Tagatose Using a Food-Grade Surface Display System - American

Jun 28, 2014 - In this study, a novel type of biocatalyst, L-AI from Lactobacillus fermentum CGMCC2921 displayed on the spore surface of. Bacillus sub...
0 downloads 0 Views 1MB Size
Download PDF
Article pubs.acs.org/JAFC

Efficient Production of D‑Tagatose Using a Food-Grade Surface Display System Yi Liu, Sha Li,* Hong Xu, Lingtian Wu, Zheng Xu, Jing Liu, and Xiaohai Feng State Key Laboratory of Materials-Oriented Chemical Engineering, College of Food Science and Light Industry, Nanjing University of Technology, 30 Puzhu South Road, Nanjing 211816, People’s Republic of China ABSTRACT: D-Tagatose, a functional sweetener, is commonly transformed from D-galactose by L-arabinose isomerase (L-AI). In this study, a novel type of biocatalyst, L-AI from Lactobacillus fermentum CGMCC2921 displayed on the spore surface of Bacillus subtilis 168, was developed for producing D-tagatose. The anchored L-AI, exhibiting the relatively high bioactivity, suggested that the surface display system using CotX as the anchoring protein was successfully constructed. The stability of the anchored L-AI was significantly improved. Specifically, the consolidation of thermal stability representing 87% of relative activity was retained even at 80 °C for 30 min, which remarkably favored the production of D-tagatose. Under the optimal conditions, the robust spores can convert 75% D-galactose (100 g/L) into D-tagatose after 24 h, and the conversion rate remained at 56% at the third cycle. Therefore, this biocatalysis system, which could express the target enzyme on the food-grade vector, was an alternative method for the value-added production of D-tagatose. KEYWORDS: L-arabinose isomerase, spore surface display, D-tagatose, biocatalysis

■

60 °C.11 Recently, resting Lactococcus lactis cells harboring B. longum L-AI were used for production of D-tagatose from Dgalactose in the presence of borate buffer, and the conversion (92%) was achieved at 20 g/L of substrate and 37.5 °C after 5 days.13 Xu et al.12 reported the purified L. fermentum CGMCC2921 L-AI expressed in E. coli BL21 converted Dgalactose (9 g/L) into D-tagatose with a high conversion rate of 55% with 1 mM Mn2+ after 12 h at 65 °C, and the immobilized L. fermentum CGMCC2921 L-AI could convert D-galactose (100 g/L) into D-tagatose and achieve an average conversion rate of 56% and a productivity of 2.33 g/L/h for 192 h.15 Currently, research is focused on looking for higher efficiency and more stable L-AIs to produce D-tagatose. However, apart from the efficiency and stability of L-AIs that impeded the commercial process, the genetic background of nonfood-grade strains, such as E. coli, is also undesirable for application in the food industry. Although the use of isolated enzyme can avoid whole cells mixing with the final product, the method is restricted by the time-consuming purification process and the expensive cost. Furthermore, purified enzymes are unstable for harsh environments and easily lose their activity.16 Therefore, the development of a novel biocatalytic system for the production of D-tagatose is highly anticipated. Surface display, a powerful technology that has a wide range of applications in biotechnology, such as vaccine development, bioremediation, biocatalysis, and biosensing, can effectively express and display bioactive molecules on the surface of cells.17−20 However, the proteins displayed on the outside of cells become involved in biocatalysis without the purification process.16 Among numerous systems that have been used in

INTRODUCTION D-Tagatose, a newly discovered functional sweetener, has numerous health advantages, such as being low calorie,1 having the capacity to decrease blood sugar level,2 and promoting the growth of intestinal probiotics.3 Deemed as a substitute for sucrose,4,5 D-tagatose gets increasing attention for its promising application in the food industry. Currently, D-tagatose is also being tested as a potential drug for treating type II diabetes and obesity.6 D-Tagatose is naturally present in small amounts in natural foods, such as hot cocoa,7 various cheeses, and yogurts.8 However, the wide application of D-tagatose remains limited by its high cost. The synthesis of D-tagatose is commonly carried out by chemical or enzymatic methods using D-galactose as the substrate. However, the chemical method is restricted by the energy-consuming process and the formation of byproduct and chemical waste.9 Thus, much interest has been directed to the production of D-tagatose using enzymatic methods. In biological preparation, D-tagatose is always transformed from D-galactose using L-arabinose isomerase (L-AI; EC 5.3.1.4) as catalyst. Moreover, the original microbes of the L-AIs are varied, such as Escherichia coli,10 Lactobacillus plantarum,11 Lactobacillus fermentum CGMCC2921,12 and Bif idobacterium longum NRRL B-41409.13 The optimal temperature and pH of the L-AIs from different microbes vary from one another and mostly range from 30 to 80 °C and pH 5.0−10.5. However, it is reported that a relatively high temperature (60−70 °C) and a neutral partial acidic condition (pH 6.0−6.5) were desirable for the production of D-tagatose.12,14 Considerable research has been done on the production of D-tagatose using enzymatic methods. For instance, L-AI from E. coli W3110 and expressed in E. coli JM105 exhibited optimal activity conditions at 30 °C and pH 8.0.10 It is reported that using immobilized L-AI from L. plantarum NC8 in a packed-bed bioreactor achieves 58 g/L of D-tagatose from 100 g/L of D-galactose after 90 h at pH 8.0 and © 2014 American Chemical Society

Received: Revised: Accepted: Published: 6756

April 23, 2014 June 27, 2014 June 28, 2014 June 28, 2014 dx.doi.org/10.1021/jf501937j | J. Agric. Food Chem. 2014, 62, 6756−6762

Journal of Agricultural and Food Chemistry

Article

in phosphate buffer at 4 °C without the addition of phenylmethylsulfonyl fluoride (PMSF).16 The E. coli DH5α strain, used for the plasmid amplification for nucleotide cloning and sequencing, was grown in LB medium at 37 °C. Activity Assays of the Anchored L-AI. Activity of spore surfacedisplayed L-AI was determined at 70 °C, pH 6.5, in 1 mL of 36 g/L of D-galactose and the washed spore suspension. After a 30 min reaction, the system was transferred to ice to terminate the reaction. The generated D-tagatose was first examined using the cysteinecarbazol-sulfuric acid method, and the absorbance was measured at 560 nm.29 Then, both D-tagatose and D-galactose were analyzed by high-performance liquid chromatograph (HPLC), using a Rezex RCM-Monosaccharide Ca2+ column at 80 °C with distilled water as the mobile phase at an elution rate of 0.5 mL/min. The components were analyzed with a refractive index detector RI-101.30 The HPLC and Rezex RCM-Monosaccharide Ca2+ column were purchased from Agilent (Wilmington, DE) and Phenomenex (Guangzhou, China). The standard linear graph prepared with different D-tagatose concentrations was used to calibrate the generated D-tagatose concentration from the reaction. One unit of enzyme activity is defined as the amount of displayed L-AI required to catalyze the production of 1 μmol D-tagatose per min.30 The number of spores was calculated by direct counting with a Burker chamber under an optical microscope.16 Examination for the Properties of the Anchored L-AI. To examine the properties of the anchored L-AI, 30 mL of reaction mixture in a 250 mL Erlenmeyer flask was used with variations as follows. The optimization of temperature and pH were conducted with 36 g/L of D-galactose and the washed spore suspension from 10 mL of spore fermentation broth (containing about 8.4 × 108 spores) for 30 min. The optimal temperature of the anchored L-AI was analyzed over the range of 55−90 °C. The effect of the pH on enzyme activity was determined using the standard assay conditions at 70 °C with sodium acetate (pH 4.0−6.0), phosphate (pH 6.0−8.0), and Tris-HCl (pH 8.0−9.0). In addition, the thermal stabilities of spore surface-displayed L-AI were determined by incubating the reaction mixtures at 70, 75, and 80 °C for 90 min at pH 6.5, and the residual activities were determined using the standard activity assays every 15 min. Production of D-Tagatose Using the Anchored L-AI. The optimization of substrate concentration was conducted with Dgalactose at 25, 50, 100, 150, and 200 g/L for 24 h using the washed spore suspension from 10 mL of spore fermentation broth. The optimal cell dosage was determined by using the washed spore suspension prepared from 5, 10, 20, 30, 40, 50, 60, and 70 mL of spore fermentation broth for 24 h. Sufficient shaking was performed each time before samples were obtained from the spore fermentation broth. Finally, 100 mL of reaction mixture (containing about 1.4 × 1010 spores) in a 500 mL Erlenmeyer flask was used to determine the reusability of the spore surface-displayed L-AI in the production of Dtagatose. The reusability experiments were conducted by recycling the anchored L-AI for several cycles. The concentrations of D-tagatose and D-galactose were measured by HPLC. After each biotransformation batch, the amount of spores was counted, and the activity of the anchored L-AI was assayed. Subsequently, reaction mixtures were centrifuged and the sediment was reused for another batch.

surface display, bacterial spore surface display systems have been widely used for their resistance to heat, radiation, and chemicals in a harsh environment.21 Moreover, Bacillus subtilis is classified as generally recognized as safe (GRAS) by the U.S. Food and Drug Administration, and its genetic information, spore structure, and mature genetic manipulation techniques are established, thus making it an excellent strain for a foodgrade surface display system.22−24 In the present study, a surface display system was constructed based on B. subtilis 168 for the production of Dtagatose using CotX as an anchoring protein. After active L-AI was successfully observed on the spore surface of B. subtilis 168 and a higher efficiency to catalyze D-galactose to produce Dtagatose was exhibited, the potential of using a food-grade expression system to produce D-tagatose was confirmed. To the best of our knowledge, this is the first report for D-tagatose production using anchored L-AI on the spore surface of B. subtilis 168.

■

MATERIALS AND METHODS

Chemicals. D-Tagatose (≥99% purity) and D-galactose (≥98% purity) were purchased from Aladdin Industry Co., Ltd. (Shanghai, China). Ex-Taq DNA polymerase, restriction enzymes, T4 DNA ligase, ampicillin, and erythromycin were supplied by Takara Biotechnology Co., Ltd. (Dalian, China). Trypsin and proteinase K were purchased from Sigma. All other chemicals were analytical grade. Plasmid and Strain Construction. To display L-AI on the surface of B. subtilis 168 spores, we constructed a genetic fusion: cotX-araA. The DNA fragment with the cotX (GenBank Accession No. NP_389058) promoter and structure gene from the genome of B. subtilis 168 was amplified by primers P1 and P2 (Table 1), digested

Table 1. Oligonucleotides Used In This Study oligonucleotides (forward, 5′ to 3′)

name

GCTCTAGATTACTTTGTCTGCCGACGAGA (Xba I underlined) CCGGTACCGAGGACAAGAGTGATAACTAGGATG (KpnI underlined) AGAGGTACCATGCGTAAGATGCAAGATTAC (KpnI underlined) CCGGAATTCCTACTTGATGTTGATAAAGT (EcoR I underlined)

P1 P2 P3 P4

with Xba I and KpnI, and ligated into pJS700a cloning vector to generate the plasmid pJS700a-cotX.25 The araA gene (GenBank Accession No. HM150718) was amplified from the genome of L. fermentum CGMCC2921 using primers P3 and P4 (Table 1), digested with KpnI and EcoR I, and cloned into the same restriction endonuclease sites of plasmid pJS700a-cotX to obtain the plasmid pJS700a-cotX-araA. The competent cells of B. subtilis 168 were prepared as previously described.26 The cells transformed by chemical transformation methods were cultured in 3 mL of Luria−Bertani (LB) medium at 37 °C and spread onto LB plates containing 4 μg/mL of erythromycin (Em). Plates were incubated at 37 °C overnight, and Em-resistant (Emr) clones were selected and identified using the amylase activity assay.27 To verify the amylase activity of colonies, we stained the colonies cultivated on LB plates containing 0.1% starch with iodine potassium iodide solution. Culture Conditions of the Bacterial Strains and the Purification of Spores. For the formation of spores, B. subtilis 168 was cultivated in Difco-sporulation media (DSM) as described elsewhere.28 After cultivation in DSM at 37 °C for 24 h, the spores and sporangial cells of B. subtilis 168 with recombinant plasmids were harvested by centrifugation and resuspended in 0.1 M sodium phosphate buffer (pH 6.5). The suspension was treated with 0.5% lysozyme for 1 h and then centrifuged at 5000 rpm (4470g) for 15 min. After the sediments were washed with 1 M NaCl, 1 M KCl, and phosphate buffer, the washed spores were obtained and resuspended

■

RESULTS Gene Clone and Construction of Recombinant Plasmid. To construct the recombinant plasmid, the cotX gene of the outer coat protein CotX (18.6 kDa) and the araA gene from L. fermentum CGMCC2921 were amplified successfully. Then, the cotX and araA genes were ligated into pJS700a to construct the recombinant plasmid pJS700a-cotXaraA (Figure 1), which was verified by the digestion method. DNA sequencing results also demonstrated that a correct recombinant plasmid pJS700a-cotX-araA was obtained. Transformation of the Plasmid pJS700a-cotX-araA and Activity Assays of the Anchored L -AI. The 6757

dx.doi.org/10.1021/jf501937j | J. Agric. Food Chem. 2014, 62, 6756−6762

Journal of Agricultural and Food Chemistry

Article

Figure 1. Construction of recombinant plasmid pJS700a-cotX-araA.

recombinant plasmid pJS700a-cotX-araA was transformed into B. subtilis 168, in which cotX-araA gene fusion was integrated into B. subtilis168 chromosome at amyE locus by double crossover events. As the integration of cotX-araA gene fusion at amyE locus disrupted the expression of amylase, colonies on starch-containing LB plate turned blue after staining by iodine potassium iodide solution, whereas B. subtilis 168 wild-type strain exhibited a distinctive yellow color due to the normal expression of amylase gene that resulted in hydrolysis of starch in the plate (Figure 2A). A cotX-specific promoter was used in the surface display system to initiate expression of L-AI and sporulation of B. subtilis synchronously, whereas the outer coat protein CotX expressed at the coat of B. subtilis 168 was used as an anchoring motif for the display of L-AI. Assays of the surface-displayed LAI revealed an activity value of 2.02 × 10−10 U/spore. The expression of L-AI on the external surface of B. subtilis 168 spores was verified by protease treatment. Purified spores of B. subtilis 168 (pJS700a-cotX-araA) were suspended in phosphate buffer containing 0.1% trypsin or 0.1% proteinase K for 1 h.15 A control sample with the spores was also prepared in phosphate buffer without protease. As shown in Figure 2B, the activity of spores treated by protease was markedly lower than that of intact spores. This observation was due to the addition of protease to the outside environment of spores that cannot penetrate through the spore wall. This result indicated that the 31 L-AI is located on the surface of spores. Properties of the Anchored L-AI. The optimal temperature and pH of the anchored L-AI were first examined in the present study. As shown in Figure 3, using D-galactose (36 g/L) as the substrate, the highest conversion efficiency of D-galactose was detected at 70 °C and pH 6.5. Enzyme stability is an important factor in the long-term commercial application of an enzymatic bioconversion.32 In the temperature range of 65−80

Figure 3. Effect of temperature (■) and pH (▲) on the displayed LAI.

°C, the relative activity of the anchored L-AI remained >70% of the highest level, which suggested that the thermal stability was improved compared with the recombinant L-AI expressed in E. coli.12 To verify this speculation, we examined the stability of the displayed L-AI treated at different temperatures. As shown in Figure 4, the activities of anchored L-AI incubated at 70 and

Figure 4. Thermostability of anchored L-AI incubated at (▼) 70 °C, (▲) 75 °C, and (■) 80 °C. The initial activity was defined as 100%.

75 °C for 30 min were not significantly decreased, and the relative activity even retained >75% of the highest level when incubated at 80 °C for 45 min. Moreover, within the pH range of 6.0−7.5, the relative activity of surface-displayed L-AI remained >90% of the highest level. These results indicated

Figure 2. (A) Identification of recombinant strains by analysis of amylase activity. (0) B. subtilis 168 as a control; (1, 2, 3, and 4) recombinant strains with amyE disruption. (B) Activities of L-AI displayed on spore surface: (□) intact spores; (■) spores treated with 0.1% trypsin for 1 h; (gray bar) spores treated with 0.1% protein K for 1 h. 6758

dx.doi.org/10.1021/jf501937j | J. Agric. Food Chem. 2014, 62, 6756−6762

Journal of Agricultural and Food Chemistry

Article

Figure 5. (A) Effect of the D-galactose concentration. (B) Effect of the recombinant spore dosage.

that the spore surface-displayed L-AI exhibited high biotransformation capability toward D-galactose over wide ranges of temperature and pH. Biocatalytic Production of D-Tagatose Using the Anchored L-AI. To obtain the maximum D-tagatose yield and efficiently utilize the substrate at the same time, we studied the concentration of D-galactose in the efficient production of D-tagatose using the washed spore suspension from 10 mL of spore fermentation broth. As shown in Figure 5A, an increase in D-galactose concentrations resulted in a decrease in conversion rate and an increase in D-tagatose yield. Although the conversion rate was 84% at the reaction system with 25 g/L of D-galactose, the D-tagatose yield was 0.85 g/L/h. On the contrary, the D-tagatose yield was improved to 2.78 g/L/h at the reaction system with 200 g/L of D-galactose, but the conversion rate decreased markedly (35%), which may lead to the low production efficiency and the waste of raw materials. On the basis of the above analysis, 100 g/L of D-galactose, with which the conversion rate was 51% and the D-tagatose yield was 2.01 g/L/h at the reaction system, was chosen as the optimal concentration for D-tagatose production. Then, we analyzed the effect of the dosage of spore fermentation broth on this biotransformation. The different dosages of spore fermentation broth were added into the reaction mixture containing 100 g/L of D-galactose as the substrate. After the biotransformation at 70 °C for 24 h, the optimum dosage of spore fermentation broth was confirmed to be 50 mL (Figure 5B), corresponding to an ∼75% yield of Dtagatose. In investigating the reusability of spore surface-displayed LAI, the reactions were conducted under the optimal transformation conditions (Figure 6). After each reaction cycle, spores with anchored L-AI were isolated by centrifugation and then washed with 0.1 M phosphate sodium buffer (pH 6.5). The anchored L-AI maintained high specific activities (1.72 × 10−10 U/spore, 85% of the initial activity) toward D-galactose within 5 reaction cycles. The conversion rate was maintained at 56% at the third cycle. However, the amount of spores decreased significantly after three cycles and only 20% of the initial amount was retained at the end of the fifth cycle. The biotransformation rate of the anchored L-AI was also gradually decreased from 75% to 19% at the end of the fifth cycle.

Figure 6. Recycling of spore surface-displayed L-AI for the production of D-tagatose. (■) Biotransformation rate of D-galactose; (□) residual amount of spores; (gray bar) residual activity of spore surfacedisplayed L-AI. The initial addition amount of spores and specific activity was defined as 100%.

remains controversial in application of the food industry, and the time-consuming purification processes restricted the use of an isolated enzyme. Therefore, it was important to explore the possibility of producing D-tagatose using L-AI carried by foodgrade whole cells or a natural structure of cells, such as spores. It is reported that bacterial spores may be good carriers of target proteins. Spores of B. subtilis are generally recognized as safe microbial resources and are used as additives in human and animal food. Moreover, B. subtilis draws considerable attention for its advantages of mature molecular genetic manipulation and detailed knowledge of its spore structure. All of these attributes make spores of B. subtilis an appealing medium for displaying heterogeneous proteins on its surface. In the present study, we introduced a novel system using the natural and robust spores of B. subtilis 168 with L-AI displayed on the surface for the enzymatic synthesis of D-tagatose. The spores of B. subtilis are encased in a protective coat consisting of an inner and an outer layer, which are composed of >70 different proteins.33 Most of the proteins successfully used in surface display were located in the outer layer, such as CotB, CotC, and CotG. Of these, CotB and CotC have always been used in the production of vaccines and antigens,17,34 and CotG was reportedly used in biocatalysis with whole cells.16,35 CotX, another outer spore coat protein, has not been documented in the application of displaying heterogeneous enzymes on the spore surface. CotX is synthesized inside the sporulating mother cells and deposited on the spore surface as spores emerge.33 In the present study, we finally generated fusion protein CotX-AI, which was anchored on the spore surface of B. subtilis 168 successfully. According to the analysis of the biocatalytic reaction, the high conversion rate of the substrate and the stability during the recycling process

■

DISCUSSION Enzymatic synthesis of D-tagatose from D-galactose using L-AI has drawn wide attention. In previous studies, L-AI was always expressed in E. coli strains and used for D-tagatose production in the form of free enzyme or immobilized enzyme or contained in whole cells. However, the genetic background of E. coli 6759

dx.doi.org/10.1021/jf501937j | J. Agric. Food Chem. 2014, 62, 6756−6762

Journal of Agricultural and Food Chemistry

Article

lactose is also in this range. Thus, the suitable temperature and pH make the anchored L-AI a desirable enzyme for the production of D-tagatose. The wide range of temperature available also offers elasticity during the industrial production. After the optimization of the operating conditions, recombinant spores harboring the pJS700a-cotX-araA plasmid were able to catalyze 100 g/L of D-galactose into 75 g/L of Dtagatose in 24 h, and even yield 56 g/L of D-tagatose at the end of the third recycle. Compared with previous studies of L-AIs from various microorganisms with a different expression vector (Table 3), the conversion yield of the anchored L-AI is relatively higher. This result suggests that the anchored L-AI on the surface of the recombinant spores is a promising alternative for D-tagatose production. Moreover, it was expressed in a foodgrade system and excludes the lengthy purification method. However, at the fifth batch, the conversion rate of D-galactose decreased to 25% of that of the first batch. It is worth noting that the amount of spores decreased to 41% of the first batch and the specific activity of anchored L-AI remained 86%, which indicates that the decrease in the conversion yield can be mostly attributed to the reduction of spore amount. Xu et al.16 reported that the addition of nisin could inhibit the germination of Bacillus spores, which finally improved the conversion yield in the reaction by controlling the reduction of the spore amount. In addition, the reduction of spore amount may also be influenced by the environment with continuous vibrations and a high temperature solution, which is bound to damage the structure of spores to some extent. In our study, the reduction of spore amount could be mostly caused by the harsh environment. To overcome this difficulty, we are considering immobilized spores to adapt the mechanical strength during production. The cost estimate is crucial to judge the significance of a new production method. In our study, the cost estimate mainly includes the medium for culturing bacteria and the substrate used in the catalytic reaction. For instance, cost comparison of different methods used to produce 10 kg of D-tagatose is shown in Table 4, and because the culture medium used for culturing spores in our study was poor nutrition, its cost saving reached 99.1%. However, the crucial factor of the cost saving was the higher conversion yield. To produce 10 kg of D-tagatose, the substrate (D-galactose) used in our study was much lower than the research conducted by Xu et al. Finally, the different culture medium and the lower amount of substrate made the cost savings achieve 45.4%. To the best of our knowledge, this is the first report for the development of a food-grade spore surface display system for the production of D-tagatose from D-galactose by using recombinant spores. The reported system exhibited both a higher conversion yield rate and a cost-saving production

demonstrate that this surface display system can be qualified for industry application. The confirmation of the availability of CotX also enriched the choice of spore coat proteins for use in surface display technology. Existing L-AIs from wild or recombinant strains remain flawed in terms of being provided with appropriate biocatalytic temperature or pH for the industrial production of D-tagatose. For instance, L-AI from Lactobacillus sakei 23K was acidtolerant, but the enzyme was rapidly inactivated at temperatures greater than 50 °C.36 In another example, the optimal temperature of L-AI from Geobacillus thermodenitrif icans was the expected result (70 °C), but its relative activity was markedly decreased at pH 7.0.32 More examples are listed in Table 2. Conversely, Bacillus spores, which are formed in Table 2. Optimal Temperature and pH of L-AI from Various Microorganisms for Industrial Production of D-Tagatose organism Lactobacillus fermentum CGMCC2921(this work) L. fermentum CGMCC292112 Lactobacillus sakei 23K36 Bacillus licheniformis37 Alicyclobacillus acidocaldarius38 Thermoanaerobacter mathranii2 Geobacillus thermodenitrif icans31 Thermotoga maritima39

optimal temperature (°C)

optimal pH

70

6.5

65 30−40 50 65 65 70 90

6.5 5.0−7.0 7.5 6.0−6.5 8.0 8.5 7.0

response to nutrient starvation, are robust and can withstand extreme heat, desiccation, and chemicals.19 The thermal stability examined in the present study indicated that the incubation of the displayed L-AI at the temperature range of 65−80 °C within 30 min would not significantly decrease the relative activity of the enzyme. Moreover, the optimal catalytic temperature of anchored L-AI is 70 °C, whereas 92% activity was retained at 75 °C after 30 min. For the industrial production of D-tagatose from D-galactose, isomerization performed at the temperature range of 60−70 °C is the most suitable temperature condition, which is advantageous for the production, such as higher conversion yield, better sugar solubility, and lower risk of microbial contamination.1,2 However, temperatures more than 75 °C also introduce undesirable consequences, such as browning and byproducts formation.14 Furthermore, pH of 6.5, examined as the optimal pH of anchored L-AI, meet the industrial requirement for maintaining the pH within the range of 6.0−6.5. At this pH range, the browning changes can be controlled markedly,14,39 and the production processes are simplified because the optimal pH of lactose hydrolase used for producing D-galactose from

Table 3. Bioconversion of D-Galactose into D-Tagatose Using L-Arabinose Isomerases from Various Microorganisms with Different Expression Systems source organism L. fermentum CGMCC2921(this work) L. fermentum CGMCC292112 L. sakei 23K36 E. coli10 G. thermodenitrif icans32 L. plantarum NC840 B. longum13

expression system B. E. E. E. E. E. L.

subtilis 168 coli BL21 coli BL21 coli BL21 coli BL21 coli HB101 lactis

conversion conditions

substrate (g/L)

conversion rate (%)

yield (g/L/h)

70 °C, 24 h 65 °C, 24 h 40 °C, 7 h 37 °C, 24 h 65 °C, 5 h 60 °C, 6 h 35 °C, 144 h

100 100 9 10 18 9.9 300

75 ± 3.5 55 36 43 46 30 36

3.13 ± 0.15 2.29 0.46 0.18 1.66 0.50 0.75

6760

dx.doi.org/10.1021/jf501937j | J. Agric. Food Chem. 2014, 62, 6756−6762

Journal of Agricultural and Food Chemistry

Article

Table 4. Cost Comparison of Different Methods to Produce 10 kg of D-Tagatosea method 112 materials culture medium

total-1c substrate total-2c

tryptone beef extract yeast extract inorganic saltb D-galactose

method 2 (this study)

cost ($/t)

amount (kg)

cost ($)

amount (kg)

3 160 1 200 3 300

6.667

21.068

0.0258 0.0077

0.0815 0.0092

3.333 6.667

10.999 6.107 38.174 666.667 704.841

0.4662

0.2523 0.343 384.615 384.958

20 000

33.333

19.231

cost ($)

cost savings (%)

99.1 42.3 45.4

a

The analysis of cost to produce 10 kg of D-tagatose was based on the best result in our study. bThe inorganic salt of method 1 represents NaCl in LB culture medium, and the inorganic salt of method 2 represents NaCl, KCl, MgSO4·7H2O, Ca(NO3)2, MnCl2, and FeSO4 in the DSM culture medium. cTotal-1 represents the total cost of culture medium used in different methods, and total-2 represents the total cost of culture medium and the substrate. (10) Yoon, S. H.; Kim, P.; Oh, D. K. Properties of L-arabinose isomerase from Escherichia coli as biocatalyst for tagatose production. World J. Microbiol. Biotechnol. 2003, 19, 47−51. (11) Kim, H. J.; Ryu, S. A.; Kim, P.; Oh, D. K. A feasible enzymatic process for D-tagatose production by an immobilized thermostable Larabinose isomerase in a packed-bed bioreactor. Biotechnol. Prog. 2003, 19, 400−404. (12) Xu, Z.; Qing, Y.; Li, S.; Feng, X.; Xu, H.; Ouyang, P. A novel Larabinose isomerase from Lactobacillus fermentum CGMCC2921 for Dtagatose production: Gene cloning, purification and characterization. J. Mol. Catal. B: Enzym. 2011, 70, 1−7. (13) Salonen, N.; Nyyssö lä, A.; Salonen, K.; Turunen, O. Bif idobacterium longum L-arabinose isomeraseOverexpression in Lactococcus lactis, purification, and characterization. Appl. Biochem. Biotechnol. 2012, 168, 392−405. (14) Rhimi, M.; Aghajari, N.; Juy, M.; Chouayekh, H.; Maguin, E.; Haser, R.; Bejar, S. Rational design of Bacillus stearothermophilus US100 L-arabinose isomerase: Potential applications for D-tagatose production. Biochimie 2009, 91, 650−653. (15) Xu, Z.; Li, S.; Fu, F.; Li, G.; Feng, X.; Xu, H.; Ouyang, P. Production of D-tagatose, a functional sweetener, utilizing alginate immobilized Lactobacillus fermentum CGMCC2921 Cells. Appl. Biochem. Biotechnol. 2012, 166, 961−973. (16) Xu, X.; Gao, C.; Zhang, X.; Che, B.; Ma, C.; Qiu, J.; Tao, F.; Xu, P. Production of N-acetyl-D-neuraminic acid by use of an efficient spore surface display system. Appl. Environ. Microbiol. 2011, 77, 3197− 3201. (17) Wang, X.; Chen, W.; Tian, Y.; Mao, Q.; Lv, X.; Shang, M.; Li, X.; Yu, X.; Huang, Y. Surface display of Clonorchis sinensis enolase on Bacillus subtilis spores potentializes an oral vaccine candidate. Vaccine 2014, 32, 1338−1345. (18) Kim, J.; Schumann, W. Display of proteins on Bacillus subtilis endospores. Cell. Mol. Life Sci. 2009, 66, 3127−3136. (19) Stahl, S.; Uhlen, M. Bacterial surface display: Trends and progress. Trends Biotechnol. 1997, 15, 185−192. (20) Park, J. P.; Choi, M. J.; Kim, S. H.; Lee, S. H.; Lee, H. Preparation of sticky Escherichia coli through surface display of an adhesive catecholamine moiety. Appl. Environ. Microbiol. 2014, 80, 43−53. (21) Nicholson, W. L.; Munakata, N.; Horneck, G.; Melosh, H. J.; Setlow, P. Resistance of Bacillus endospores to extreme terrestrial and extraterrestrial environments. Microbiol. Mol. Biol. Rev. 2000, 64, 548− 572. (22) Kunst, F. The complete genome sequence of the Gram-positive bacterium Bacillus subtilis. Nature 1997, 390, 249−256. (23) Driks, A. The Bacillus spore coat. Phytopathology 2004, 94, 1249−1251. (24) Setlow, P. Spores of Bacillus subtilis: Their resistance to and killing by radiation, heat and chemicals. J. Appl. Microbiol. 2006, 101, 514−525. (25) Ning, D.; Leng, X.; Li, Q.; Xu, W. Surface-displayed VP28 on Bacillus subtilis spores induce protection against white spot syndrome

method of D-tagatose. The value-added production process using surface-displayed enzymes could help meet the demand of the food industry and can generally be applicable to numerous biocatalytic reactions in other industries.

■

AUTHOR INFORMATION

Corresponding Author

*Associate Professor, Sha Li Nanjing University of Technology, State Key Laboratory of Materials-Oriented Chemical Engineering, College of Food Science and Light Industry, 30 Puzhu South Road, Nanjing 211816, People’s Republic of China. Tel./Fax: +86-25-58139433. E-mail: [email protected]. cn. Funding

This work was supported by the National Basic Research Program of China (2013CB733603), the National High Technology Research and Development Program of China (2012AA021503), the National Nature Science Foundation of China (31371732), and the Program for Changjiang Scholars and Innovative Research Team in University (IRT1066). Notes

The authors declare no competing financial interest.

■

REFERENCES

(1) Kim, P. Current studies on biological tagatose production using L-arabinose isomerase, a review and future perspective. Appl. Microbiol. Biotechnol. 2004, 65, 243−249. (2) Jorgensen, F.; Hansen, O. C.; Stougaard, P. Enzymatic conversion of D-galactose to D-tagatose: Heterologous expression and characterisation of a thermostable L-arabinose isomerase from Thermoanaerobacter mathranii. Appl. Microbiol. Biotechnol. 2004, 64, 816−822. (3) Buemann, B.; Toubro, S.; Raben, A.; Blundell, J.; Astrup, A. The acute effect of D-tagatose on food intake in human subjects. Br. J. Nutr. 2000, 84, 227−231. (4) Zehener, L. R. D-Tagatose as a low-calorie carbohydrate sweetener and bulking agent. European Patent EP 0257626 B1, 1988. (5) Marzur A. W. Functional sugar substitutes with reduced calories. European Patent EP 0341062 A3, 1989. (6) Lu, Y.; Levin, G. V.; Donner, T. W. Tagatose, a new antidiabetic and obesity control drug. Diabetes, Obes. Metab. 2008, 10, 109−134. (7) Troyono, E.; Martinez-Castro, I.; Olano, A. Kinetics of galactose and tagatose formation during heat-treatment of milk. Food Chem. 1992, 45, 41−43. (8) Levin, G. V.; Zehner, L. R.; Saunders, J. P.; Beadle, J. R. Sugar substitutes: Their energy values, bulk characteristics, and potential health benefits. Am. J. Clin. Nutr. 1995, 62, 1161S−1168S. (9) Oh, D. K. Tagatose: Properties, applications, and biotechnological processes. Appl. Microbiol. Biotechnol. 2007, 76, 1−8. 6761

dx.doi.org/10.1021/jf501937j | J. Agric. Food Chem. 2014, 62, 6756−6762

Journal of Agricultural and Food Chemistry

Article

virus in crayfish by oral administration. J. Appl. Microbiol. 2011, 111, 1327−1336. (26) Bron, S. Plasmids. In Molecular biological methods for Bacillus; Harwood, C., Cutting, S., Eds.; John Wiley and Sons: Chichester, U.K., 1990; pp 75−174. (27) Li, G.; Tang, Q.; Chen, H.; Yao, Q.; Ning, D.; Chen, K. Display of Bombyx mori Nucleopolyhedrovirus GP64 on the Bacillus subtilis Spore Coat. Curr. Microbiol. 2011, 62, 1368−1373. (28) Nicholson, W. L.; Setlow, P. Sporulation, germination and outgrowth. In Molecular biological methods for Bacillus; Harwood, C., Cutting, S., Eds.; John Wiley and Sons: Chichester, U.K., 1990; pp 391−450. (29) Haider, T.; Husain, Q. Immobilization of β-D-galactosidase from Aspergillus oryzae via immunoaffinity support. Biochem. Eng. J. 2009, 43, 307−314. (30) Zhan, Y.; Xu, Z.; Li, S.; Liu, X.; Xu, L.; Feng, X.; Xu, H. Coexpression of β-D-galactosidase and L-arabinose isomerase in the production of D-tagatose: A functional sweetener. J. Agric. Food Chem. 2014, 62, 2412−2417. (31) Kim, J. H.; Lee, C. S.; Kim, B. G. Spore-displayed streptavidin: A live diagnostic tool in biotechnology. Biochem. Biophys. Res. Commun. 2005, 331, 210−214. (32) Kim, H. J.; Oh, D. K. Purification and characterization of an Larabinose isomerase from an isolated strain of Geobacillus thermodenitrificans producing D-tagatose. J. Biotechnol. 2005, 120, 162−173. (33) Pan, J. G.; Kim, E. J.; Yun, C. H. Bacillus spore display. Trends Biotechnol. 2012, 30, 610−612. (34) Isticato, R.; Cangiano, G.; Tran, H. T.; Ciabattini, A.; Medaglini, D.; Oggioni, M. R.; Felice, M. D.; Pozzi, G.; Rizza, E. Surface display of recombinant proteins on Bacillus subtilis spores. J. . Bacteriol. 2001, 183 (21), 6294−6301. (35) Qu, Y.; Wang, J.; Zhang, Z.; Shi, S.; Li, D.; Shen, W.; Shen, E.; Zhou, J. Catalytic transformation of HODAs using an efficient metacleavage product hydrolase-spore surface display system. J. Mol. Catal. B: Enzym. 2014, 102, 204−210. (36) Rhimi, M.; Ilhammami, R.; Bajic, G.; Boudebbouze, S.; Maguin, E.; Haser, R.; Aghajari, N. The acid tolerant L-arabinose isomerase from the food grade Lactobacillus sakei 23K is an attractive D-tagatose producer. Bioresour. Technol. 2010, 101, 9171−9177. (37) Prabhu, P.; Tiwari, M. K.; Jeya, M.; Gunasekaran, P.; Kim, I. W.; Lee, J. K. Cloning and characterization of a novel L-arabinose isomerase from Bacillus licheniformis. Appl. Microbiol. Biotechnol. 2008, 81, 283−290. (38) Lee, S. J.; Lee, D. W.; Choe, E. A.; Hong, Y. H.; Kim, S. B.; Kim, B. C.; Pyun, Y. R. Characterization of a thermoacidophilic L-arabinose isomerase from Alicyclobacillus acidocaldarius: Role of Lys-269 in pH optimum. Appl. Environ. Microbiol. 2005, 71, 7888−7896. (39) Lee, D. W.; Jang, H. J.; Choe, E. A.; Kim, B. C.; Lee, S. J.; Kim, S. B.; Hong, Y. H.; Pyun, Y. R. Characterization of a thermostable Larabinose (D-galactose) isomerase from the hyperthermophilic eubacterium Thermotoga maritima. Appl. Environ. Microbiol. 2004, 70, 1397−1404. (40) Chouayekh, H.; Bejar, W.; Rhimi, M.; Jelleli, K.; Mseddi, M.; Bejar, S. Characterization of an L-arabinose isomerase from the Lactobacillus plantarum NC8 strain showing pronounced stability at acidic pH. FEMS Microbiol. Lett. 2007, 277, 260−267.

6762

dx.doi.org/10.1021/jf501937j | J. Agric. Food Chem. 2014, 62, 6756−6762