Systematic Engineering of Escherichia coli for d-Lactate Production

Oct 19, 2015 - Phone: 886-4-22053366, ext. 7227. Fax: 886-4-22057414., *E-mail: [email protected]. Phone: 886-4-24517250, ext. 3677. ... of Escherichi...
0 downloads 6 Views 596KB Size
Download PDF
Article pubs.acs.org/JAFC

Systematic Engineering of Escherichia coli for D‑Lactate Production from Crude Glycerol Zei Wen Wang,† Mukesh Saini,† Li-Jen Lin,‡ Chung-Jen Chiang,*,§ and Yun-Peng Chao*,†,∥,⊥ †

Department of Chemical Engineering, Feng Chia University, 100 Wenhwa Road, Taichung 40724, Taiwan School of Chinese Medicine, College of Chinese Medicine, China Medical University, Taichung 40402, Taiwan § Department of Medical Laboratory Science and Biotechnology, China Medical University, No. 91, Hsueh-Shih Road, Taichung 40402, Taiwan ∥ Department of Health and Nutrition Biotechnology, Asia University, Taichung 41354, Taiwan ⊥ Department of Medical Research, China Medical University Hospital, Taichung 40447, Taiwan ‡

ABSTRACT: Crude glycerol resulting from biodiesel production is an abundant and renewable resource. However, the impurities in crude glycerol usually make microbial fermentation problematic. This issue was addressed by systematic engineering of Escherichia coli for the production of D-lactate from crude glycerol. First, mgsA and the synthetic pathways of undesired products were eliminated in E. coli, rendering the strain capable of homofermentative production of optically pure D-lactate. To direct carbon flux toward D-lactate, the resulting strain was endowed with an enhanced expression of glpD−glpK in the glycerol catabolism and of a heterologous gene encoding D-lactate dehydrogenase. Moreover, the strain was evolved to improve its utilization of cruder glycerol and subsequently equipped with the FocA channel to export intracellular D-lactate. Finally, the fedbatch fermentation with two-phase culturing was carried out with a bioreactor. As a result, the engineered strain enabled production of 105 g/L D-lactate (99.9% optical purity) from 121 g/L crude glycerol at 40 h. The result indicates the feasibility of our approach to engineering E. coli for the crude glycerol-based fermentation. KEYWORDS: crude glycerol, D-lactate, metabolic engineering, fermentation technology

■

INTRODUCTION The pressing need for bulk chemicals from renewable resources to substitute for the petroleum-based counterparts has ushered in intensive studies in both academia and industry. Among them, lactate is an important chemical with many applications in the food, pharmaceutical, and chemical industries.1 In particular, polylactate (PLA) synthesized from D- and L-lactate is known as a biodegradable and environmentally friendly material and holds a great potential to substitute for the synthetic plastic from petrochemicals.2 Lactate of optical purity is usually required for industrial use, which makes the microbial fermentation process promising. Lactic acid bacteria have been commonly employed for the production of lactate using glucose-rich feedstock.3 Nevertheless, a sustainable production scheme of lactate can be realized by the microbial fermentation process based on inexpensive and renewable substrates. In addition to cellulose, glycerol attracts a lot of attention because it is a renewable resource generated as a byproduct from the biodiesel production process.4,5 Biodiesel is an alternative fuel and is commercially available on the market. The supply of fossil fuels is insecure, and their mass consumption results in the global warming effect, which has provoked the demand for biodiesel. Consequently, it leads to a large amount of glycerol circulating in the market. However, waste glycerol usually needs refinement prior to its use for most industrial applications, which increases the production cost of biodiesel. Moreover, the disposal of waste residues from refinement also overshadows the biodiesel industry. To address this issue, one appealing solution is to develop the microbial © XXXX American Chemical Society

production process for value-added chemicals based on crude glycerol.6 Escherichia coli is broadly recognized as a bioprocess-friendly strain, enables utilization of various sugars, and can grow on a simple medium. With the availability of genetic techniques, this bacterial strain has been successfully modified to produce biofuels and high-value chemicals.7,8 Wild-type E. coli grown on glycerol exhibits a heterofermentative production pattern while producing an undetected level of D-lactate.9,10 Apparently, redesign of E. coli metabolic pathways is necessary for the synthesis of D-lactate, and encouraging results are reported with the engineered strains on glucose.11−13 Nevertheless, there are few studies on the production of optically pure lactate from crude glycerol in E. coli. In this context, this work was initiated by systematic engineering of E. coli for D-lactate production using the combined approach of metabolic engineering, directed evolution, and fermenation technology. Consequently, the resulting strain enabled effective production of D-lactate from crude glycerol.

■

MATERIALS AND METHODS

Gene Manipulation and Strain Construction. The E. coli strains and primers applied in this study are summarized in Table 1. The removal of adhE from strain BL21 essentially followed the Received: August 25, 2015 Revised: October 16, 2015 Accepted: October 19, 2015

A

DOI: 10.1021/acs.jafc.5b04162 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry Table 1. Main Strains and Primers Used in This Study E. coli strain

main characteristics

source

BL21 BLac-2101 BLac-2102 BLac-2103 BLac-2104-AK BLac-2104-KD BLac-2015 BLac-2106 primer

F− dcm gal ompT hsdS(rB− mB−) as BL21 ΔadhE Δdld ΔmgsA Δpta as BLac-2101 Δf rdA Δpf lB as BLac-2102 ΔpflCD::PλPL-D-ldh as BLac-2013 PλPL-gldA PλPL-dhaKLM as BLac-2013 PλPL-glpK PλPL-glpD evolved BLac-2104-KD as BLac-2105 PλPL-focA

laboratory collection this study this study this study this study this study this study this study

Dld1 Dld2 Dha1 Dha2 Mgs1 Mgs2 Foc1 Foc2 Frd1 Frd2 Gld1 Gld2 Glk1 Glk2 Glp1 Glp2 Pfl1 Pfl2 RC12120 RC12121 RC11111 RC11061 RC12036 RC12054 RC14056 RC14057 RC14058 RC14059 RC14060 RC14061 RC14062 RC14063 RC14084 RC14085

sequence cgattcctactgaacatagc tggtgatgcgtacggttatc cagtcctgccagttgttcgtccagtacgtcttgcacatcattgatcaattttttcatatggatcaacctccttaggattac cagtcagtggtcgccgtgtcgttgaacatcatccatgccctaccgtaattgcccccattaatgtcgacgatcc caggtgctcacagaacaacg aagaggcgctactgccacc ccactttggccattgcagcaggaagtaaaagatcaaaagggttgtcagctttcatatggatcaacctccttaggattac gatctatactaatttctcatctataatgctttgttagtatctcgtcgccgacccccattaatgtcgacgatcc gcagtgactaaaaaaagcacg gcacgttgttaaccatcatgc cgattaatcacatcagcgccctggatgtatttacccggtgattgaataatgcggtccatatggatcaacctccttaggattac gagaagttcgaacacgactggaatgccgcatttggcactactcatctctaaccccattaatgtcgacgatcc gcgggagctggtggtgccctggtcgagcgcaacgatatattttttttcagtcatatggatcaacctccttaggattac gttgtggaagaaaaggaaaccacaactccttcagaacaaaaagcttcgctgtaaccccattaatgtcgacgatcc ccagcaccattgatgccgccccctatcacaatcagatctttggtttccatatggatcaacctccttaggattac gcgcgattctttgctaatatgttcgataacgaacatttatgagctttaacgccccattaatgtcgacgatcc tttctcacctgaccgtgatg tgacattgcggtgtttctcc ctcatgacgaatcgtatctctc gtatgccattttaacctcccac ggaaccatggtaatgaaaattattgcatatgc aatttcgcgattaaaacttgttcttgttcaaag ctgtctcttatacacatcttaatgtcgacgatcctatac ctgtctcttatacacatcttaaaacttgttcttgttcaaagc caccgacgcccgataaaa ccttcgccgccatcaac ggtatcggtggcggaaaaa cggaacacccatgaaatgtg gcaggcgcatccattcag tcgtaggcgtcgttaatcaactt tcgccgcaggctattacc gcggtgctttgccatttt gccaagacggttgaagatgc gagaaactgccgaaaccgc

reported method.14 Meanwhile, pta and f rdA of the strain were eliminated as reported previously.15,16 To delete dld, f rdA, mgsA, or pflB, each gene inserted with the flippase recognition target (FRT) site-flanked kan (FRT−kan−FRT) was amplified from strains JW2121-1, JW4115-1, JW5129-1, and JW0886-117 by polymerase chain reaction (PCR) with primers Dld1−Dld2, Frd1−Frd2, Mgs1− Mgs2, and Pfl1−Pfl2, respectively. The PCR DNAs were electroporated into the strain, and the genomic target genes were then knocked out as a result of the λRed-mediated homologous recombination.18 Followed by each insertion event, the inserted DNA cassette containing flanked FRT or loxP sites was removed by the act of Flp or Cre following the previous protocols.18,19 The partial region of pf lCD was amplified from the BL21 genome by PCR using primer RC12120−RC12121. The PCR DNA was spliced with plasmid pBluescript SK(+) cleaved by EcoRV to give pBlue-pflCD. Meanwhile, the gene (D-ldh) encoding D-lactate dehydrogenase of Lactobacillus helveticus CCRC 12936 was cloned by PCR with primer RC11111−RC11061 and fused to the λPL

promoter (PλPL). This was carried out by incorporation of the PCR DNA into the NdeI−XhoI site of plasmid pPL-Gn to give plasmid pPL-ldh. Plasmid pPL-Gn essentially carries the LE*-gen-RE*-PλPL cassette.16 By PCR with primer RC12036−RC12054, the DNA containing LE*-gen-RE*-PλPL-D-ldh was amplified from plasmid pPLldh and spliced into plasmid pBlue-pflCD at NruI. Consequently, the construction gave plasmid pFlCD-ldh from which the PCR DNA was additionally synthesized using primer RC12120−RC12121. The resulting PCR DNA was integrated into the strain via homologous recombination, finally leading to the insertion of PλPL-D-ldh at pf lCD. To fuse endogenous gldA with PλPL, the LE*-gen-RE*-PλPL cassette on plasmid pPL-Gn was flanked by two homologous extensions containing the upstream and 5′-structure region of the target gene. This was carried out by PCR from plasmid pPL-Gn with primer Gld1−Gld2. After electroporation, the linear DNA was forced to integrate by the aid of λRed. dhaK, glpK, glpD, and focA were linked to PλPL in a similar way by amplification of DNAs from plasmid pPLGn with primers Dha1−Dha2, Glk1−Glk2, Glp1−Glp2, and Foc1− B

DOI: 10.1021/acs.jafc.5b04162 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

liquid chromatography (HPLC) equipped with an RID-10A refractive index detector (Shimadzu, Japan) and ICSep ICE-ION-300 column (Transgenomic, United States). The analysis was conducted at 60 °C with the mobile phase (0.0085 N H2SO4) set at 0.6 mL/min. Lactic acid and other organic acids were analyzed by HPLC (AS3000, Thermo Scientific, United States) with a UV detector at 210 nm and ICSep ICE-ORH-801 column (Transgenomic). The analysis was carried out at 55 °C with the mobile phase (0.0085 N H2SO4) set at 0.3 mL/min. To determine the chiral purity of D-lactate, a Chirex 3126 D-penicillamine column (Phenomenex, United States) was used with the mobile phase (1 mM CuSO4) pumped at 1 mL/min. Detection was conducted with UV at 254 nm at room temperature. To determine the lactate dehydrogenase (LDH) activity, the shakeflask culture was preformed with NBS medium plus 20 g/L crude glycerol at 37 °C for 24 h. The culture was harvested and then resuspended in 10 mM phosphate buffer (pH 7.0). The harvested cells were disrupted, and a centrifuge was applied to obtain the cell-free extract (CFX). The CFX concentration was measured using the BioRad Protein Assay Kit. The reaction was initiated by adding CFX to the solution, consisting of 1 mM pyruvate, 0.053 mM NADH, and 100 mM sodium phosphate buffer (pH 7.0), at 25 °C for 5 min. The activity was determined by a decrease in absorbance at 340 nm resulting from the oxidation of NADH. One unit (U) of the enzyme activity was expressed in micromoles of reacted NADH per minute. The specific enzyme activity (U/mg) was calculated by dividing the measured units by milligrams of CFX.

Foc2, respectively. The resulting PCR DNAs were then used for genomic insertion. Shake-Flask Culture and Bacterial Evolution. The bacterial growth was measured turbidimetrically at 550 nm (OD550). Unless stated otherwise, bacterial strains were cultured in rotary tubes containing Luria−Bertani (LB) medium20 overnight. The overnight cultures were inoculated into 125 mL Erlenmeyer flasks containing 40 mL of mineral NBS medium21 supplemented with 35 g/L pure glycerol. The seeded cultures were then incubated at 37 °C with occasional shaking throughout the experiment. To evolve the strain, the shake-flask culture was grown for 24 h and 1/10 of the culture volume was seeded into a flask containing NBS medium plus 35 g/L crude glycerol. Subsequently, the bacterial culture was grown at 37 °C for 48 h. The serial transfer of the bacterial culturing on crude glycerol was then repeated until the cell density greatly increased. Crude glycerol was provided by Great Green Technology (Changhua, Taiwan), and its composition was 82% (w/w) glycerol, 1.7% fatty acids, and 4.6% ash after sterilization by autoclaving. Bacterial Fermentation Using Pure Glycerol. The overnight culture was routinely grown and seeded into flasks containing 100 mL of NBS medium with 20 g/L pure glycerol. After growth for 12 h, the grown culture was inoculated into a custom-made mini-bioreactor14 containing 0.4 L of NBS medium plus 38 g/L pure glycerol. The initial cell density reached 0.05 at OD550. The fermentation was carried out at 37 °C, while the pH was controlled at 7 by 4 N KOH. The agitation rate was set at 100 rpm, and air was purged at 0.2 vvm (gas volume flow per unit of liquid volume per minute). Bacterial Fermentation Using Crude Glycerol. The overnight culture was inoculated into flasks containing 100 mL of NBS medium with 20 g/L crude glycerol. The bacteria were grown at 37 °C for 24 h and transferred to flasks containing 200 mL of fresh NBS medium with 30 g/L crude glycerol for another 12 h. Following centrifugation, the harvested bacteria were inoculated into a bench bioreactor (New Brunswick Bioflow 110) containing 1 L of NBS medium with 35 g/L crude glycerol. The initial cell density reached 0.5 at OD550, and the culture was grown under conditions where the dissolved oxygen (DO) concentration reached around 50% of the saturated DO. This was achieved with air purged at 2 vvm and the agitation rate set at 200− 500 rpm. After culturing for 12 h, 45 mL of crude glycerol (820 g/L) was additionally supplemented, and the DO was controlled at 1% of the saturated DO by purging air at 0.1 vvm and agitating at 200 rpm. The whole fermentation process was conducted at 37 °C and pH 7.0. Similarly, the preculture process was carried out, and the harvested bacteria were seeded into the bench bioreactor containing 1 L of NBS medium with 6.2 g/L crude glycerol and 10 g/L yeast extract. After aerobic culturing (at 30% of the saturated DO) for 10 h, the fermentation was initiated with the DO set at 1% of the saturated DO, and crude glycerol was fed at a rate to keep its concentration higher than 10 g/L. Moreover, the pH was controlled at 7.0 by using 20% (w/v) Ca(OH)2. Quantitative Real-Time PCR (RT-PCR). The shake-flask culture was carried out with NBS medium plus 20 g/L crude glycerol at 37 °C for 24 h. The cells were harvested by centrifugation and washed with 0.9% NaCl. Their total RNAs were isolated by Ambion RiboPure (Life Technology, United States) according to the manufacturer’s instructions. The RNA concentration was quantified using a NanoVue Plus spectrophotometer (GE Healthcare Life Science, United States). The primers for gldA (RC14058−RC14059), dhaK (RC14056− RC14057), glpK (RC14060−RC14061), glpD (RC14062−RC14063), and ihf B (RC14084−RC14085) were designed using Applied Biosystems Primer Express Software (Life Technology). The cDNA was then synthesized with the High Capacity cDNA Reverse Transcription Kit (Life Technology). Real-time PCR was performed using the Applied Biosystems StepOne real-time PCR system (Life Technology) with the Power SYBR Green PCR Master Mix and Power SYBR Green RT-PCR Reagent Kit. The mRNA level for each gene was normalized to that of ihf B, which served as an internal control. Analytical Methods. The analytical methods essentially followed the reported protocol.16 Glycerol was measured by high-performance

■

RESULTS AND DISCUSSION Development of a D-Lactate Producer Strain. As revealed from the glycerol metabolism of E. coli, acetate and ethanol are the main byproducts competing with D-lactate for glycerol (Figure 1). Therefore, their synthetic pathways were blocked by deletion of pta and adhE in strain BL21. Moreover, the methylglyoxal pathway leads to the synthesis of both D- and 22 L-lactate. To ensure the product purity, this pathway was eliminated by removing mgsA from the strain. In addition, dld encodes D-lactate dehydrogenase, which oxidizes D-lactate and is induced at a high D-lactate level.23 Reassimilation of D-lactate in the strain is circumvented by dld knockout in the strain. Finally, the resulting strain (designated as BLac-2101) was investigated for its fermentation performance on pure glycerol. As shown in Figure 2, formate was the most abundant product for the strain, followed by D-lactate and succinate. The fermentative syntheses of succinate and formate are mediated by fumarate reductase (encoded by f rdABCD) and pyruvate-formate lyase (encoded by pf lB), respectively. To improve the D-lactate production, both f rdA and pf lB of strain BLac-2101 were deleted to obtain strain BLac-2102. Consequently, strain BLac-2102 approximately doubled the production of D-lactate compared to strain BLac-2101. Nevertheless, the formate production for strain BLac-2102 still remained high. In addition to pflB, tdcE, pf lCD, and pf lEF are annotated with a potential function of pyruvate-formate lyase (PFL).24 Deletion of all these genes is likely to ban the formation of formate in the strain. However, PFL fulfills a physiological function in conversion of pyruvate to acetyl-CoA, which is essential for the anaerobic growth of E. coli. Moreover, the intracellular pyruvate pool in BLac-2102 is expected to increase after disruption of all known pathways leading to various fermentation products. Therefore, an enhanced level of D-lactate dehydrogenase (D-LDH) and a reduced level of PFL might be useful for directing pyruvate toward lactate. Accordingly, strain BLac-2103 was constructed by integration of PλPL-driven D-ldh of L. helveticus into strain BLac-2102 at pf lCD. The enzyme activity assay revealed that strain BLacC

DOI: 10.1021/acs.jafc.5b04162 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 2. Fermentation production of recombinant strains using minibioreactors. Fermentation of recombinant strains was carried out with a custom-made mini-bioreactor containing NBS medium with pure glycerol (20 g/L). After fermentation for 72 h, the culture broth was sampled and the fermentation products were analyzed by HPLC. The experiments were conducted in triplicate.

Figure 1. Synthetic pathway of D-lactate from glycerol involved in E. coli. Genes involved in the metabolic pathway: aceE-lpd, pyruvate dehydrogenase; adhE, aldehyde-alcohol dehydrogenase; dld, FADlinked D-lactate dehydrogenase; dhaKLM, dihydroxyacetone kinase operon; f rdA, subunit of fumarate reductase; ldhA, NAD-linked Dlactate dehydrogenase; D-ldh, L. helveticus D-lactate dehydrogenase; mgsA, methylglyoxal synthase; gldA, glycerol dehydrogenase; glpD, glycerol 3-phosphate dehydrogenase; glpF, glycerol facilitator; glpK, glycerol kinase; gltA, citrate synthase; pflB, pyruvate-formate lyase; pflDC, putative pyruvate-formate lyase; pf lEF, putative pyruvateformate lyase; pta, phosphate acetyltransferase; ppc, phosphoenolpyruvate carboxylase; tdcDE, putative pyruvate-formate lyase. The metabolic pathways are blocked as marked by “X”. Abbreviations: ACE, acetate; CIT, citrate; DHAP, dihydroxyacetone phosphate; EtOH, ethanol; FOM, formate; D-LAC, D-lactate; L-LAC, L-lactate; OAA, oxaloacetate; PEP, phosphoenolpyruvate; PYR, pyruvate; SUC, succinate.

Figure 3. Utilization of pure glycerol and crude glycerol by recombinant strains. Recombinant strains were grown in shake flasks containing NBS medium with either pure glycerol or crude glycerol (35 g/L for each). The fermentation was carried out for 72 h, and the products were analyzed. The experiments were conducted in triplicate. Key: 1, strain BLac-2103 on pure glycerol; 2, strain BLac-2103 on crude glycerol; 3, strain BLac-2105 on crude glycerol.

2103 displayed a 2.2-fold higher D-LDH activity than strain BLac-2102 (3.9 vs 0.9 U/mg). As a result, D-lactate became a main product for strain BLac-2013, while other fermentation products were largely reduced (each less than 5 mM). Enhanced Utilization of Crude Glycerol. As illustrated above, strain BLac-2103 enabled overproduction of D-lactate from pure glycerol. It was intriguing to learn the fermentation performance of this strain on crude glycerol. The shake-flask culture of strain BLac-2103 was then carried out to facilitate the investigation. In contrast to its behavior on pure glycerol, strain BLac-2103 exhibited poor growth and slow consumption of crude glycerol (Figure 3). This implies that impurities present in crude glycerol likely perturb the bacterial physiology.25 Figure 1 indicates that the synthetic pathway of D-lactate from glycerol generally consists of three blocks: (1) the dissimilation of glycerol to dihydroxyacetone phosphate (DHAP), (2) the reduction of DHAP to pyruvate via glycolysis, and (3) the D-LDH-mediated conversion of pyruvate to D-

lactate. Strain BLac-2103 already displayed a high D-LDH activity. To improve the strain’s utilization of crude glycerol, the glycerol dissimilation appears to be the next target to work on. There are two routes responsible for glycerol catabolism in E. coli: the fermentative pathway mediated by gldA and dhaKLM and the aerobic pathway consisting of glpK and glpD. Two additional strains were thus generated from strain BLac-2103. Strain BLac-2104-AK harbors both gldA and dhaKLM under the control of PλPR, while strain BLac-2104-KD carries the PλPR-driven glpK and glpD. By quantitative RT-PCR, the expression level of gldA and dhaKLM in strain BLac-2104-AK was higher than that in strain BLac-2103 by 1.5- and 14-fold, respectively. Meanwhile, the GlpK and GlpD activities in strain BLac-2104-KD were increased by 1.2- and 4-fold, respectively. However, the catabolism of crude glycerol for these two strains was not improved (data not shown). In agreement with the previous report,23 the amplification of two glycerol-dissimD

DOI: 10.1021/acs.jafc.5b04162 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry ilation pathways has no effect on glycerol utilization of the strain. This indicates that the potential bottlenecks are present elsewhere in the cell metabolism. The glycolytic pathway from DHAP to pyruvate is a common pathway utilized by dissimilation of various sugars and likely is not limited. Therefore, we decided to evolve strain BLac-2104-KD for a better trait. This strain carries the aerobic pathway of glycerol dissimilation, which constitutes a redox-balanced pathway for the synthesis of D-lactate from glycerol (Figure 1). Consequently, the performance of an evolved strain grown on crude glycerol was comparable to that of strain BLac-2103 grown on pure glycerol (Figure 3). This evolved strain was designated BLac-2105 and was employed for further investigation. Production of D-Lactate by a Bioreactor. A fermentative condition is favorable for D-lactate production. Therefore, a bench bioreactor was implemented to control the DO tension of the culture broth, and a two-phase fermentation scheme was carried out. In the first phase, the strain was grown on crude glycerol under aerobic conditions and D-lactate was rarely produced. Upon entry into the stationary growth of the cell, the second phase was initiated by controlling the DO below 1% of the saturated DO level and adding extra crude glycerol (Figure 4a). D-Lactate started to largely accumulate during this time period. After 30 h of fermentation, the strain consumed 62 g/L crude glycerol and produced 35 g/L D-lactate. Overall, the volumetric productivity and the conversion yield for D-lactate reached 1.7 g/L/h and 55% of the theoretical maximum, respectively. A recent study reported that the formate channel FocA plays a physiological function in preventing the intracellular accumulation of organic acids.26 The high accumulation of Dlactate likely triggers a feedback control circuit, which may interfere with the cell physiology and discourage D-lactate production. Therefore, an increase in the FocA level may help circumvent the intracellular accumulation of D-lactate in the producer strain. To do so, focA of strain BLac-2105 was fused with PλPR. The resulting strain BLac-2106 was then fermented in a similar way. As a result, the strain produced around 50 g/L D-lactate from 63 g/L crude glycerol at 30 h (Figure 4b). The conversion yield and the volumetric productivity for D-lactate account for 85.2% of the theoretical maximum and 2.6 g/L/h, respectively. Production of D-Lactate by Fed-Batch Fermentation. Next, we attempted to improve the D-lactate production titer by a substrate-feeding strategy. A higher productivity is envisioned by a high cell density. Therefore, yeast extract was chosen as a nutrient supplement to increase the bacterial growth and biomass in the first phase of fermentation. The effect on the bacterial growth was investigated by varying the weight of crude glycerol to yeast extract (defined as the C/N ratio) in the culture medium. Grown in a shake flask, strain BLac-2106 exhibited the highest specific growth rate (ca. 0.56 per hour) at a C/N ratio between 0.55 and 0.75. In general, the specific growth rate of the strain was within 0.42−0.5 per hour at a C/ N ratio of 0.1−0.5 and 0.48−0.42 per hour at a C/N ratio of 0.8−1.0. Accordingly, the bacterial culture was grown with the medium containing a C/N ratio of 0.6. As depicted in Figure 5, the strain reached its final cell density at 10 h. From then on, the substrate feeding was initiated with an indicated rate. During the fermentation phase, D-lactate started to largely accumulate along the time course. The production titer of Dlactate with 99.9% optical purity finally reached 105 g/L from 121 g/L crude glycerol at 40 h, which accounts for a conversion

Figure 4. Fermentation profiles of recombinant strains using bench fermenters. Recombinant strains were cultured with bench fermenters containing NBS medium with 35 g/L crude glycerol. Upon entry into the stationary growth phase, 37 g of crude glycerol was additionally added into the culture. The experiments were duplicated with a standard deviation of less than 10%. For clarity, a typical fermentation profile is shown. (a) Fermentation profile of strain BLac-2105. (b) Fermentation profile of strain BLac-2106. Symbols: cell mass (●); Dlactate (■).

yield of 0.87 g/g of glycerol. The volumetric and specific productivities for D-lactate were estimated to reach 2.63 g/L/h and 0.47 g/g of cells/h, respectively. There are only a limited number of studies focusing on production of L-lactate27 and D-lactate from crude glycerol.23,28 In one study,23 an E. coli strain (LA02Δdld) was equipped with enhanced glpD−glpK and mutated by deletion of adhE, dld, f rdA, and pta. Consequently, the shake-flask culture resulted in 32 g/L D-lactate from 40 g/L crude glycerol, accounting for a conversion yield of 0.8 g/g of glycerol. Strain LA02Δdld exhibits volumetric and specific productivities for D-lactate reaching 1.5 g/L/h and 1.25 g/g of cells/h, respectively. In the other study,28 an isolated wild-type E. coli strain was constructed by deletion of ackA-pta, adhE, dld, frdA, pf lB, poxB, and pps. By overexpression of endogenous ldhA, the engineered strain was cultured in a bioreactor and produced DE

DOI: 10.1021/acs.jafc.5b04162 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Journal of Agricultural and Food Chemistry

■

REFERENCES

(1) Abdel-Rahman, M. A.; Tashiro, Y.; Sonomoto, K. Recent advances in lactic acid production by microbial fermentation processes. Biotechnol. Adv. 2013, 31, 877−902. (2) Drumright, R. E.; Gruber, P. R.; Henton, D. E. Polylactic acid technology. Adv. Mater. 2000, 12, 1841−1846. (3) Hofvendahl, K.; Hahn-Hägerdal, B. Factors affecting the fermentative lactic acid production from renewable resources. Enzyme Microb. Technol. 2000, 26, 87−107. (4) da Silva, G. P.; Mack, M.; Contiero, J. Glycerol: a promising and abundant carbon source for industrial microbiology. Biotechnol. Adv. 2009, 27, 30−39. (5) Yang, F.; Hanna, M. A.; Sun, R. Value-added uses for crude glycerol–a byproduct of biodiesel production. Biotechnol. Biofuels 2012, 5, 13. (6) Yazdani, S. S.; Gonzalez, R. Anaerobic fermentation of glycerol: a path to economic viability for the biofuels industry. Curr. Opin. Biotechnol. 2007, 18, 213−219. (7) Clomburg, J. M.; Gonzalez, R. Biofuel production in Escherichia coli: the role of metabolic engineering and synthetic biology. Appl. Microbiol. Biotechnol. 2010, 86, 419−434. (8) Yu, C.; Cao, Y.; Zou, H.; Xian, M. Metabolic engineering of Escherichia coli for biotechnological production of high-value organic acids and alcohols. Appl. Microbiol. Biotechnol. 2011, 89, 573−583. (9) Durnin, G.; Clomburg, J.; Yeates, Z.; Alvarez, P. J.; Zygourakis, K.; Campbell, P.; Gonzalez, R. Understanding and harnessing the microaerobic metabolism of glycerol in Escherichia coli. Biotechnol. Bioeng. 2009, 103, 148−161. (10) Gonzalez, R.; Murarka, A.; Dharmadi, Y.; Yazdani, S. S. A new model for the anaerobic fermentation of glycerol in enteric bacteria: trunk and auxiliary pathways in Escherichia coli. Metab. Eng. 2008, 10, 234−245. (11) Zhou, S.; Causey, T. B.; Hasona, A.; Shanmugam, K. T.; Ingram, L. O. Production of optically pure D-lactic acid in mineral salts medium by metabolically engineered Escherichia coli W3110. Appl. Environ. Microbiol. 2003, 69, 399−407. (12) Zhu, Y.; Eiteman, M. A.; DeWitt, K.; Altman, E. Homolactate fermentation by metabolically engineered Escherichia coli strains. Appl. Environ. Microbiol. 2007, 73, 456−464. (13) Zhou, L.; Niu, D. D.; Tian, K. M.; Chen, X. Z.; Prior, B. A.; Shen, W.; Shi, G. Y.; Singh, S.; Wang, Z. X. Genetically switched Dlactate production in Escherichia coli. Metab. Eng. 2012, 14, 560−568. (14) Saini, M.; Chen, M. H.; Chiang, C. J.; Chao, Y. P. Potential production platform of n-butanol in Escherichia coli. Metab. Eng. 2015, 27, 76−82. (15) Chiang, C. J.; Lee, H. M.; Guo, H. J.; Wang, Z. W.; Lin, L. J.; Chao, Y. P. Systematic approach to engineer Escherichia coli pathways for co-utilization of the glucose-xylose mixture. J. Agric. Food Chem. 2013, 61, 7583−7590. (16) Saini, M.; Wang, Z. W.; Chiang, C. J.; Chao, Y. P. Metabolic engineering of Escherichia coli for production of butyric acid. J. Agric. Food Chem. 2014, 62, 4342−4348. (17) Baba, T.; Ara, T.; Hasegawa, M.; Takai, Y.; Okumura, Y.; Baba, M.; Datsenko, K. A.; Tomita, M.; Wanner, B. L.; Mori, H. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2006, 2, 2006.0008. (18) Chiang, C. J.; Saini, M.; Lee, H. M.; Wang, Z. W.; Lin, L.-J.; Chao, Y. P. Genomic engineering of Escherichia coli by the phage attachment site-based integration system with mutant loxP sites. Process Biochem. 2012, 47, 2246−2254. (19) Chiang, C. J.; Chen, P. T.; Chao, Y. P. Replicon-free and markerless methods for genomic insertion of DNAs in phage attachment sites and controlled expression of chromosomal genes in Escherichia coli. Biotechnol. Bioeng. 2008, 101, 985−995. (20) Miller, J. H. Experiments in Molecular Genetics; Cold Spring Harbor Laboratory: Cold Spring Harbor, NY, 1972. (21) Martinez, A.; Grabar, T. B.; Shanmugam, K. T.; Yomano, L. P.; York, S. W.; Ingram, L. O. Low salt medium for lactate and ethanol

Figure 5. Production of D-lactate by fed-batch fermentation. Strain BLac-2106 was cultured with a bench fermenter containing NBS medium plus crude glycerol and yeast extract. In the production phase, crude glycerol was fed at a rate as indicated in the figure. The experiment was duplicated with a standard deviation of less than 10%. For clarity, a typical fermentation profile is shown. Symbols: cell mass (●); D-lactate (□).

lactate with a conversion yield of 0.75 g/g of glycerol by the fed-batch fermentation at 40 °C. The volumetric and specific productivities for D-lactate could reach 2.78 g/L/h and 0.28 g/g of cells/h, respectively. It is well recognized that the impurities in crude glycerol affect the microbial performance in various ways.25 In contrast to our result, these previous studies illustrated the insensitivity of their strains to 40−50 g/L crude glycerol. This discrepancy is likely attributed to the variation in crude glycerol compositions and the genetic makeup of producer strains. In conclusion, using a low-grade glycerol for production of biobased chemicals is of industrial importance. It can sustain the continued development of the biodiesel industry by lowering the downstream treatment cost of glycerol. As illustrated in this study, the combined approach of metabolic engineering, directed evolution, and fermentation technology is useful for efficient production of D-lactate from crude glycerol. This proposed strategy can be also applied for conversion of crude glycerol to other chemicals of interest.

■

Article

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected]. Phone: 886-4-22053366, ext. 7227. Fax: 886-4-22057414. *E-mail: [email protected]. Phone: 886-4-24517250, ext. 3677. Fax: 886-4-24510890. Funding

This work was supported by the Ministry of Science and Technology, Taiwan (MOST 104-2221-E-035-072 and 1042622-E-035-011-CC1). Notes

The authors declare no competing financial interest. F

DOI: 10.1021/acs.jafc.5b04162 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry production by recombinant Escherichia coli B. Biotechnol. Lett. 2007, 29, 397−404. (22) Grabar, T. B.; Zhou, S.; Shanmugam, K. T.; Yomano, L. P.; Ingram, L. O. Methylglyoxal bypass identified as source of chiral contamination in L(+) and D(−)-lactate fermentations by recombinant Escherichia coli. Biotechnol. Lett. 2006, 28, 1527−1535. (23) Mazumdar, S.; Clomburg, J. M.; Gonzalez, R. Escherichia coli strains engineered for homofermentative production of D-lactic acid from glycerol. Appl. Environ. Microbiol. 2010, 76, 4327−4336. (24) Zhu, J.; Shimizu, K. The effect of pfl gene knockout on the metabolism for optically pure D-lactate production by Escherichia coli. Appl. Microbiol. Biotechnol. 2004, 64, 367−375. (25) Chatzifragkou, A.; Papanikolaou, S. Effect of impurities in biodiesel-derived waste glycerol on the performance and feasibility of biotechnological processes. Appl. Microbiol. Biotechnol. 2012, 95, 13− 27. (26) Lü, W.; Du, J.; Schwarzer, N. J.; Gerbig-Smentek, E.; Einsle, O.; Andrade, S. L. The formate channel FocA exports the products of mixed-acid fermentation. Proc. Natl. Acad. Sci. U. S. A. 2012, 109, 13254−13259. (27) Mazumdar, S.; Blankschien, M. D.; Clomburg, J. M.; Gonzalez, R. Efficient synthesis of L-lactic acid from glycerol by metabolically engineered Escherichia coli. Microb. Cell Fact. 2013, 12, 7. (28) Chen, X. Z.; Tian, K. M.; Niu, D. D.; Shen, W.; Algasan, G.; Singh, S.; Wang, Z. X. Efficient bioconversion of crude glycerol from biodiesel to optically pure D-lactate by metabolically engineered Escherichia coli. Green Chem. 2014, 16, 342−350.

G

DOI: 10.1021/acs.jafc.5b04162 J. Agric. Food Chem. XXXX, XXX, XXX−XXX