Systematic Analysis of Lysine Acetylation in the Halophilic Archaeon

Subscriber access provided by UNIVERSITY OF THE SUNSHINE COAST

Article

Systematic Analysis of Lysine Acetylation in the Halophilic Archaeon Haloferax mediterranei Jingfang Liu, Qian Wang, Xiongjian Jiang, Haibo Yang, Dahe Zhao, Jing Han, Yuanming Luo, and Hua Xiang J. Proteome Res., Just Accepted Manuscript • DOI: 10.1021/acs.jproteome.7b00222 • Publication Date (Web): 01 Aug 2017 Downloaded from http://pubs.acs.org on August 1, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Journal of Proteome Research is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Proteome Research

Systematic Analysis of Lysine acetylation in the halophilic archaeon Haloferax mediterranei

Jingfang Liu1†, Qian Wang3†, Xiongjian Jiang1,2, Haibo Yang1,2, Dahe Zhao1,2, Jing Han1, Yuanming Luo1, Hua Xiang1,2*

State Key Laboratory of Microbial Resources, Institute of Microbiology, Chinese Academy of Sciences, Beijing, China1; College of Life Sciences, University of Chinese Academy of Sciences, Beijing,China2; Core Facility of Institute of Microbiology, Chinese Academy of Sciences, Beijing, China3. †These authors contributed equally to this article. * Corresponding author. E-mail address: [email protected]; Tel/Fax: 86-10-64807472

1

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT Lysine acetylation is a reversible and highly regulated post-translational modification that plays a critical role in regulating many aspects of cellular processes, both in bacteria and in eukaryotes. However, this modification has not been systematically studied in archaea. Herein, we report the lysine acetylome of a model haloarchaeon, Haloferax mediterranei. Using immunoaffinity enrichment and LC-MS/MS analysis, we identified 1017 acetylation sites in 643 proteins, accounting for 17.3% of the total proteins in this haloarchaeon. Bioinformatics analysis indicated that lysine acetylation mainly distributes in cytoplasm (94%) and participates in protein biosynthesis and carbon metabolism. Specifically, the acetylation of key enzymes in PHBV biosynthesis further suggested that acetylation plays a key role in the energy and carbon storage. In addition, a survey of the acetylome revealed a universal rule in acetylated motifs: a positively charged residue (K, R, or H) located downstream of acetylated lysine at the positions +1, +2, or +3. Interestingly, we identified acetylation in several replication initiation proteins Cdc6, mutation on the acetylated site of Cdc6A destroyed the Autonomous Replication Sequence (ARS) activity of its adjacent origin oriC1. Our study indicates that lysine acetylation is an abundant modification in H.mediterranei, and plays key roles in the processes of replication, protein biosynthesis, central metabolism, and carbon storage. This acetylome of H.mediterranei provides opportunities to explore the physiological role of acetylation in halophilic archaea. KEYWORDS: Lysine acetylation, acetylome, acetylated lysine motif, interaction

2


Page 2 of 48

Page 3 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


network, PHBV, Cdc6, Haloferax mediterranei INTRODUCTION Post-translational modifications (PTMs) play an important role in regulating the structure and function of proteins in different species. To date, more than 400 PTMs have been reported1. Lysine acetylation was first discovered in eukaryotic histones half a century ago2, and it is a dynamic and reversible PTM catalyzed by acetyltransferases and deacetylases3. This PTM occurs when an acetyl group of acetyl-coenzyme A (acetyl-CoA) is transferred to the ε-amino group of internal lysine residues. For a long time, studies of this PTM focused on the acetylation of histones and other nuclear regulators until lysine acetylation was identified in non-histone proteins, such as p53 and α-tubulin4, 5. The discovery of additional non-histone acetylated proteins indicates that lysine acetylation is a widespread PTM occurring not only in nuclei but also in the cytoplasm, mitochondria and other cellular compartments and is involved in many aspects of cellular processes6-8. Therefore, lysine acetylation has received more attention in recent years due to its crucial regulatory role in many cellular processes and has been considered as a rival of phosphorylation9. Breakthroughs in the high-resolution mass spectrometry (MS)-based proteomics and high-affinity purification of acetylated peptides make it possible to survey this modification in proteomics10, 11.The first acetylome was reported by Kim and his colleagues, who identified 388 acetylated sites in 195 proteins in HeLa cells and mouse liver mitochondria7. Till now, large-scale proteomic studies of lysine

3



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

acetylation have been performed in eukaryotes, such as human6, drosophila12, yeast13, etc., and several model organisms of bacteria14-19. These proteomic data demonstrate that the regulatory scope of lysine acetylation is involved in many aspects of cellular processes such as chromatin remodeling, cell cycle, mRNA splicing, transcription, etc.6, 7. Especially, lysine acetylation plays important regulatory roles in the activity of metabolic enzymes and in the coordination of different metabolic pathways both in bacteria and eukaryotes8,

17

.The increasing comprehensive so-called “acetylome”

studies show that lysine acetylation is evolutionarily conserved from bacteria to humans. In stark contrast to eukaryotes and bacteria, there are just a few reports about lysine acetylation in archaea. The Halobacterium salinarum 2Fe-2S ferredoxin, which was monoacetylated on lysine 118 near the C-terminus, was the first acetylated protein reported in archaea20. Later, a conserved chromatin protein Alba from a thermophilic archaeon, Sulfolobus solfataricus, was also identified as the target of acetylation, which could be deacetylated by an archaeal Sir2 homolog, thereby mediating transcriptional repression21. In 2009, three acetyltransferases belonging to the Gcn5 family (Pat1, Pat2, and Elp3) and two deacetylases (Sir2 and HdaI) were identified in Haloferax volcanii. Genetic evidence indicated that acetylation and deacetylation are important for haloarchaeal species22. However, the large-scale identification of acetylation proteins has not been performed in archaea. Haloferax mediterranei, an extremely halophilic archaeon, exhibits versatile metabolic and physiological features, such as polyhydroxyalkanoate (PHA)

4


Page 4 of 48

Page 5 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


biosynthesis23, nitrate reduction24, gas vesicle formation, etc.25, 26. Thus, this species has been used as a good model for haloarchaeal physiology and metabolism studies for several decades23, 27-30. The complete genome sequence of this haloarchaeon was reported in 2012 by our group31. Bioinformatics analysis reveals eleven Gcn5 family acetyltransferases and two deacetylases, including five homologous proteins that were identified in H. volcanii. While PHAs are deposited as carbon and energy materials by many

bacteria

H.mediterranei

and can

haloarchaea typically

under

unbalanced

accumulate

poly(3-hydroxybutyrate-co-3-hydroxyvalerate)

one

(PHBV),

nutrients type from

conditions32, of

acetyl-CoA

PHA, and

propionyl-CoA33, 34. It is noteworthy that all lysine acetyltransferases (KATs) use acetyl-CoA as an acetyl group donor35-37, thus acetylation may play a regulatory role in carbon metabolism and PHBV biosynthesis in H. mediterranei. Here, we report the first proteome-wide analysis of lysine acetylation in H. mediterranei. Our results indicate that lysine acetylation is an abundant PTM in this haloarchaeon. A total of 1017 lysine acetylation sites were identified, corresponding to 643 lysine-acetylated proteins. In addition to those metabolic enzymes that are involved in glycolysis and the tricarboxylic acid (TCA) cycle as previously reported substrates of lysine acetylation7,

8, 17, 19

, we also found the lysine acetylation occurs in many other

biological process, such as transcription and replication, the mutation of acetylated site in replication initiation protein Cdc6A destroyed the ARS activity of its adjacent origin oriC1. It is noteworthy that the key enzymes related to PHBV biosynthesis (PhaAα, BktBα, PhaE) and major structural protein of PHA granules (PhaP) are also

5



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

acetylated. The widespread identification of lysine acetylation has provided novel insights into the physiological mechanism of H. mediterranei responding to extremely halophilic environment. MATERIALS AND METHODS Strains and Culture Conditions In order to investigate the lysine acetylation in the process of PHBV production, H. mediterranei wild-type strain was first cultivated in 50 ml of nutrient-rich medium (AS-168) until the mid-exponential growth phase38, then, 4% (v/v) inoculums were transferred to 150 ml of MG medium (200 g of NaCl, 20 g of MgSO4·7H2O, 2 g of KCl, 2 g of NH4Cl, 375 mg of KH2PO4, 5mg of FeSO4·7H2O, 0.036 mg of MnCl2·4H2O, 1 g of yeast extract,1 g of sodium glutamate,15 g of PIPES, and 10 g of glucose per liter [pH 7.2]) for PHBV accumulation. The culture conditions were 37°C in shake flasks at a speed of 200 rpm. The cells were cultured for about 18h (until mid-exponential growth phase) and then the protein sample was prepared. The cell density of the cultures was monitored by measuring the optical density at 600 nm (OD600). Protein Preparation and Western Blotting Analysis Cells were harvested for protein sample preparation, then transferred to 5 mL centrifuge tube and sonicated for three times on ice using a high intensity ultrasonic processor (Scientz, Ningbo, China ) in lysis buffer (8 M urea, 1% Triton-100, 65 mM DTT and 0.1% Protease Inhibitor Cocktail). The remaining debris was removed by centrifugation at 20,000g at 4 °C for 10 min. Finally, the protein was precipitated with

6


Page 6 of 48

Page 7 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


cold 15% TCA for 2h at -20 °C. After centrifugation at 4 °C for 10 min, the supernatant was discarded. The remaining precipitate was washed with cold acetone for three times. The proteins were redissolved in buffer (8 M urea, 100 mM NH4HCO3, pH 8.0) and the protein concentration was determined with 2-D Quant kit (GE Healthcare, Piscataway, USA) according to the manufacturer’s instructions. Western blotting assay was performed with 30µg protein lysates separated by 12% SDS-PAGE. After transferred to PVDF membrane (Cat.No.162-0177, Bio-Rad Laboratories, Hercules, USA), the PVDF was soaked in confining liquid (1% tween-20 and 3% nonfat milk powder in PBS). Acetylated lysines were detected using pan anti-acetyl antibodies (PTM Biolabs, Hangzhou, China) diluted in blocking buffer (5% nonfat milk) at 1:1,000. After incubation overnight at 4℃, PVDF were washed by

PBST

and

incubated

with

(HRP)-conjugated

Goat

anti-mouse

antibody(Cat.No.31430, ThermoFisher Scientific, Pierce, Rockford, IL, USA)in 1:10000 dilution, and then detected by chemiluminescene (ECL) reagent (Cat.No. E411-04, Vazyme Biotech, Nanjing, China). Tryptic Digestion and HPLC Fractionation For digestion, the protein solution was reduced with 10 mM DTT for 1 h at 37 °C and alkylated with 20 mM IAA (iodoacetamide) for 45 min at room temperature in darkness. For trypsin digestion, the protein sample was diluted by adding 100 mM NH4HCO3 to urea concentration less than 2M. Finally, trypsin was added at 1:50 trypsin-to-protein mass ratio for the first digestion overnight and 1:100 trypsin-to-protein mass ratio for a second 4-h digestion.

7



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

The sample was then fractionated into fractions by high pH reverse-phase HPLC using C18 column (Betasil C18, 5 µm particles, 10 mm ID × 250 mm, ThermoFisher Scientific, Waltham, USA). Briefly, peptides were first separated with a gradient of 2% to 60% acetonitrile in 10 mM ammonium bicarbonate pH 10 over 80 min into 80 fractions, Then, the peptides were combined into 6 fractions and dried in a SpeedVac. Immunoaffinity Enrichment and LC-MS/MS Analysis To enrich K[Ac] peptides, tryptic peptides dissolved in NETN buffer (100 mM NaCl, 1 mM EDTA, 50 mM Tris-HCl, 0.5% NP-40, pH 8.0) were incubated with pre-washed antibody beads (PTM Biolabs, Hangzhou, China) at 4°C overnight with gentle shaking. The beads were washed four times with NETN buffer and twice with ddH2O. The bound peptides were eluted from the beads with 0.1% TFA. The eluted fractions were combined and vacuum-dried. The resulting peptides were dissolved in 0.1% TFA and cleaned with C18 ZipTips (Merck Millipore, Darmstadt, Germany) according to the manufacturer’s instructions, then, the sample was subjected to LC-MS/MS analysis. The peptides were directly loaded onto a reversed-phase analytical column (Acclaim Pepmap C18 RSLC, 5 µm particles, 50 µm ID × 150 mm, ThermoFisher Scientific, Waltham, USA). The gradient was comprised of an increase from 6% to 22% solvent B (0.1% TFA in 98% ACN) for 26 min, 22% to 35% for 8 min and climbing to 80% in 3 min then holding at 80% for the last 3 min, all at a constant flow rate of 350nL/min on an EASY-nLC 1000 UPLC system. Later, the peptides were subjected to NSI source followed by tandem mass spectrometry (MS/MS) in Orbitrap FusionTM TribridTM (ThermoFisher

8


Page 8 of 48

Page 9 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Scientific, Waltham, USA) coupled online to the UPLC. Intact peptides were detected in the Orbitrap at a resolution of 60,000. Peptides were selected for MS/MS using NCE setting as 35 and ion fragments were detected in the Orbitrap at a resolution of 15,000. A data-dependent procedure that alternated between one MS scan followed by 20 MS/MS scans was applied for the top 20 precursor ions above a threshold intensity greater than 5E3 in the MS survey scan with 15.0 s dynamic exclusion. Mass window for precursor ion selection was set as 1.6 m/z, ions with charge state 2-7 were allowed for fragmentation in mass spectrometers. The electrospray voltage applied was 2.0 kV. Automatic gain control (AGC) was used to prevent overfilling of the Orbitrap; 5E4 ions were accumulated for generation of MS/MS spectra. For MS scans, the m/z scan range was 350 to 1550. Fixed first mass was set as 100 m/z. Database searching The resulting MS/MS data was processed using MaxQuant with integrated Andromeda search engine (v.1.5.2.8). Tandem mass spectra were searched against Uniprot H. mediterranei database (2016/12, 3848 sequences) concatenated with reverse decoy database. Trypsin/P was specified as cleavage enzyme allowing up to 4 missing cleavages and 5 modifications per peptide. Mass error was set to 10 ppm for precursor ions and 0.02 Da for fragment ions. Carbamidomethylation on Cys was specified as fixed modification and oxidation on Met, acetylation on Lysine and on N-terminal of protein were specified as variable modifications. False discovery rate (FDR) thresholds for protein, peptide and modification site were specified at 1%. Minimum peptide length was set at 7. All the other parameters in MaxQuant were set

9



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 48

to default values. The site localization probability was set as > 0.75. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium (http:// proteomecentral.proteomexchange.org) via the PRIDE39 partner repository with the dataset identifier PXD006211. Evolutionarily conservative analysis To determine the degree of evolutionary conservation of acetylation, BLASTP was used to compare acetylated protein sequences of H. mediterranei against protein sequences of S.cerevisiae and E. coli in UniProtKB (http://www.uniprot.org/). By applying a reciprocal best BLAST hit approach, the orthologous proteins were determined among these species. GO/KEGG Annotation The Gene Ontology (GO) annotation was derived from the UniProt-GOA database (www. http://www.ebi.ac.uk/GOA/). Firstly, the identified protein ID was converted to UniProt ID and then mapped to GO IDs. If some identified proteins were not annotated

by

UniProt-GOA

database,

the

InterProScan

software

(http://www.ebi.ac.uk/interpro/) would be used to annotated protein’s GO function based on protein sequence alignment method. Then proteins were classified by GO annotation (http://www.geneontology.org/) based on categories: biological process and molecular function. Kyoto Encyclopedia of Genes and Genomes (KEGG, http://www.genome.jp/kegg/) database was used to annotate protein pathway, which connects known information on molecular interaction networks, such as pathways and complexes information about

10


Page 11 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


genes and proteins, including metabolism, genetic information processing, environmental information processing, cellular processes, and so on. First, we used KEGG online service tools KAAS (http://www.genome.jp/tools/kaas/) to annotate protein’s KEGG database description, then the annotation result was mapped on the KEGG pathway database using KEGG online service tools KEGG mapper (http://www.genome.jp/kegg/tool/map_pathway2.html). GO/KEGG Pathway Functional Enrichment Analysis We used Fisher’s exact test for the GO and KEGG pathway functional category enrichment of the resulting protein clusters. We selected 0.05 as the cut-off P-value and Benjamini correction as the control of false discovery rates40. Any terms with p-values of less than 0.05 in any of the clusters were considered significant. Subcellular Localization Both the cells of eukaryotic organisms and prokaryotes have their elaborate subcellular localizations according to their functions of distinct constituents. Here, we used CELLO (http://cello.life.nctu.edu.tw/), a subcellular localization predication web-server to predict subcellular localization. Model of Sequences Surrounding Acetylation Sites The model of the sequences surrounding the acetylation sites was determined using the Motif-X (http://motif-x.med.harvard.edu/motif-x.html) software, by which the amino acids in specific positions of acetyl-21-mers (10 amino acids upstream and downstream of the acetylation site) were analyzed in all of the protein sequences. The occurrence was set as 5 and 0.00025 was set as the threshold of significance. In

11



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

addition, all of the database protein sequences were taken as the background database parameters.

Enrichment of protein domain analysis For each category proteins, InterPro (http://www.ebi.ac.uk/interpro/, a resource that provides functional analysis of protein sequences by classifying them into families and predicting the presence of domains and important sites) database was researched and a two-tailed Fisher’s exact test was employed to test the enrichment of the identified protein against all database proteins. Correction for multiple hypothesis testing was carried out using standard false discovery rate control methods and domains with a corrected p-value < 0.05 were considered significant. Protein-Protein Interaction Analysis The protein-protein interactions for the identified acetylated proteins were analyzed against the STRING database version 10.0 (http://www.string-db.org/).We selected H. volcanii DS2 （ http://www.uniprot.org/uniprot/?query=taxonomy:309800 ） as the database searched organism for its high identity and coverage to H.mediterranei. Only interactions between the proteins belonging to the searched dataset were selected, thereby excluding external candidates. STRING defines a metric called “confidence score” to define interaction confidence, we fetched all interactions that had a confidence score ≥ 0.7 (high confidence). Interaction network from STRING was visualized in Cytoscape, and MCODE (Molecular Complex Detection), a Cytoscape plug-in using graph theoretical clustering algorithm, was employed to finds clusters (highly interconnected regions) in a network. 12


Page 12 of 48

Page 13 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Autonomous replication ability assay The Autonomous replication sequence (ARS) assay experiments were performed as previously described, with some modifications41. The target fragment oriC1-cdc6A or its mutation was amplified and cloned into the non-replicating plasmid pHFX42, which could not be replicated in H. mediterranei unless an ARS was inserted. To avoid integration of the plasmids into the chromosome, the resulting plasmids were transferred into H. mediterranei strains (pyrF-) with the oriC1-cdc6A fragment deleted. If the fragment oriC1-cdc6A could confer autonomous replication to the plasmid pHFX with a pyrF selection marker gene, the transformants could be obtained on an AS-168SY (AS-168 medium without yeast extract) plate. RESULTS AND DISCUSSION Identification of Lysine Acetylation in H. mediterranei The genome of H. mediterranei has been sequenced in our laboratory, which facilitated the proteome-wide analysis of their lysine acetylation proteins. To characterize the protein modification level of lysine acetylation in H. mediterranei, we conducted western blotting analysis with a pan anti-acetyl antibody (PTM Biolabs， Hangzhou, China) and detected many protein bands spanning a wide range (Figure 1A), which suggested that acetylation was widespread in H.mediterranei. To determine the protein acetylome of H. mediterranei, the anti-acetyl lysine antibody beads (PTM Biolabs, Hangzhou, China) was used to enrich acetyllysine-containing peptides in whole-cell protein tryptic digests, which were then separated and analyzed by LC-MS/MS. The MS data validation (Figure S1) showed that the distribution of

13



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

mass error was near zero and most of them are less than 5 ppm, this indicated that the mass accuracy of the MS data fitted the requirement (Figure S1A). The length of most peptides distributed between 7 and 20 amino acids (Figure S1B, Supplementary Table S2), which agrees with the property of tryptic peptides. The resulting tandem mass spectral data were searched against H. mediterranei Uniprot Proteome database with MaxQuant software. We identified a total of 1017 acetylated sites on 643 proteins (Supplementary Table S1), which contained 1-7 different lysine acetylated sites individually (Figure 1B). Approximately 66.25% of the identified proteins carried only one lysine acetylation site, and 19.6% contained two acetylated sites (Supplementary Table S3). We found that most of proteins containing more than 2 acetylated sites were ribosomal subunits and their genes are located in a cluster, for example, HFX_2570-2573, HFX_2582-2588 and HFX_2792-2794 (Supplementary Table S1). Moreover, some proteins related to peptide chain release (HFX_0307) and elongation (HFX_0346) contained 4 or 6 acetylated sites (Supplementary Table S1). High level of acetylation of ribosome and translational factors suggested that acetylation would participate in the regulation of ribosome function and protein biosynthesis. As the first large-scale acetylome in archaea, it is noteworthy that the acetylated proteins account for 17.3% of the total 3718 proteins in this haloarchaeon. Compared with the acetylome of bacteria, in which the percentage of identified acetylated proteins of the total proteins in each bacterium varies from 2.1% in Escherichia coli to 13.6% in Vibrio parahemolyticus15-19, 43, it is obvious that lysine acetylation is

14


Page 14 of 48

Page 15 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


relatively abundant in H. mediterranei, which may be attributed to its containing of 11 acetyltransferases, and implied that acetylation may be involved in regulation of many physiological processes in H. mediterranei. Evolutionarily conservative analysis of acetylated proteins between H. mediterranei and other species In order to investigate whether these acetylated proteins identified from H. mediterranei were evolutionarily conserved among all three domains of life, we compared the acetylome of H. mediterranei with those of yeast and E.coli13, 19, taking them as model species of eukaryotes and bacteria respectively. Among the 643 acetylated proteins, 109 proteins had orthologs in the acetylome of yeast (Saccharomyce scerevisiae), while, 66 proteins had orthologs in the acetylome of E.coli (Figure 2A, B, Supplementary Table S4). Moreover, there were 30 proteins shared by these three species and 79 overlap proteins between yeast and E.coli (Figure 2C, Supplementary Table S4, S5). These results showed that H. mediterranei shared 10.2% orthologs of acetylated proteins with yeast and 19.6% with E.coli. The acetylome profile of H. mediterranei exhibited greater similarity with E. coli. than with yeast (S. cerevisiae). Functional Characterization and Subcellular Location of the Lysine Acetylome of H. mediterranei To better understand the lysine acetylome in H. mediterranei, the acetylated proteins were classified into different groups according to biological process and molecular function based on Gene Ontology (GO) annotation (Figure 3A, B and Supplementary

15



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Table S6). As shown in Figure 3, in the classification of biological process, metabolic process ranked the highest ratio for 41% (Figure 3A), the cellular process and single-organism process constituted 28% and 19% respectively. When assigned by molecular function, the largest group was composed of catalytic activity, the number of proteins in this group was approximately 48% of all of the identified acetylated proteins (Figures 3B), which was consistent with the result that metabolic process was the largest group of biological process. The binding made up the second group of acetylated proteins in the classification of molecular function, which accounted for 41% of the total acetylated proteins (Figure 3B). This is similar to that of V. parahemolyticus16, indicating that the function of lysine acetylation in the regulation of molecular function is conserved from bacteria to archaea. The investigation of the subcellular location shows that most acetylated proteins were distributed in the cytoplasm (94%), and 28 proteins were located in the cytoplasmic membrane (4%). Only 10 acetylated proteins located in extracellular region (Figure 3C and Supplementary Table S7).This analysis of subcellular location showed that, albeit belonging to a different domain, H.mediterranei shared the similar subcellular locations with those of acetylated proteins identified in bacteria. For example, there are 87.95% and 60% acetylated proteins located in cytoplasm in V. parahemolyticus and E. coli respectively16, 19.This result was consistent with the classification results according to cellular process and molecular function in the GO analysis. Functional Enrichment of Lysine Acetylome of H. mediterranei

16


Page 16 of 48

Page 17 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Furthermore, the significance of functional enrichment was investigated to reveal the main process regulated by acetylation in different GO functional classification (Figure 3D and Supplementary Table S8). The enrichment analysis based on molecular function showed that functions related to the binding of nucleoside, nucleotide and ribosome structure were enriched, which included structural constituent of ribosome, RNA and rRNA binding, nucleoside and ribonucleoside binding, purine nucleotide and purine ribonucleotide binding and structural molecular activity (Top half of Figure 3D). Consistent with that molecular function related to ribosome was enriched, in the enrichment of biological process, the processes associated with amide biosynthesis, peptide biosynthesis, translation, peptide metabolism and cellular amide metabolism showed higher tendency to be acetylated. The other biological processes enriched included organonitrogen compound metabolism and biosynthesis, cellular macromolecule metabolism and biosynthesis, protein metabolism, gene expression, cellular protein metabolism and organic substance biosynthesis (Bottom half of Figure 3D). The GO enrichment analysis of the acetylome indicated that lysine acetylation is a widespread modification and plays key regulatory roles in cellular processes and molecular function in H. mediterranei. As we can see, the structural constituent of ribosome and the process related to peptide biosynthesis and translation were enriched in the GO enrichment, which was further revealed by KEGG pathway enrichment. In the KEGG pathway enrichment, 9 acetylated ribosome proteins were identified, they belonged to large or small subunits respectively (Figure S2 A, B and Supplementary Table S9).

17


These results further


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

suggested that the protein biosynthesis was regulated by lysine acetylation in H. mediterranei. Another significantly enriched pathway was purine metabolism. Ten acetylated proteins were mapped to this pathway (Supplementary Table S9). As shown in Figure S2 C, these metabolic enzymes were linked to different metabolic pathway, such as pentose phosphate pathway, alanine, aspartate and glutamate metabolism, histidine metabolism and so on. This enrichment result implied that lysine acetylation may affect different metabolic pathways by regulating purine metabolism. Based on protein domain enrichment analysis, 18 kinds of domains were enriched. As shown in Figure 3E and Supplementary Table S10, 7 domains were related to ATP/GTP/AMP binding/grasp, P-loop and ATPase domains that were responsible for hydrolysis of nucleoside triphosphate. OB-fold and C-terminal of Cdc6 were nucleic acid-binding domains. The other enriched domains included anticodon-binding domain, aminoacyl-tRNA synthetase domain, FAD/NAD (P)-binding domain, aspartate decarboxylase-like domain and NADP-dependent oxidoreductase. From these enriched protein domains, we can see that those proteins containing domains related to energy metabolism were preferred to be acetylated. Which is consistent with its role suggested by Wang et al. that acetylation can sense cellular energy status and modulate the metabolism17. Analysis of Acetylated Lysine Motifs The preferences of amino acid residues surrounding the lysine acetylation sites have been investigated in several eukaryotic and bacterial cells7, 15, 16, 18, 44-46. To investigate

18


Page 18 of 48

Page 19 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


whether the characteristics of acetylated lysine in haloarchaea are different, we also performed a motif analysis of the sequences around the identified lysine acetylated sites using the Motif-X program, a software that could extract the overrepresented patterns from any set of sequences16. The amino acid sequence from the −10 to the +10 positions surrounding the acetylated lysine were analyzed, and eight definitively conserved motifs were identified (Figure 4 and Supplementary Table S11) in 703 acetylated peptides, named K[Ac]R, K[Ac]*R, K[Ac]K, K[Ac]H, K[Ac]S, K[Ac]**R, K[Ac]N and K[Ac]*K (Figure 4A)(K[Ac] indicates the acetylated lysine, and * indicates a random amino acid residue). Among these motifs, the K[Ac]R motif was most conserved, the number of acetylated peptides with this motif was 227, accounting for 32% of all identified acetylated peptides. The other three kinds of domains K[Ac]*R, K[Ac]K and K[Ac]S were identified in 41% acetylated peptides (Figure 4C and Supplementary Table S11). This result suggested that these four kinds of domains (K[Ac]R, K[Ac]*R, K[Ac]K and K[Ac]S ) were the main recognized substrates of acetyltransferases in H. mediterranei. A survey of these motifs revealed that most of the motifs share a common feature: a positively charged residue, including lysine (K), arginine (R) and histidine (H), occurred at different position (+1, +2, +3) of downstream of acetylated lysine. The frequency of K and R in different positions was determined by an inspection of the heat map (Figure 4B). Only two motifs contained serine (S) and asparagine (N) at the +1 position. It was reported that the alkaline residues were typical residues frequently observed in the acetylated motifs identified in bacteria and eukaryotes, for example,

19



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

the conserved motif K[Ac]****K, K[Ac]***K and K[Ac]H were also observed in human cells44, 47, 48, K[Ac]**K in rat49, K[Ac]****K and K[Ac]H in V. parahemolyticus16, K[Ac] ***R, K[Ac]H, K[Ac]Y, K[Ac]****K , K[Ac]***K and K[Ac]****R in Mycobacterium tuberculosis50, K[Ac]****K, K[Ac]***K, K[Ac]***R, K[Ac]H in Candida albicans46. These results suggested that the recognized specificity of acetyltransferases from three life domains are conserved, they preferred to recognize motifs containing positively charged residue downstream of acetylated lysine. But the positively charged residue always located at the +1,+2 and +3 position in H.mediterranei, while in eukaryotes and bacteria, these residues occurred more frequently at +4, +5 and +6 positions, which implied that the acetyltransferases in H.mediterranei also had their own recognized specificity besides the common feature of positively charged residues. Analysis of Protein Interaction Networks of Acetylated Proteins in H. mediterranei Protein-interaction network analysis has been carried out extensively not only to understand the high throughput data of proteomics in recent years, but also to investigate the function of acetylated proteins in different biological processes6, 16, 19. To better understand the cellular processes that are regulated by acetylation in H.mediterranei, we analyzed the protein-protein interaction for all identified acetylated proteins using STRING software. Because there is no information about H.mediterranei in the STRING database, we blasted all 3718 proteins of H.mediterranei against H.volcanii DS2 in STRING. Among the 643 acetylated proteins, H.mediterranei shared 551 homologous proteins with H. volcanii, and a

20


Page 20 of 48

Page 21 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


global network graph was obtained with 354 acetylated proteins as nodes (Figure S3 and Supplementary Table S12-13), which were connected by 3071 direct physical interactions obtained from the STRING database with a combined score higher than 0.70. As shown in Figure 5, four highly interconnected subnetworks of acetylated proteins were obtained in different categories of cellular functions and biological processes, such as ribosome, basal transcription factors and metabolic pathways. 53 acetylated proteins involved in the ribosome were connected in a relatively high dense protein-protein interaction network, in which 8 acetylated proteins associated with translation initiation and elongation were also found as the nodes of this interaction network (Figure 5A). In eukaryotes and bacteria, the acetylated proteins in ribosome and protein biosynthesis have also shown a dense protein interaction network6, 16, 19

.These results indicated that lysine acetylation modification played conserved

regulatory roles in the function of ribosome and protein biosynthesis from prokaryotes to eukaryotes. In addition, the RNA polymerase subunit (RpoE1, HFX_1990; RpoM1, shown as C439_03183 in Figure 5B, HFX_1461), the general transcription factors (TBP1, 3 and TFB5, 7) and DNA helicase (Ssl2, DinG) also comprised a highly dense protein interaction network (Figure 5B). The other two subnetworks were related to metabolic pathways. The first one was mainly constituted by the proteins of TCA cycle and some molecular chaperone proteins (BM92_08560, ThsA, HFX_0142; BM92_07150, ThsB, HFX_0422; C439_06780, ThsA, HFX_0738) (Supplementary TableS12 and Figure 5C). The

21



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 48

enzymes mainly related to aspartate metabolism were revealed in another subnetwork (AvtA, HFX_1659; ArgG, HFX_0050; AsnB, HFX_1049; PurA, HFX_1140; PyrI, HFX_1520), and the glutamate dehydrogenase (GdhA1, HFX_2178) was also found in this subnetwork (Supplementary Table S12 and Figure 5D).

The subnetwork

graph of acetylated proteins in TCA cycle was also determined in V. parahemolyticus16, and the acetylation of enzymes in TCA cycle was conserved from eukaryotes to prokaryotes. However, the subnetwork of enzymes involved in the metabolism of aspartate was reported for the first time, further study was needed to investigate the role of acetylation in the metabolism of aspartate. Acetylated Proteins in the PHBV Biosynthetic Pathway The research in our laboratory demonstrated that H.mediterranei can specifically accumulate PHBV as a storage form of carbon and energy51, and it is biosynthesized from acetyl-CoA and propionyl-CoA33, 34. Most of the enzymes directly involved in PHBV biosynthesis have been experimentally identified in H. mediterranei52-56. In this research, we identified the acetylation of key enzymes in PHBV biosynthesis, including

PHA-specific

PHA-specific

beta-ketothiolase

beta-ketothiolase

α

α

subunit

subunit

(PhaAα,

(BktBα,

HFX_1023),

HFX_6004)

and

poly(3-hydroxyalkanoate) synthase subunit (PhaE, HFX_5220)(Figure 6 and Supplementary Table S1). In this PHBV synthesis pathway, both PhaA and BktB can catalyze the condensation of two acetyl-CoA molecules to generate acetoacetyl-CoA, while only BktB is responsible for the condensing one acetyl-CoA and one propionyl-CoA to 3-ketovaleryl-CoA, specifically. In addition, both PhaAα and

22


Page 23 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


BktBα were the catalytic subunits and determined substrate specificities of BktB and PhaA, respectively56. As the subunit of PHA synthase (PhaEC), we have demonstrated that the deacetylation of PhaE decreased the PHA synthesis from glucose metabolism57. In addition, the major structural protein (PhaP, HFX_5219)38 of PHA granules was also the substrate of acetylation (Supplementary Table S1). The acetylation of proteins related to PHBV biosynthesis suggests that acetylation has participated in the regulation of carbon deposition and utilization in H. mediterranei. Acetylation of Replication Initiation Protein Cdc6 The acetylation of replication initiation protein has been identified in E.coli and human cells58-60. In E.coli, the acetylation in conserved Walker A motif of DnaA reached the summit level at the stationary phase, and inhibited DNA replication initiation by preventing DnaA from binding to ATP or oriC60. In human cells, acetylation of Cdc6 regulated its phosphorylation and relocated Cdc6 protein from nucleus to the cell cytoplasm in the S phase58. There are 13 Cdc6 proteins in H. mediterranei31, we identified acetylation in 5 Cdc6 proteins as shown in Table 1. Among the five acetylated Cdc6 proteins, only origin adjacent to Cdc6L was dormant replication origin demonstrated by our lab61, origins adjacent to the other four Cdc6 proteins were all active origins61, 62. Sequence alignment showed that the acetylated sites in Cdc6A and Cdc6K were all located within the Walker A motif of Cdc6 (Figure 7A), the MS spectra showed the acetylated site (K139) of Cdc6A (Figure 7B). To address the effect of acetylation on the function of Cdc6, we constructed different clones with the primers in Table 2 to mutate the acetylated site K139 of Cdc6A to

23



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

arginine (R) and glutamine (Q) to mimic deacetylation and acetylation respectively, and alamine (A) mutation was taken as negative control. ARS assay was performed to detect the effect of different point mutations on the function of Cdc6A. Wild type or mutated oriC1-cdc6A fragments were inserted into non-replicating plasmid pHFX, then transformed the host strain DF50ΔoriC1-cdc6A. As shown in Figure 7C, neither K139R nor K139A mutation could rescue the ARS activity of mutant oriC1-cdc6A. Although there were transformants growing on the plate detecting the effect of K139Q mutation on ARS activity of mutant oriC1-cdc6A, the transformation efficiency was lower than that of the wild type Cdc6A. This indicated that glutamine mutation also inhibited the function of Cdc6A, but it could rescue the ARS activity of the oriC1-cdc6A mutant to some extent because glutamine is uncharged and mimicking acetylation. However, the arginine mutation changed this site to a charge-conserved state as non-acetylated lysine, and alamine mutation totally changed the characteristics of this conserved site, so both the arginine and alamine mutation completely destroyed the ARS activity of mutant oriC1-cdc6A. These results showed that the acetylation of K139 was critical to the function of Cdc6A to initiate replication. Similar to the acetylated site K178 of DnaA in E.coli60, K139 also located in the conserved Walker A motif of Cdc6, which is responsible for ATP binding. Previous study demonstrated that the invariant lysine of Walker A motif interacted with the β and γ phosphates of ATP and structured the p-loop in related NTPases, mutation at this site would typically abolish its ATP binding and therefore ATPase activity63, 64.

24


Page 24 of 48

Page 25 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


We proposed that these mutation changed the electric charge of the conserved lysine site, thus destroyed the activity of Cdc6. 5 acetylated lysine sites were identified in the Walker A motif of E.coli60, the high level of acetylation in Walker A motif implied that the function of ATP binding was strictly regulated by acetylation. Moreover, acetylation was identified in 5 Cdc6 proteins in our research, which further suggested that regulation of acetylation on Cdc6 (or DnaA) function was a widespread and conserved mechanism from eukaryotes to prokaryotes.

CONCLUSIONS In this study, we provide the first extensive lysine acetylome in archaea, using the model haloarchaeon H. mediterranei. A total of 1017 acetylation sites from 643 acetylated proteins were identified in H. mediterranei, accounting for 17.3% of the total proteins in the cell. This acetylome provides a global view of this microorganism in lysine acetylation. Extensive characterization of this acetylome revealed that the acetylated proteins were mainly distributed in cytoplasm and involved in many aspects of cellular functions. Consistent with eukaryotes and bacteria, lysine acetylation was widespread in the biological processes of protein biosynthesis and carbon metabolism in H. mediterranei. Moreover, the analysis of the amino acid sequence motifs revealed that H. mediterranei shared a common feature with human cells and some bacteria: a positive charged residue (K, R or H) locating downstream of acetylated lysine. However, it showed a distinct feature with K/R locating at +1, +2 or +3 position downstream of acetylated lysine in H.mediterranei, rather than +4, +5

25



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

or +6 position in eukaryotes and bacteria. The distinctive interaction network of 354 acetylated proteins indicates that lysine acetylation not only participated in the regulation of protein biosynthesis and metabolism but also took part into the transcription of H.mediterranei. Especially, the acetylation of key enzymes in the PHBV biosynthesis further supported that acetylation was involved in the carbon metabolism. Significantly, we found that acetylation of Cdc6 proteins was widespread in H.mediterranei, and demonstrated that the mutation of acetylated lysine destroyed the replication initiation activity of Cdc6A, implying that acetylation may play an important and conserved role in the regulation of DNA replication initiation. Taken together, our findings provide an important foundation for understanding the physiological functions and the potential regulatory mechanism of lysine acetylation in H.mediterranei. Acknowledgments This work was supported by grants from the National Natural Science Foundation of China (Grant No. 31330001),the Hundred Talents Program of the Chinese Academy of Sciences (to H.X.), and the CAS/SAFEA International Partnership Program for Creative Research Teams.

Abbreviations LC PBS PBST HRP DTT

Liquid Chromatography Phosphate Buffered Saline Phosphate Buffered Saline, 0.05% Tween 20 Horseradish Peroxidase DL-Dithiothreitol 26


Page 26 of 48

Page 27 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


IAA K[ac] ACN UPLC TFA NSI NCE MCODE

Iodoacetamide

Acetylated lysine Acetonitrile Ultra Performance Liquid Chromatography Trifluoroacetic Acid Nano Electrospray Ionization Normalized Collision Energy Molecular Complex Detection, Plug-in of Cytoscape software

Supporting Information Available: Table S1. Identified acetylated proteins and peptides; Table S2. The distribution of peptide length; Table S3.The distribution of acetylated sites; Table S4. Ortholog acetylated proteins with yeast and E.coli; Table S5. Ortholog acetylated proteins among H.mediterranei, yeast and E.coli; Table S6. GO annotation analysis; Table S7. Subcellular location analysis; Table S8. GO enrichment analysis; Table S9. KEGG pathway enrichment analysis; Table S10. Acetylated protein domain enrichment Analysis; Table S11. Motif type of acetylated peptides; Table S12. Analysis of interaction network; Table S13. Analysis of interaction network nodes. Figure S1. Validation of the MS data by the distribution of peptide mass error and the distribution of peptide length. Figure S2. Pathway enrichment from KEGG pathway analysis.

27



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure S3. Global protein-protein interaction network of 354 acetylated proteins in H.mediterranei from a STRING analysis.

References (1). Hart, G. W.; Ball, L. E., Post-translational modifications: a major focus for the future of proteomics. Mol Cell Proteomics 2013, 12, (12), 3443. (2). Phillips, D. M., The presence of acetyl groups of histones. Biochem J 1963, 87, 258-63. (3). Bernal, V.; Castano-Cerezo, S.; Gallego-Jara, J.; Ecija-Conesa, A.; de Diego, T.; Iborra, J. L.; Canovas, M., Regulation of bacterial physiology by lysine acetylation of proteins. N Biotechnol 2014, 31, (6), 586-95. (4). Gu, W.; Roeder, R. G., Activation of p53 sequence-specific DNA binding by acetylation of the p53 C-terminal domain. Cell 1997, 90, (4), 595-606. (5). LeDizet, M.; Piperno, G., Identification of an acetylation site of Chlamydomonas alpha-tubulin. Proc Natl Acad Sci U S A 1987, 84, (16), 5720-4. (6). Choudhary, C.; Kumar, C.; Gnad, F.; Nielsen, M. L.; Rehman, M.; Walther, T. C.; Olsen, J. V.; Mann, M., Lysine acetylation targets protein complexes and co-regulates major cellular functions. Science 2009, 325, (5942), 834-40. (7). Kim, S. C.; Sprung, R.; Chen, Y.; Xu, Y.; Ball, H.; Pei, J.; Cheng, T.; Kho, Y.; Xiao, H.; Xiao, L.; Grishin, N. V.; White, M.; Yang, X. J.; Zhao, Y., Substrate and functional diversity of lysine acetylation revealed by a proteomics survey. Mol Cell 2006, 23, (4), 607-18.

28


Page 28 of 48

Page 29 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(8). Zhao, S.; Xu, W.; Jiang, W.; Yu, W.; Lin, Y.; Zhang, T.; Yao, J.; Zhou, L.; Zeng, Y.; Li, H.; Li, Y.; Shi, J.; An, W.; Hancock, S. M.; He, F.; Qin, L.; Chin, J.; Yang, P.; Chen, X.; Lei, Q.; Xiong, Y.; Guan, K. L., Regulation of cellular metabolism by protein lysine acetylation. Science 2010, 327, (5968), 1000-4. (9). Norvell, A.; McMahon, S. B., Cell biology. Rise of the rival. Science 2010, 327, (5968), 964-5. (10). Choudhary, C.; Mann, M., Decoding signalling networks by mass spectrometry-based proteomics. Nat Rev Mol Cell Biol 2010, 11, (6), 427-39. (11). Jensen, O. N., Interpreting the protein language using proteomics. Nat Rev Mol Cell Biol 2006, 7, (6), 391-403. (12). Weinert, B. T.; Wagner, S. A.; Horn, H.; Henriksen, P.; Liu, W. R.; Olsen, J. V.; Jensen, L. J.; Choudhary, C., Proteome-wide mapping of the Drosophila acetylome demonstrates a high degree of conservation of lysine acetylation. Sci Signal 2011, 4, (183), ra48. (13). Henriksen, P.; Wagner, S. A.; Weinert, B. T.; Sharma, S.; Bacinskaja, G.; Rehman, M.; Juffer, A. H.; Walther, T. C.; Lisby, M.; Choudhary, C., Proteome-wide analysis of lysine acetylation suggests its broad regulatory scope in Saccharomyces cerevisiae. Mol Cell Proteomics 2012, 11, (11), 1510-22. (14). Mo, R.; Yang, M.; Chen, Z.; Cheng, Z.; Yi, X.; Li, C.; He, C.; Xiong, Q.; Chen, H.; Wang, Q.; Ge, F., Acetylome analysis reveals the involvement of lysine acetylation in photosynthesis and carbon metabolism in the model cyanobacterium Synechocystis sp. PCC 6803. J Proteome Res 2015, 14, (2), 1275-86.

29



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(15). Okanishi, H.; Kim, K.; Masui, R.; Kuramitsu, S., Acetylome with structural mapping reveals the significance of lysine acetylation in Thermus thermophilus. J Proteome Res 2013, 12, (9), 3952-68. (16). Pan, J.; Ye, Z.; Cheng, Z.; Peng, X.; Wen, L.; Zhao, F., Systematic analysis of the lysine acetylome in Vibrio parahemolyticus. J Proteome Res 2014, 13, (7), 3294-302. (17). Wang, Q.; Zhang, Y.; Yang, C.; Xiong, H.; Lin, Y.; Yao, J.; Li, H.; Xie, L.; Zhao, W.; Yao, Y.; Ning, Z. B.; Zeng, R.; Xiong, Y.; Guan, K. L.; Zhao, S.; Zhao, G. P., Acetylation of metabolic enzymes coordinates carbon source utilization and metabolic flux. Science 2010, 327, (5968), 1004-7. (18). Zhang, J.; Sprung, R.; Pei, J.; Tan, X.; Kim, S.; Zhu, H.; Liu, C. F.; Grishin, N. V.; Zhao, Y., Lysine acetylation is a highly abundant and evolutionarily conserved modification in Escherichia coli. Mol Cell Proteomics 2009, 8, (2), 215-25. (19). Zhang, K.; Zheng, S.; Yang, J. S.; Chen, Y.; Cheng, Z., Comprehensive profiling of protein lysine acetylation in Escherichia coli. J Proteome Res 2013, 12, (2), 844-51. (20). Hase, T.; Wakabayashi, S.; Matsubara, H.; Kerscher, L.; Oesterhelt, D.; Rao, K. K.; Hall, D. O., Complete amino acid sequence of Halobacterium halobium ferredoxin containing an Nepsilon-acetyllysine residue. J Biochem 1978, 83, (6), 1657-70. (21). Bell, S. D.; Botting, C. H.; Wardleworth, B. N.; Jackson, S. P.; White, M. F., The interaction of Alba, a conserved archaeal chromatin protein, with Sir2 and its

30


Page 30 of 48

Page 31 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


regulation by acetylation. Science 2002, 296, (5565), 148-51. (22). Altman-Price, N.; Mevarech, M., Genetic evidence for the importance of protein acetylation and protein deacetylation in the halophilic archaeon Haloferax volcanii. J Bacteriol 2009, 191, (5), 1610-7. (23). Lillo, J. G.; Rodriguez-Valera, F., Effects of Culture Conditions on Poly(beta-Hydroxybutyric Acid) Production by Haloferax mediterranei. Appl Environ Microbiol 1990, 56, (8), 2517-2521. (24). Martinez-Espinosa, R. M.; Marhuenda-Egea, F. C.; Bonete, M. J., Assimilatory nitrate reductase from the haloarchaeon Haloferax mediterranei: purification and characterisation. FEMS Microbiol Lett 2001, 204, (2), 381-5. (25). Englert, C.; Horne, M.; Pfeifer, F., Expression of the major gas vesicle protein gene in the halophilic archaebacterium Haloferax mediterranei is modulated by salt. Mol Gen Genet 1990, 222, (2-3), 225-32. (26). Englert, C.; Wanner, G.; Pfeifer, F., Functional analysis of the gas vesicle gene cluster of the halophilic archaeon Haloferax mediterranei defines the vac-region boundary and suggests a regulatory role for the gvpD gene or its product. Mol Microbiol 1992, 6, (23), 3543-50. (27). Anton, J.; Meseguer, I.; Rodriguez-Valera, F., Production of an Extracellular Polysaccharide by Haloferax mediterranei. Appl Environ Microbiol 1988, 54, (10), 2381-6. (28). Cheung, J.; Danna, K. J.; O'Connor, E. M.; Price, L. B.; Shand, R. F., Isolation, sequence, and expression of the gene encoding halocin H4, a bacteriocin from the

31



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 48

halophilic archaeon Haloferax mediterranei R4. J Bacteriol 1997, 179, (2), 548-51. (29). Fang, C. J.; Ku, K. L.; Lee, M. H.; Su, N. W., Influence of nutritive factors on C50 carotenoids production by Haloferax mediterranei ATCC 33500 with two-stage cultivation. Bioresour Technol 2010, 101, (16), 6487-93. (30). Jager, A.; Samorski, R.; Pfeifer, F.; Klug, G., Individual gvp transcript segments in Haloferax mediterranei exhibit varying half-lives, which are differentially affected by salt concentration and growth phase. Nucleic Acids Res 2002, 30, (24), 5436-43. (31). Han, J.; Zhang, F.; Hou, J.; Liu, X.; Li, M.; Liu, H.; Cai, L.; Zhang, B.; Chen, Y.; Zhou, J.; Hu, S.; Xiang, H., Complete genome sequence of the metabolically versatile halophilic

archaeon

Haloferax

mediterranei,

a

poly(3-hydroxybutyrate-co-3-hydroxyvalerate) producer. J Bacteriol 2012, 194, (16), 4463-4. (32). Anjum, A.; Zuber, M.; Zia, K. M.; Noreen, A.; Anjum, M. N.; Tabasum, S., Microbial production of polyhydroxyalkanoates (PHAs) and its copolymers: A review of recent advancements. Int J Biol Macromol 2016, 89, 161-74. (33). Han, J.; Hou, J.; Zhang, F.; Ai, G.; Li, M.; Cai, S.; Liu, H.; Wang, L.; Wang, Z.; Zhang, S.; Cai, L.; Zhao, D.; Zhou, J.; Xiang, H., Multiple propionyl coenzyme A-supplying

pathways

for

production

of

the

bioplastic

poly(3-hydroxybutyrate-co-3-hydroxyvalerate) in Haloferax mediterranei. Appl Environ Microbiol 2013, 79, (9), 2922-31. (34). Sim, S. J.; Snell, K. D.; Hogan, S. A.; Stubbe, J.; Rha, C.; Sinskey, A. J., PHA synthase

activity

controls

the

molecular

weight

32


and

polydispersity

of

Page 33 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


polyhydroxybutyrate in vivo. Nat Biotechnol 1997, 15, (1), 63-7. (35). Hodawadekar, S. C.; Marmorstein, R., Chemistry of acetyl transfer by histone modifying enzymes: structure, mechanism and implications for effector design. Oncogene 2007, 26, (37), 5528-40. (36). Sterner, D. E.; Berger, S. L., Acetylation of histones and transcription-related factors. Microbiol Mol Biol Rev 2000, 64, (2), 435-59. (37). Tanner, K. G.; Trievel, R. C.; Kuo, M. H.; Howard, R. M.; Berger, S. L.; Allis, C. D.; Marmorstein, R.; Denu, J. M., Catalytic mechanism and function of invariant glutamic acid 173 from the histone acetyltransferase GCN5 transcriptional coactivator. J Biol Chem 1999, 274, (26), 18157-60. (38). Cai, S.; Cai, L.; Liu, H.; Liu, X.; Han, J.; Zhou, J.; Xiang, H., Identification of the haloarchaeal phasin (PhaP) that functions in polyhydroxyalkanoate accumulation and granule formation in Haloferax mediterranei. Appl Environ Microbiol 2012, 78, (6), 1946-52. (39). Vizcaino, J. A.; Csordas, A.; Del-Toro, N.; Dianes, J. A.; Griss, J.; Lavidas, I.; Mayer, G.; Perez-Riverol, Y.; Reisinger, F.; Ternent, T.; Xu, Q. W.; Wang, R.; Hermjakob, H., 2016 update of the PRIDE database and its related tools. Nucleic Acids Res 2016, 44, (22), 11033. (40). Klipper-Aurbach, Y.; Wasserman, M.; Braunspiegel-Weintrob, N.; Borstein, D.; Peleg, S.; Assa, S.; Karp, M.; Benjamini, Y.; Hochberg, Y.; Laron, Z., Mathematical formulae for the prediction of the residual beta cell function during the first two years of disease in children and adolescents with insulin-dependent diabetes mellitus. Med

33



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Hypotheses 1995, 45, (5), 486-90. (41). Wu, Z. F.; Liu, H. L.; Liu, J. F.; Liu, X. Q.; Xiang, H., Diversity and evolution of multiple orc/cdc6-adjacent replication origins in haloarchaea. BMC Genomics 2012, 13:478. (42). Liu, H.; Han, J.; Liu, X.; Zhou, J.; Xiang, H., Development of pyrF-based gene knockout systems for genome-wide manipulation of the archaea Haloferax mediterranei and Haloarcula hispanica. J Genet Genomics 2011, 38, (6), 261-9. (43). Yu, B. J.; Kim, J. A.; Moon, J. H.; Ryu, S. E.; Pan, J. G., The diversity of lysine-acetylated proteins in Escherichia coli. J Microbiol Biotechnol 2008, 18, (9), 1529-36. (44). Shao, J.; Xu, D.; Hu, L.; Kwan, Y. W.; Wang, Y.; Kong, X.; Ngai, S. M., Systematic analysis of human lysine acetylation proteins and accurate prediction of human lysine acetylation through bi-relative adapted binomial score Bayes feature representation. Mol Biosyst 2012, 8, (11), 2964-73. (45). Sun, G.; Jiang, M.; Zhou, T.; Guo, Y.; Cui, Y.; Guo, X.; Sha, J., Insights into the lysine acetylproteome of human sperm. J Proteomics 2014, 109C, 199-211. (46). Zhou, X.; Qian, G.; Yi, X.; Li, X.; Liu, W., Systematic Analysis of the Lysine Acetylome in Candida albicans. J Proteome Res 2016, 15, (8), 2525-36. (47). Chen, Y.; Zhao, W.; Yang, J. S.; Cheng, Z.; Luo, H.; Lu, Z.; Tan, M.; Gu, W.; Zhao, Y., Quantitative acetylome analysis reveals the roles of SIRT1 in regulating diverse substrates and cellular pathways. Mol Cell Proteomics 2012, 11, (10), 1048-62.

34


Page 34 of 48

Page 35 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(48). Kim, G. W.; Yang, X. J., Comprehensive lysine acetylomes emerging from bacteria to humans. Trends Biochem Sci 2011, 36, (4), 211-20. (49). Lundby, A.; Lage, K.; Weinert, B. T.; Bekker-Jensen, D. B.; Secher, A.; Skovgaard, T.; Kelstrup, C. D.; Dmytriyev, A.; Choudhary, C.; Lundby, C.; Olsen, J. V., Proteomic analysis of lysine acetylation sites in rat tissues reveals organ specificity and subcellular patterns. Cell Rep 2012, 2, (2), 419-31. (50). Xie, L.; Wang, X.; Zeng, J.; Zhou, M.; Duan, X.; Li, Q.; Zhang, Z.; Luo, H.; Pang, L.; Li, W.; Liao, G.; Yu, X.; Li, Y.; Huang, H.; Xie, J., Proteome-wide lysine acetylation profiling of the human pathogen Mycobacterium tuberculosis. Int J Biochem Cell Biol 2015, 59, 193-202. (51). Han, J.; Lu, Q.; Zhou, L.; Zhou, J.; Xiang, H., Molecular characterization of the phaECHm genes, required for biosynthesis of poly(3-hydroxybutyrate) in the extremely halophilic archaeon Haloarcula marismortui. Appl Environ Microbiol 2007, 73, (19), 6058-65. (52). Feng, B.; Cai, S.; Han, J.; Liu, H.; Zhou, J.; Xiang, H., Identification of the phaB genes and analysis of the PHBV precursor supplying pathway in Haloferax mediterranei. Wei Sheng Wu Xue Bao 2010, 50, (10), 1305-12. (53). Han, J.; Hou, J.; Liu, H.; Cai, S.; Feng, B.; Zhou, J.; Xiang, H., Wide distribution among halophilic archaea of a novel polyhydroxyalkanoate synthase subtype with homology to bacterial type III synthases. Appl Environ Microbiol 2010, 76, (23), 7811-9. (54). Han, J.; Li, M.; Hou, J.; Wu, L.; Zhou, J.; Xiang, H., Comparison of four phaC

35



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 36 of 48

genes from Haloferax mediterranei and their function in different PHBV copolymer biosyntheses in Haloarcula hispanica. Saline Systems 2010, 6: 9. (55). Lu, Q.; Han, J.; Zhou, L.; Zhou, J.; Xiang, H., Genetic and biochemical characterization of the poly(3-hydroxybutyrate-co-3-hydroxyvalerate) synthase in Haloferax mediterranei. J Bacteriol 2008, 190, (12), 4173-80. (56). Hou, J.; Feng, B.; Han, J.; Liu, H.; Zhao, D.; Zhou, J.; Xiang, H., Haloarchaeal-type

beta-ketothiolases

involved

in

Poly(3-hydroxybutyrate-co-3-hydroxyvalerate) synthesis in Haloferax mediterranei. Appl Environ Microbiol 2013, 79, (17), 5104-11. (57). Jiang X, W. Q., Liu G, Zhao D, Liu J, Xiang H, Acetylation Regulates the Function of PhaE in Haloferax mediterranei. Wei Sheng Wu Xue Bao 2017, DOI: 10.13343/j.cnki.wsxb.20170039. (58). Paolinelli, R.; Mendoza-Maldonado, R.; Cereseto, A.; Giacca, M., Acetylation by GCN5 regulates CDC6 phosphorylation in the S phase of the cell cycle. Nat Struct Mol Biol 2009, 16, (4), 412-20. (59). Schilling, B.; Christensen, D.; Davis, R.; Sahu, A. K.; Hu, L. I.; Walker-Peddakotla, A.; Sorensen, D. J.; Zemaitaitis, B.; Gibson, B. W.; Wolfe, A. J., Protein acetylation dynamics in response to carbon overflow in Escherichia coli. Mol Microbiol 2015, 98, (5), 847-63. (60). Zhang, Q.; Zhou, A.; Li, S.; Ni, J.; Tao, J.; Lu, J.; Wan, B.; Li, S.; Zhang, J.; Zhao, S.; Zhao, G. P.; Shao, F.; Yao, Y. F., Reversible lysine acetylation is involved in DNA replication initiation by regulating activities of initiator DnaA in Escherichia

36


Page 37 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


coli. Sci Rep 2016, 6, 30837. (61). Yang, H.; Wu, Z.; Liu, J.; Liu, X.; Wang, L.; Cai, S.; Xiang, H., Activation of a dormant replication origin is essential for Haloferax mediterranei lacking the primary origins. Nat Commun 2015, 6, 8321. (62). Liu, X.; Miao, D.; Zhang, F.; Wu, Z.; Liu, J.; Xiang, H., Characterization of the minimal replicon of pHM300 and independent copy number control of major and minor chromosomes of Haloferax mediterranei. FEMS Microbiol Lett 2013, 339, (1), 66-74. (63). Saraste, M.; Sibbald, P. R.; Wittinghofer, A., The P-loop--a common motif in ATP- and GTP-binding proteins. Trends Biochem Sci 1990, 15, (11), 430-4. (64). Wendler, P.; Ciniawsky, S.; Kock, M.; Kube, S., Structure and function of the AAA+ nucleotide binding pocket. Biochim Biophys Acta 2012, 1823, (1), 2-14.

Table 1 Acetylated Cdc6 identified in H.mediterranei Gene ID

Protein Name

Acetylated peptide

Acetylated site position

HFX_0001

Cdc6A

GETPSNILIYGK[Ac]TGTGK

139

HFX_1817

Cdc6G

GLSTSTYYK[Ac]R

137

HFX_5001

Cdc6K

EPTHLFIFGK[Ac]TGSGK

70

HFX_6001

Cdc6L

FQPDDTLYK[Ac]R

13

HFX_6249

Cdc6M

DDLSPK[Ac]VK IQEEHVK[Ac]R

192 276

37



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 38 of 48

Table 2 Primers, Plasmids and strains used in this study Primers Primer

Sequence(5’-3’)

cdc6A-K139R-F1

ATTCTCATCTACGGGCGCACCGGGACCGGGAAG

cdc6A-K139R-R1

CTTCCCGGTCCCGGTGCGCCCGTAGATGAGAAT

cdc6A-K139A-F1

ATTCTCATCTACGGGGCCACCGGGACCGGGAAG

cdc6A-K139A-R1

CTTCCCGGTCCCGGTGGCCCCGTAGATGAGAAT

cdc6A-K139Q-F1

ATTCTCATCTACGGGCAGACCGGGACCGGGAAG

cdc6A-K139Q-R1

CTTCCCGGTCCCGGTCTGCCCGTAGATGAGAAT

Purpose Mutation of K139 to Arginine (R) Mutation of K139 to Alamine (A) Mutation of K139 to Glutamine (Q)

Plasmids Plasmid pHFX

Description

Source or reference

non-replicating vector containing pyrF and Liu, et al42. its native promoter, Ampr

pHFX-cdc6A+

pHFX with insertion of oriC1-cdc6A at BamH I-Kpn I sites

This study

pK139R

pHFX-cdc6A+ with the K139R mutation

This study

pK139A

pHFX-cdc6A+ with the K139A mutation

This study

pK139Q

pHFX-cdc6A+ with the K139Q mutation

This study

Strains Strains

Description

Source or reference

H.mediterranei

wild type

CGMCC

DF50∆oriC1-cdc6A

oriC1-cdc6Adeletaion mutant of DF50

Yang et al.

38


61

Page 39 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure Legends Figure 1.Characterization of lysine acetylation in H.mediterranei. (A) Detection of the overall acetylation of H.mediterranei by western blotting. 30µg protein lysates were separated by SDS-PAGE, then proteins were detected by pan anti-acetyl antibodies ( from PTM Biolabs, PTM-101, 1:1000 dilution)；(B) Distribution of acetylated proteins based on the number of lysine acetylated sites identified in each protein.

Figure 2. Comparative analysis of acetylated proteins in H.mediterranei with yeast (S. cerevisiae) and E. coli. Venn diagram showed the relationship of lysine acetylated proteins among H.mediterranei, yeast (S. cerevisiae) and E. coli. (A) The ortholog acetylated proteins between H.mediterranei and yeast (S. cerevisiae). (B) The ortholog acetylated proteins between H.mediterranei and E.coli. (C) The acetylated ortholog proteins shared by H.mediterranei, yeast (S. cerevisiae) and E.coli.

Figure 3. Functional classification (A-C) and enrichment analysis (D-E) of the identified acetylated proteins based on Gene Ontology (GO). (A) biological process; (B) molecular function; (C) Subcellular location; (D) Functional enrichment in molecular function (TOP) and biological process (Below); (E) Protein domain enrichment analysis of all identified acetylated proteins.

For the -log10（Fishers’s

test p exact value）, the number (>1.3) showed the score of each enrichment.

39



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 4. Properties of the acetylated peptides. (A) Acetylated lysine motifs as analyzed by Motif-X software. The height of each letter represents the frequency of that amino acid residue in that position. The central K refers to the acetylated lysine. Motif score is calculated by taking the sum of the negative log probabilities to fix each position of the motif. Higher motif scores typically correspond to motifs that are more statistically significant as well as more specific. The “fold increase” statistic is an indicator of the enrichment level of the extracted motifs. (B) Heat map of the amino acid compositions around the acetylation sites, showing the different type of amino acids frequencies for ±10 amino acids from the acetylated lysine. (C) The number of identified peptides containing acetylated lysine in each motif.

Figure 5. Highly dense interaction subnetworks of acetylated proteins in different biological processes derived from a STRING analysis. (A) Subnetwork in ribosome and translational factors. (B) Subnetwork of basal transcription factors, C439_03183 represented HFX_1461, RpoM1. (C) Subnetwork mainly related to TCA cycle and some molecular chaperone proteins (BM92_08560, ThsA, HFX_0142; BM92_07150, ThsB, HFX_0422; C439_06780, ThsA, HFX_0738). (D) Subnetwork of enzymes mainly involved in the metabolism of aspartate.

Figure 6. Acetylation of key enzymes in the PHBV biosynthesis (acetylated enzymes in red).

40


Page 40 of 48

Page 41 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 7. Mutation of acetylated K139 site of Cdc6A in the Walker A motif destroyed its function. (A) Sequence alignment of all Cdc6 proteins in H.mediterranei by ClustalX2. * showed the acetylated lysine (K139) of Cdc6A in the conserved Walker

A

motif.

(B)

MS/MS

spectra

of

acetylated

peptide

GETPSNILIYGK[Ac]TGTGK of Cdc6A. (C) Mutation of acetylated K139 site of Cdc6A destroyed its function detected by ARS activity assay. Wild type or mutated oriC1-cdc6A fragments were inserted into non-replicating plasmid pHFX, then transformed the host strain DF50ΔoriC1-cdc6A. On AS-168SY (AS-168 medium without yeast extract) plates, K139R and K139A could not rescue the ARS activity of mutant oriC1-cdc6A, K139Q inhibited the ARS activity of mutant oriC1-cdc6A.

41



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figures

Figure 1

42


Page 42 of 48

Page 43 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2

43



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 3

44


Page 44 of 48

Page 45 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure4

45



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 5

Figure 6

46


Page 46 of 48

Page 47 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 7

47



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

For TOC only

48


Page 48 of 48

Systematic Analysis of Lysine Acetylation in the Halophilic Archaeon

Recommend Documents