately, the acrylic group was too reactive and it underwent Michael addition during the thioester formation reaction. The less reactive crotonic acid was next tested (Table 1, entry 3b) to determine if substitution on the alkene could be used to prevent undesired reactions with free thiols. Regrettably crotonic acid was also too reactive and most

1942

Biomacromolecules, Vol. 10, No. 7, 2009

Figure 1. Production of alkene-functionalized, polymerizable protein monomers. N-terminal cysteines are generated by TEV protease cleavage of His-tagged fusion proteins. Alkene groups are then attached to the N-terminus of the protein via native chemical ligation with the alkene-containing thioester 1.

of it underwent a Michael addition reaction, with only a small amount of thioester 4b (5%) being isolated. To move away from the reactivity of R,β-unsaturated carbonyl containing compounds, we further tested two additional alkene-containing carboxylic acids, 4-pentenoic acid and 4-vinylbenzoic acid (Table 1, entries 3c and 3d), which are significantly less reactive in addition reactions. Under the same reaction conditions, both 3c and 3d underwent the desired coupling reaction and produced protected thioesters 4c and 4d in good yields. After purification by flash chromatography, the t-butyl groups on 4c and 4d were cleaved by 95% TFA at room temperature, and the TFA was then removed by rotovap to afford the corresponding thioesters 1c and 1d in high yields. Synthesis of a Polymerizable Protein G Monomer. To test the feasibility of our ligation approach for the synthesis of polymerizable protein monomers, we chose a small monomeric protein, the C2 domain of Protein G, as our first model system.34,35 Protein G is an immunoglobulin-binding protein that is found in group G streptococci that has many biotechnological applications in antibody purification and immobilization. Protein G was expressed as a fusion protein with a TEV protease cleavable His-tag and purified by Ni2+-NTA affinity chromatography. TEV protease cleavage of the fusion protein produced the desired Protein G with an N-terminal cysteine, which was confirmed by MALDI-TOF mass spectra (Figure 2A). The cleaved Protein G was purified by Ni2+-NTA affinity chromatography again to remove the His-tag and then dialyzed into ligation buffer at 4 °C for 12 h. Ligation of 4-pentenoic acid thioester 1c to Protein G was performed first. The ligation reaction was initiated by adding 1c (4 mM final concentration) and sodium 2-mercaptoethanesulfonate (30 mM final concentration) into a Protein G solution (4 mg/mL), and this mixture was incubated at room temperature for 24 h. Under these conditions, 1c reacted with the N-terminal cysteine of Protein G and produced 4-pentenyl functionalized

Xiao and Tolbert

Protein G (pentenyl-Protein G) in a high yield as determined by mass spectrometry analysis (Figure 2B). Next, ligation of 4-vinylbenzoic acid thioester 1d with Protein G was performed. Under the same ligation conditions 1d was not completely watersoluble at a concentration of 4 mM and a slight cloudiness could be detected in solution. After 24 h incubation, the undissolved 1d was removed by centrifugation, and the supernatant was collected and characterized by mass spectrometry (Figure 2C). Though there was somewhat less than a 4 mM concentration of 1d in the reaction, it still proceeded well and gave the desired 4-vinylbenzyl functionalized Protein G (vinylbenzyl-Protein G) in a high yield (>95% as estimated by mass spectrometry analysis). After the ligation reaction, both the pentenyl-Protein G and the vinylbenzyl-Protein G were dialyzed in sodium phosphate buffer at pH 7.5 to remove the excess thioesters and sodium 2-mercaptoethanesulfonate. Immobilization of Protein G. To investigate the ability of alkene-functionalized Protein G to be used in free radical induced polymerization, we developed a method for immobilization of proteins into polyacrylamide hydrogels based upon polymerization procedures used to produce polyacrylamide gels for biochemical applications.12 Protein solution (3 mg/mL) was mixed with 30% acrylamide/bis solution (29:1) in the presence of 0.5% β-ME to keep the cysteines in reduced form. In these protein polymerization reactions, the concentration of acrylamide used (2.1 M) was in large excess of the protein concentrations (approximately 220 µM for Protein G) to ensure efficient hydrogel formation. Next APS and TEMED were added into the mixture to initiate free radical copolymerization. After thorough mixing, the mixture was quickly loaded into the sample well of a native polyacrylamide gel and incubated for 1 h to form protein-acrylamide copolymer hydrogels. Then the entire gel was electrophoresed and stained with coomassie brilliant blue to visualize location of proteins and determine if they were immobilized into polyacrylamide hydrogels in the well or free to migrate through the gel. The amounts of immobilized protein and migrated protein were quantified by gel densitometry to determine the percentage of protein immobilized in the sample wells.36,37 We tested this method on the pentenyl-Protein G first, but unfortunately, the pentenyl-protein G migrated into the gel during electrophoresis just as the unmodified Protein G and only a negligible amount of pentenyl-Protein G (4.5%) was immobilized into the hydrogel in the well (Figure S1). This suggests that the pentenyl-Protein G could not be immobilized by free radical copolymerization using APS as the initiator because of the inertness of the R-olefin structure of 4-pentenyl group.38 Though more forcing conditions can be used to induce the 4-pentenyl group to polymerize, many of those conditions are also likely to result in chemical modification or denaturation of our protein monomers. For applications where protein activity was to be preserved, we sought a polymerizable group that could be polymerized under milder conditions. Compared to the 4-pentenyl group, the 4-vinylbenzyl group is more reactive owing to its conjugated structure. Thus, we next tested the possibility of protein immobilization using vinylbenzyl modified Protein G. Unlike pentenyl-Protein G, after polymerization and electrophoresis all (100.0%) of the vinylbenzyl-Protein G was immobilized in the sample well as can be seen in the coomassie stained gel and the quantified immobilization percentage (shown in Figure 3A, lane 3). For comparison, almost all (97.0%) of the unmodified Protein G used as a control migrated into the gel (Figure 3A, lane 2). These results indicate that the vinylbenzyl group is responsible for Protein G immobilization through protein-acrylamide copoly-

Synthesis of Polymerizable Protein Monomers

Biomacromolecules, Vol. 10, No. 7, 2009

1943

Table 1. Synthesis of Alkene-Containing Thioesters (1)

Figure 3. Protein G immobilization and binding activity. (A) Immobilization of Protein G into a native polyacrylamide gel visualized by coomassie staining and quantified by gel densitometry. (Lane 1) Unmodified, unpolymerized Protein G as a MW marker, (lane 2) immobilization of unmodified Protein G (3.0% immobilization), (lane 3) immobilization of vinylbenzyl-Protein G (100.0% immobilization). (B) Fluorescence of FITC-IgG Fc after electrophoresis of FITC-IgG Fc through a native gel containing immobilized Protein G, lanes 1-3 are the same as in part A.

Figure 2. MALDI-TOF mass spectra of (A) Protein G, calcd 6737, found 6739; (B) pentenyl-Protein G, calcd 6819, found 6820; (C) vinylbenzyl-Protein G, calcd 6867, found 6868; (D) Protein G treated with APS and TEMED, calcd 6737, found 6738.

merization because the unmodified Protein G was not significantly immobilized at all, but Protein G functionalized with the vinylbenzyl group was completely immobilized into polyacrylamide hydrogels. In Gel Binding Assay of Immobilized Protein G. To further determine if the free radical induced polymerization of the vinylbenzyl modified protein damaged it, we first investigated whether the protein was modified at sites other than the N-terminal vinyl group under the polymerization conditions. To do this, the unmodified Protein G was incubated with APS and TEMED in the absence of acrylamide for 1 h. After incubation, the Protein G was analyzed by mass spectrometry. As shown

in Figure 2D, the mass spectra of APS/TEMED treated Protein G was remarkably similar to the spectra of unmodified Protein G shown in Figure 2A, with the masses being the same within error and indicating that there was little or no other modifications under the polymerization conditions. We further investigated if the immobilized Protein G retained its ability to bind to the antibody fragment IgG Fc. Briefly, fluorescein isothiocyanate labeled IgG Fc (FITC-IgG Fc) was electrophoresed through the Protein G immobilized native gel, and the location of the FITC-IgG Fc was visualized under UV light. As can be seen by the fluorescent bands in Figure 3B, after electrophoresis the FITC-IgG Fc was retained in the well where vinylbenzyl-Protein G was polymerized (Figure 3B, lane 3). However, in the well where the unmodified Protein G was polymerized, the FITC-IgG Fc migrated into the gel (Figure 3B, lane 2) as a diffuse band as would be expected for IgG Fc randomly labeled with FITC. These in gel binding results

1944

Biomacromolecules, Vol. 10, No. 7, 2009

Xiao and Tolbert

Figure 5. Immobilization of GPRT into a native gel visualized by coomassie staining and quantified by gel densitometry. (Lane 1) Unmodified, unpolymerized GPRT as a MW marker, (lane 2) immobilization of alkylated GPRT (30.1% immobilization), (lane 3) immobilization of unmodified GPRT (47.7% immobilization), (lane 4) immobilization of vinylbenzyl-GPRT (99.2% immobilization).

Figure 4. Reconstructed ESI mass spectra of (A) GPRT, calcd 17074, found 17074; (B) vinylbenzyl-GPRT, calcd 17204, found 17204.

indicate that only the vinylbenzyl-Protein G was immobilized into the hydrogel in the well to a significant extent, and the unmodified Protein G was not immobilized in the well. These results are consistent with the coomassie stained immobilization gel (Figure 3A) and also indicate that immobilized vinylbenzylProtein G in the polyacrylamide hydrogels is still active for IgG Fc binding and can be used to capture antibodies and antibody fragments during native gel electrophoresis. Synthesis of a Polymerizable GPRT Monomer. Next, we applied this ligation and immobilization approach to a more complicated model protein, the E. coli enzyme GPRT, which contains an internal cysteine and forms a tetramer in its native state.39 N-terminal cysteine containing GPRT was prepared as described previously (Figure 4A).27,31 The ligation of 1d to GPRT produced vinylbenzyl-GPRT in a high yield as determined by mass spectrometry analysis (Figure 4B). Immobilization of GPRT. Polyacrylamide copolymerization experiments were conducted similarly to those done with Protein G using a large excess of acrylamide to ensure efficient hydrogel formation (the concentration of acrylamide used these experiments was approximately 2.1 M and GPRT was approximately 87 µM). As expected, almost all (99.2%) the vinylbenzyl-GPRT was efficiently immobilized into polyacrylamide hydrogels by protein-acrylamide copolymerization (Figure 5, lane 4). However, unexpectedly, about half (47.7%) of the unmodified GPRT was also immobilized (Figure 5, lane 3), and the rest migrated into the gel as a mixture of monomer, dimer, and tetramer. We

hypothesized that the immobilization of unmodified GPRT could be due to the participation of GPRT’s two cysteines in the free radical polymerization, potentially as part of chain transfer. In this hypothesis, a free radical abstracts the thiol hydrogen of cysteine to form a thiyl radical and terminating one chain. The thiyl radical then adds to the double bond of acrylamide to initiate the polymerization of another chain and results in the immobilization of GPRT into the polyacrylamide hydrogels through cysteine.40 In addition, the greater amount of immobilization of unmodified GPRT could also be due to the native tetrameric state of GPRT, which would result in four protein monomers being immobilized for each single covalent cross-link to the polyacrylamide. To test these hypotheses, we alkylated the cysteines of unmodified GPRT with iodoacetamide and carried out the immobilization experiments on the alkylated GPRT (Figure 5, lane 2). After electrophoresis, 30.1% of the alkylated GPRT was immobilized into the hydrogel in the sample well, which was less than the unmodified GPRT (47.7%). This suggests that alkylation of cysteine reduces the amount of immobilization but does not completely eliminate the immobilization of unmodified GPRT. The remaining immobilization of alkylated GPRT may be due to incomplete alkylation of GPRT cysteine residues, which was observed in the mass spectrum of alkylated GPRT (Figure S2). This observation indicates that addition of cysteine to polyacrylamide chains contributes to the immobilization of unmodified GPRT into polyacrylamide hydrogels. To further examine the influence of the free cysteines and the tetrameric state of GPRT on GPRT acrylamide copolymerization, the unmodified GPRT and vinylbenzyl-GPRT were immobilized in the sample well of a SDS-PAGE gel, with different concentrations of a free thiol competitor (0% β-ME, 0.05% β-ME, and 0.5% β-ME) and electrophoresed with denaturing gel running buffer (Figure 6) to denature the GPRT such that noncovalently bound GPRT would migrate out of the hydrogel. Under these conditions, about 44% of unmodified GPRT was immobilized in the presence of no or low concentrations of free thiol (0% and 0.05% of β-ME), and the immobilization of unmodified GPRT was dramatically decreased to 18.4% in the presence of higher concentrations of free thiol (0.5% of β-ME). In contrast, approximately 87% of vinylbenzylGPRT was immobilized in the presence of no or low concentrations of free thiol (0 and 0.05% of β-ME), and the immobilization was slightly reduced to 81.1% in the presence of higher concentrations of free thiol (0.5% of β-ME). These results indicate that in the presence of no or very low concentrations of free thiol, the addition of cysteine with acrylamide does contribute to the immobilization of unmodified GPRT into polyacrylamide hydrogels. However, in the presence of high concentrations of free thiol, the free thiol potentially competes with cysteine to form thiyl radical which inhibits the cysteine

Synthesis of Polymerizable Protein Monomers

Biomacromolecules, Vol. 10, No. 7, 2009

Figure 6. Immobilization of GPRT into a SDS-PAGE gel with different concentrations of β-ME visualized by coomassie staining and quantified by gel densitometry. (Lane 1) MW marker, (lane 2) unmodified GPRT immobilized with 0% β-ME (44.0% immobilization), (lane 3) vinylbenzyl-GPRT immobilized with 0% β-ME (87.3% immobilization), (lane 4) unmodified GPRT immobilized with 0.05% β-ME (43.1% immobilization), (lane 5) vinylbenzyl-GPRT immobilized with 0.05% β-ME (87.1% immobilization), (lane 6) unmodified GPRT immobilized with 0.5% β-ME (18.4% immobilization), (lane 7) vinylbenzyl-GPRT immobilized with 0.5% β-ME (81.1% immobilization). Table 2. Number of Cysteines and the Immobilization Percentages of the Five Proteins protein

No. of Cys

% of immobilizationa

BSA IgG Fc sialic acid aldolase CMP-sialic acid synthetase CMP kinase

35 7 4 3 2

62.8 13.5 13.1 13.1 9.8

a

% of immobilization under denaturing conditions.

addition to acrylamide and, consequently, partially inhibits the incorporation of unmodified GPRT into polyacrylamide hydrogels. The smaller influence of this inhibition phenomenon on the immobilization of vinylbenzyl-GPRT also indicates that the vinylbenzyl-GPRT is preferentially immobilized through the vinyl group rather than through its cysteines. Most interestingly, we observed that in the presence of higher concentrations of free thiol (0.5% of β-ME), the majority of the unmodified GPRT migrated into the gel as a monomer and only 18.4% was covalently immobilized under denaturing electrophoresis conditions (Figure 6, lane 6), which was significantly lower than the 47.7% immobilization of unmodified GPRT observed in the presence of 0.5% β-ME under native electrophoresis conditions (Figure 5, lane 3). This observation suggests that with the same amount of free thiol competitor present, the tetramer formation of GPRT also significantly contributes to the immobilization of the unmodified GPRT into polyacrylamide hydrogels under native conditions. All of these results indicate that both chain transfer with cysteine residues and the native tetrameric state of GPRT contribute to the significant immobilization of unmodified GPRT into polyacrylamide hydrogels under native electrophoresis conditions. These results also indicate that undesirable modification of cysteine residues can be reduced by addition of a free thiol competitor, and that this does not prevent the vinylbenzyl group from being incorporated into polyacrylamide hydrogels. Generality of Protein Immobilization through Cysteine Residues. To investigate the general effect of the participation of cysteine residues in protein immobilization during polyacrylamide polymerization, we chose five proteins containing differing numbers of cysteine residues. These proteins were polymerized with acrylamide/bis-acrylamide in the presence of 0.5% β-ME in the sample well of a SDS-PAGE gel (Table 2 and Figure S3, please see Supporting Information for more detailed information). The five proteins were BSA, IgG Fc, sialic acid aldolase,41 cytidine monophosphate (CMP)-sialic acid

1945

Figure 7. Enzymatic activity assays of immobilized GPRT proteins. The activities of the GPRT hydrogel and the vinylbenzyl-GPRT hydrogel were 0.37 and 0.87 nmol/min, respectively.

synthetase,41 and CMP kinase,42 which contain 35, 7, 4, 3, and 2 cysteine residues, respectively. Among these five proteins, only BSA was significantly immobilized (62.8%) into polyacrylamide hydrogels. All other proteins had around 13% immobilization efficiency or less. These data suggest that in the presence of 0.5% of free thiol competitor, only proteins containing large numbers of cysteines can be significantly immobilized through their cysteine residues, and proteins containing small numbers of cysteines are not efficiently immobilized. This indicates that modification of proteins with small numbers of cysteine residues using the vinylbenzyl group would be a much more efficient way to immobilize them into polyacrylamide hydrogels. Enzymatic Assay of Immobilized GPRT. To determine what effects the modification and immobilization of GPRT have on its enzymatic activity, we first assayed the enzymatic activity of the soluble forms of GPRT. The activity assays showed that modification of GPRT with the vinylbenzyl group had almost no effect on the specific activity of GPRT (11.6 µmol/min per mg vs 11.9 µmol/min per mg, respectively). Incubation of a GPRT solution with APS and TEMED in the absence of acrylamide resulted in the loss of some GPRT activity but 76% of the enzyme activity was retained (9.0 µmol/min per mg). This indicates that the polymerization conditions may damage the activity of GPRT, but not significantly. Next, we assayed the activity of immobilized forms of unmodified GPRT and vinylbenzyl-GPRT after electrophoresis. Both immobilized forms of the enzyme were able to catalyze the synthesis of GMP, but the activity of the vinylbenzyl-GPRT hydrogel was 2.4fold greater than the unmodified GPRT hydrogel (Figure 7). These data were consistent with the immobilization gel (Figure 5), in which about 2.1-fold more vinylbenzyl-GPRT was immobilized than GPRT. Compared to the soluble form of vinylbenzyl-GPRT, the immobilized vinylbenzyl-GPRT (2.9 µmol/min per mg) retained approximately 25% of its initial specific activity. One factor that can account for some of the loss of activity during hydrogel formation is the protein damage under APS/TEMED polymerization conditions noted above, nevertheless a significant fraction of the original GPRT enzymatic activity remains in the vinylbenzyl-GPRT hydrogel.

Conclusion We have developed an approach to site-selectively incorporate alkenes onto expressed proteins via native chemical ligation.

1946

Biomacromolecules, Vol. 10, No. 7, 2009

These alkene modified proteins can be utilized as polymerizable protein monomers for immobilization of proteins into polyacrylamide hydrogels. To incorporate alkenes into proteins via thioester ligation for subsequent copolymerization, it was necessary to strike a balance between alkene reactivity for free radical induced polymerization under mild conditions, and the stability of the alkenes to the free thiols that are found in thioester ligation reactions. Both 4-pentenoic acid thioester 1c and 4-vinylbenzoic acid thioester 1d were stable under thioester ligation conditions, and were used to site-selectively modify the N-termini of recombinant Protein G and GPRT. Though the pentenyl functionalized Protein G could not be immobilized through mild APS initiated free radical polymerization owing to the low reactivity of the R-olefin structure, the pentenyl functionalized proteins may be useful for other reactions such as olefin metathesis.43 The vinylbenzyl group proved to have good reactivity under mild APS initiated free radical polymerization, and vinylbenzyl functionalized Protein G and GPRT were both immobilized into polyacrylamide hydrogels via free radical induced copolymerization. Although proteins containing cysteines may be incorporated into polyacrylamide hydrogels directly through addition of cysteine to acrylamide, functionalizing proteins with the vinylbenzyl group was shown to be a much more efficient way for protein-acrylamide hydrogel formation. The vinylbenzyl-immobilized proteins produced in this manner retained biological activity as demonstrated by the binding of immobilized Protein G to antibody fragment IgG Fc, and the retention of enzymatic activity by immobilized GPRT. Thus, our approach to site-specific incorporation of alkenes into proteins to produce polymerizable protein monomers may lead to the development of potential applications for protein modification and protein-polymer conjugation. Proteinacrylamide copolymerization for protein-acrylamide hydrogel formation may also be utilized for construction of protein microarrays, enzyme recycling, and immunoassays. Acknowledgment. This work was supported by Indiana University. We thank Jonathan A. Karty and Angela M. Hansen for assistance in mass spectrometry. Supporting Information Available. Pentyl-Protein G immobilization gel, MS of alkylated GPRT, and immobilization gel data for the five sample proteins in Table 2. This material is available free of charge via the Internet at http://pubs.acs.org.

References and Notes (1) Kochendoerfer, G. G. Curr. Opin. Chem. Biol. 2005, 9, 555–560. (2) Heredia, K. L.; Maynard, H. D. Org. Biomol. Chem. 2007, 5, 45–53. (3) Yamamoto, Y.; Tsutsumi, Y.; Yoshioka, Y.; Nishibata, T.; Kobayashi, K.; Okamoto, T.; Mukai, Y.; Shimizu, T.; Nakagawa, S.; Nagata, S.; Mayumi, T. Nat. Biotechnol. 2003, 21, 546–552. (4) Shao, H.; Crnogorac, M. M.; Kong, T.; Chen, S. Y.; Williams, J. M.; Tack, J. M.; Gueriguian, V.; Cagle, E. N.; Carnevali, M.; Tumelty, D.; Paliard, X.; Miranda, L. P.; Bradburne, J. A.; Kochendoerfer, G. G. J. Am. Chem. Soc. 2005, 127, 1350–1351. (5) Basu, A.; Yang, K.; Wang, M.; Liu, S.; Chintala, R.; Palm, T.; Zhao, H.; Peng, P.; Wu, D.; Zhang, Z.; Hua, J.; Hsieh, M. C.; Zhou, J.; Petti, G.; Li, X.; Janjua, A.; Mendez, M.; Liu, J.; Longley, C.; Mehlig, M.; Borowski, V.; Viswanathan, M.; Filpula, D. Bioconjugate Chem. 2006, 17, 618–630. (6) Jackson, D. C.; O’Brien-Simpson, N.; Ede, N. J.; Brown, L. E. Vaccine 1997, 15, 1697–1705. (7) O’Brien-Simpson, N. M.; Ede, N. J.; Brown, L. E.; Swan, J.; Jackson, D. C. J. Am. Chem. Soc. 1997, 119, 1183–1188.

Xiao and Tolbert (8) Sadler, K.; Zeng, W.; Jackson, D. C. J. Pept. Res. 2002, 60, 150– 158. (9) Kantlehner, M.; Finsinger, D.; Meyer, J.; Schaffner, P.; Jonczyk, A.; Diefenbach, B.; Nies, B.; Kessler, H. Angew. Chem., Int. Ed. 1999, 38, 560–562. (10) Sheldon, R. A. AdV. Synth. Catal. 2007, 349, 1289–1307. (11) Arenkov, P.; Kukhtin, A.; Gemmell, A.; Voloshchuk, S.; Chupeeva, V.; Mirzabekov, A. Anal. Biochem. 2000, 278, 123–131. (12) Brueggemeier, S. B.; Kron, S. J.; Palecek, S. P. Anal. Biochem. 2004, 329, 180–189. (13) Brueggemeier, S. B.; Wu, D.; Kron, S. J.; Palecek, S. P. Biomacromolecules 2005, 6, 2765–2775. (14) Jonkheijm, P.; Weinrich, D.; Ko¨hn, M.; Engelkamp, H.; Christianen, P. C.; Kuhlmann, J.; Maan, J. C.; Nu¨sse, D.; Schroeder, H.; Wacker, R.; Breinbauer, R.; Niemeyer, C. M.; Waldmann, H. Angew. Chem., Int. Ed. 2008, 47, 4421–4424. (15) Jonkheijm, P.; Weinrich, D.; Schro¨der, H.; Niemeyer, C. M.; Waldmann, H. Angew. Chem., Int. Ed. 2008, 47, 9618–9647. (16) Gauthier, M. A.; Klok, H. A. Chem. Commun. 2008, 2591–2611. (17) van Hest, J. C. M.; Kiick, K. L.; Tirrell, D. A. J. Am. Chem. Soc. 2000, 122, 1282–1288. (18) Zhang, Z.; Wang, L.; Brock, A.; Schultz, P. G. Angew. Chem., Int. Ed. 2002, 41, 2840–2842. (19) Balan, S.; Choi, J. W.; Godwin, A.; Teo, I.; Laborde, C. M.; Heidelberger, S.; Zloh, M.; Shaunak, S.; Brocchini, S. Bioconjugate Chem. 2007, 18, 61–76. (20) Heredia, K. L.; Bontempo, D.; Ly, T.; Byers, J. T.; Halstenberg, S.; Maynard, H. D. J. Am. Chem. Soc. 2005, 127, 16955–16960. (21) Lele, B. S.; Murata, H.; Matyjaszewski, K.; Russell, A. J. Biomacromolecules 2005, 6, 3380–3387. (22) Liu, J.; Bulmus, V.; Herlambang, D. L.; Barner-Kowollik, C.; Stenzel, M. H.; Davis, T. P. Angew. Chem., Int. Ed. 2007, 46, 3099–3103. (23) Dawson, P. E.; Muir, T. W.; Clark-Lewis, I.; Kent, S. B. Science 1994, 266, 776–779. (24) Muir, T. W.; Sondhi, D.; Cole, P. A. Proc. Natl. Acad. Sci. U.S.A. 1998, 95, 6705–6710. (25) van Baal, I.; Malda, H.; Synowsky, S. A.; van Dongen, J. L.; Hackeng, T. M.; Merkx, M.; Meijer, E. W. Angew. Chem., Int. Ed. 2005, 44, 5052–5057. (26) Woulfe, S. R.; Miller, M. J. J. Org. Chem. 1986, 51, 3133–3139. (27) Tolbert, T. J.; Wong, C. H. Angew. Chem., Int. Ed. 2002, 41, 2171– 2174. (28) Fan, M.; Bigsby, R. M.; Nephew, K. P. Mol. Endocrinol. 2003, 17, 356–365. (29) Keough, D. T.; McConachie, L. A.; Gordon, R. B.; de Jersey, J.; Emmerson, B. T. Clin. Chim. Acta 1987, 163, 301–308. (30) Yuan, L.; Craig, S. P., III.; McKerrow, J. H.; Wang, C. C. Biochemistry 1992, 31, 806–810. (31) Xiao, J.; Burn, A.; Tolbert, T. J. Bioconjugate Chem. 2008, 19, 1113– 1118. (32) Gill, S. C.; von Hippel, P. H. Anal. Biochem. 1989, 182, 319–326. (33) de Souza Dantas, D.; Ramos Dos Santos, C.; Guimara˜es Pereira, G. A.; Medrano, F. J. Biochim. Biophys. Acta 2008, 1784, 953–960. (34) Sjobring, U.; Bjorck, L.; Kastern, W. J. Biol. Chem. 1991, 266, 399– 405. (35) Sauer-Eriksson, A. E.; Kleywegt, G. J.; Uhlen, M.; Jones, T. A. Structure 1995, 3, 265–278. (36) Pardowitz, I.; Ehrhardt, W.; Neuhoff, V. Electrophoresis 1990, 11, 400–406. (37) Syrovy´, I.; Hodny´, Z. J. Chromatogr. 1991, 569, 175–196. (38) Furuike, T.; Nishi, N.; Tokura, S.; Nishimura, S.-I. Macromolecules 1995, 28, 7241–7247. (39) Vos, S.; de Jersey, J.; Martin, J. L. Biochemistry 1997, 36, 4125– 4134. (40) Kudo, H.; Sanda, F.; Endo, T. Macromolecules 1999, 32, 8370–8375. (41) Yu, H.; Yu, H.; Karpel, R.; Chen, X. Bioorg. Med. Chem. 2004, 12, 6427–6435. (42) Bucurenci, N.; Sakamoto, H.; Briozzo, P.; Palibroda, N.; Serina, L.; Sarfati, R. S.; Labesse, G.; Briand, G.; Danchin, A.; Baˆrzu, O.; Gilles, A. M. J. Biol. Chem. 1996, 271, 2856–2862. (43) Lin, Y. A.; Chalker, J. M.; Floyd, N.; Bernardes, G. J.; Davis, B. G. J. Am. Chem. Soc. 2008, 130, 9642–9643.

BM900339Q