Telomerase Inhibition and Human Telomeric G-Quadruplex DNA

Subscriber access provided by UNIV OF NEWCASTLE

Article

Telomerase inhibition and human telomeric G-quadruplex DNA stabilization by a #-carboline–benzimidazole derivative at low concentration. Kranthikumar Yadav, Penchala Narasimha Rao Meka, Sudeshna Sadhu, Sravanthi Devi Guggilapu, Jeshma Kovvuri, Ahmed Kamal, Ragampeta Srinivas, Panuganti Devayani, Bathini Nagendra Babu, and Narayana Nagesh Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.7b00008 • Publication Date (Web): 24 Jul 2017 Downloaded from http://pubs.acs.org on July 25, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Biochemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Telomerase inhibition and human telomeric G-quadruplex DNA stabilization by a β-carboline–benzimidazole derivative at low concentration Kranthikumar Yadav,b M. P. Narasimha Rao,c Sudeshna Sadhu,a Sravanthi Devi Guggilapu,d Jeshma Kovvuri,c Ahmed Kamal,c,d Ragampeta Srinivas,b Panuganti Devayani,a Nagendra Babu Bathini,d Narayana Nagesh *a a CSIR- Centre for Cellular and Molecular Biology, Hyderabad-500007, India. Analytical Chemistry and Mass Spectrometry Division, CSIR-Indian Institute of Chemical Technology, Hyderabad-500007, India. c Medicinal Chemistry and Pharmacology, CSIR–Indian Institute of Chemical Technology, Hyderabad-500007, India. d Department of Medicinal Chemistry, National Institute of Pharmaceutical Education and Research (NIPER), Hyderabad-500037, India.

b

Abstract: Guanine rich regions in DNA, which can form highly stable secondary structures, namely, G-quadruplex or G4 DNA structures, affect DNA replication and transcription. Molecules that stabilize G4 DNA have attained importance in recent years. In the present study, G4 DNA stabilization, inhibition of telomerase and anticancer activity of synthetic β-carboline–benzimidazoles (5a, 5d, 5h and 5r) were studied. Among them, derivatives containing a 4-methoxyphenyl ring at C1 and 6-methoxy substituted benzimidazole at C3 (5a) was found to stabilize telomeric G-quadruplex DNA efficiently. Stoichiometry and interaction of a synthetic, β-carboline–benzimidazole derivative, namely, 3-(6-Methoxy-1H-benzo [d] imidazol-2-yl) -1-(4-methoxyphenyl) -9H-pyrido [3,4-b] indole (5a) with human intermolecular G-quadruplex DNA at low concentration was examined using electrospray ionization mass spectrometry (ESI-MS). Spectroscopy techniques indicate that 5a may intercalate between the two stacks of G-quadruplex DNA. This model is supported by docking studies. On treating cancer cells with 5a, the cell cycle arrest occurs at sub-G1 phase. Further, apoptosis assay and fluorescence microscopy studies using cancer cells indicate that 5a can induce apoptosis. Biochemical assays such as the PCR stop assay and telomerase activity assay results indicate that 5a has potential to stabilize G-quadruplex DNA, and thereby it may interfere with in vitro DNA synthesis and reduce telomerase activity. The outcomes from the present study reveal that the βcarboline–benzimidazole derivative (5a) is efficient in G-quadruplex DNA stabilization over dsDNA, inhibits telomerase activity and induces apoptosis in cancer cells.

Key words: β-carboline–benzimidazole; G-quadruplex DNA; ESI-MS; spectroscopy; flow cytometry; apoptosis; telomerase activity; stop assay. _______________________________________________________________ ∗a

Corresponding author: Tel.: +91-40-27192568; fax: +91-40-27160311; E-mail: [email protected]

ACS Paragon Plus Environment

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1. Introduction

The β-carboline alkaloids are a large group of natural and synthetic indole alkaloids that possess a common tricyclic pyrido-[3, 4-b] indole ring structure. These alkaloids are originally isolated from the seeds of Peganum harmala, a medicinal plant that has been traditionally used for hundreds of years to treat alimentary tract cancers and malaria in Northwest China.1 Some of these alkaloids are largely seen among various plants, marine creatures, insects and occur naturally in the human body. They are shown to exhibit anticancer activity through multiple mechanisms, but among the mostly accepted mechanisms are intercalation of β-carboline into DNA2,3 and inhibiting topoisomerase I and II.4,5 In our recent study, we have synthesised a series of β-carboline–benzimidazole derivatives bearing a substituted benzimidazole moiety at C3 and an aryl ring at C1 respectively and evaluated their interaction with dsDNA as well as their potential in inhibiting topoisomerase by using several biophysical and biochemical studies.6 Our study reveals that β-carboline–benzimidazole derivative, 5a interacts with dsDNA and enhances anticancer activity when compared to other synthetic β-carboline derivatives. An increased interest in β-carboline derivatives can be attributed to their diverse biological activities and several natural and synthetic β-carboline derivatives have been reported to serve as potential anticancer agents.7-9 Considering the importance of β-carboline–benzimidazole derivatives as anti-cancer agent, we have focused our attention on most promising βcarboline–benzimidazole derivative with benzimidazole at C3 and aryl ring at C1 position (5a) and tried to understand the underlying biochemical aspects involved in their potential anticancer activity.

G-Quadruplex structures are non-canonical secondary structures of DNA composed of stacked tetrads, each having planar association of four guanines arranged in a cyclic manner connected by Hoogsteen hydrogen bonds.10,11 Formation of a G-quadruplex requires the presence of monovalent cations like K+, NH4+ and Na+ at the centre.12,13 G-rich sequences with the potential to form quadruplex structure are common in genomic DNA and these have been identified in several biologically important regions, such as the telomeric ends of chromosomes,14 oncogene promoters15,16 or immunoglobulin heavy chain switch regions.17 G-Quadruplexes can fold into various conformations where the strands are oriented either in parallel or antiparallel direction and fold in either intra or intermolecular forms. Recently, several anti-cancer molecules were demonstrated to bind


Page 2 of 30

Page 3 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

and stabilize G-quadruplex DNA.18-23 Therefore, the interest on molecules that interact with and stabilize G-quadruplex DNA has been increasingly utilized as potential anticancer agents. Small molecules interact with G-quadruplexes through tetrad stacking, groove binding, loop binding and intercalation between the two stacks of G-tetrads. It was shown earlier that the synthetic and natural small molecules that stabilize G-quadruplex DNA, inhibit telomerase activity and induce apoptosis will exhibit potential anticancer activity.2429

Our previous studies indicate that 5a has potential anti-cancer properties.6 Considering

these findings and to better understand the proximity between the anticancer properties of small molecules (5a,5d,5h and 5r) and G-quadruplex DNA stabilization, we embarked upon this study using several biochemical and biophysical approaches. In addition, ESIMS technique was applied to examine the stoichiometry of interaction between the potential β-carboline–benzimidazole derivative (5a) and human telomeric G-quadruplex DNA, at low concentration (nM). G-quadruplex DNA stabilization and inhibition of telomerase by small molecules was presumed to play a crucial role in the initiation of apoptosis among cancer cells and this forms the basis of our study reported here.

2. Materials and Methods

2.1. Quadruplex forming oligonucleotide and β-carboline–benzimidazole conjugates. Synthetic oligonucleotides were purchased from BioArtis, Hyderabad and purified by reversed-phase high-performance liquid chromatography (RP-HPCL). The human telomeric region contains stretches of d(TTAGGG) sequences, that were shown to form Gquadruplex complex. The short stretch of oligonucleotide strands d(T2AG3) and d(T2AG3)2 were considered for ESI-MS and spectroscopy studies. The sequences of oligonucleotides considered from different regions of human chromosome to form quadruplex DNA structure (h-Telo, Bcl2, c-MYC, c-KIT1), the double stranded DNA (dsDNA) that are used in melting studies are depicted in Table 1. For ESI-MS experiments, 1 mM stock solution of quadruplex forming telomeric DNA sequences (d(T2AG3) and d(T2AG3)2) were prepared in 100 mM ammonium acetate buffer (pH 7.5). For the other experiments, DNA stock solution was prepared in 100 mM TE (pH 7.0). The solutions of oligonucleotides were heated to 90 °C and slowly allowed to reach room temperature. The quadruplex forming DNA samples were incubated at 4 oC for 16 h and then diluted appropriately before each experiment. 1 mM stock solution of the derivatives (5a, 5d, 5h and 5r) were prepared by dissolving a known amount of each derivative in methanol and subsequently


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 30

reduced to obtain required concentrations. The β-carboline–benzimidazole derivatives (5a,5d,5h and 5r) were synthesized and characterized by using the procedure described earlier.6 All chemicals and reagents required for the synthesis of β-carboline– benzimidazole conjugates were obtained from Aldrich (Sigma-Aldrich, St. Louis, MO, USA). The structure of β-carboline–benzimidazole derivatives (5a, 5d, 5h and 5r) and Gquadruplex DNA used in the present work is shown in Fig. 1.

FIGURE 1. (A) Diagram of G-quadruplex DNA proposed by Williamson et al 53 depicting the cyclic array of guanine bases connected to each other by hydrogen bonds of guanine. The cavity in the middle of the tetrad is usually occupied by a monovalent or divalent cation represented by a circle in the figure. (B) Representative structures of synthetic β-carboline–benzimidazole derivatives 5a, 5d, 5h and 5r.

Table 1. The sequences of oligonucleotides used in the present study that is capable of forming Gquadruplex DNA and dsDNA. S.No 1. 2. 3. 4. 5. 6. 7.

Name of the Oligonucleotide h-Telo Bcl2 c-MYC c-KIT1 Double stranded DNA (dsDNA) d(T2AG3) d(T2AG3)2

Sequence 5’- TTAGGG TTAGGG TTAGGG TTA GGG-3’ 5’-CGG GCG CGG GAG GAA GGG GGC GGG AGC-3’ 5′-TGAGGGTGGGTAGGGTGGGTAA-3′ 5′-GGGAGGGCGCTGGGAGGGAGGG-3′ 5’-CCAGTTCGTAGTAACCCAGTTC-3′ and 3′- GGTCAAGCATCATTGGGTCAAG-5′ 5’-TTAGGG-3’ 5’-TTAGGGTTAGGG-3’


Page 5 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

2.2. DNA melting studies. The potential of a synthetic molecule to stabilize DNA was assessed by monitoring the change in the DNA melting temperature (Tm) in the presence and the absence of each derivative. Melting studies were performed using ABI Lambda Spectrophotometer (Waltham, MA, USA) attached to a thermal controller. 25 µM synthetic dsDNA and different G-quadruplex DNA like h-Telo (human telomeric DNA), c-Myc, Bcl-2 and cKIT1 were taken in 0.1 cm path length quartz cuvette and absorbance (A260) was recorded initially in the absence and later in the presence of each derivative (5a, 5d, 5h and 5r). 25 µM DNA samples were taken in 100 mM TE (pH 7.0), later 25 µM of each derivative was added slowly, and absorbance was recorded at 260 nm. Absorbance values at 260 nm versus temperature were collected over the range starting from 22 °C to 85 °C. The temperature ramp was maintained at 0.1 °C/s. Each experiment was repeated thrice and the mean value was calculated. Table 2 lists the results obtained and the details of oligonucleotides as well as β-carboline–benzimidazole derivatives used in the melting studies.

Table 2. The oligonucleotides used in melting studies and the corresponding melting temperatures recorded in the absence and presence of 5a,5d,5h and 5r.

S.No

Name of the oligonucleotide

Tm (o C)

1 2 3 4. 5.

h-Telo Bcl-2 c-Myc c-KIT1 dsDNA

55 ± 2 56 ± 1 71 ± 1 53 ± 2 67± 3

∆ Tm (oC) 5a 12±3 06±2 09±1 10±2 05±3

5d 06±3 03±2 04±1 05±2 03±2

5h 04±2 05±3 04±1 03±2 02±3

5r 03±1 02±2 02±3 03±2 01±2

2.3. Mass Spectrometry (ESI-MS studies). Electrospray ionization (ESI) mass spectra were recorded using Exactive Orbitrap mass spectrometer (Thermo Scientific, USA) in negative ion mode. Data was acquired using X calibur software (Thermo Scientific). The source conditions maintained were; sheath gas (N2) pressure, 35 psi; aux. gas pressure, 5 psi; capillary temperature, 130 oC; capillary voltage, -40.0 V; tube lens offset voltage, -60 V; skimmer voltage, -40 V; vaporizer temperature, 50

o

C. Scanning parameters were: higher energy collisional induced

dissociation (HCD) gas, off; resolution, enhanced; micro scans, 1; lock masses, off; AGC


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

target, balanced and maximum injection time, 200 ms for a full-scan mass spectrum. For ESI experiments, the concentration of G-quadruplex DNA formed by d(T2AG3) and d(T2AG3)2 oligonucleotides and 5a was maintained at 10 nM. In the ESI-MS studies, Gquadruplex complex formed by short oligonucleotides (d(T2AG3) and d(T2AG3)2) were considered to yield clean mass spectra with low signal to noise ratio. In order to obtain clean spectra, all the ESI mass spectrum was recorded in the volatile ammonium acetate buffer and 20 % methanol was used to improve spraying conditions. For ESI-MS studies DNA and 5a solutions were prepared in 100 mM ammonium acetate (pH 7.5) and methanol respectively. All the sample solutions were infused into the ESI source at a current rate of 5 µl/min by using an instrument’s syringe pump and the spectra were recorded under identical experimental conditions with an average of 25-30 scans.

2.4. UV-visible titration. UV-visible absorption spectra were recorded using Perkin Elmer Lambda 35 spectrophotometer (Waltham, MA, USA) at 25 oC. All the experiments were carried out in polystyrene cuvettes to minimize binding of the derivative to the surface of the cuvettes. 25 µM of 5a was prepared in methanol and 25 µM G-quadruplex DNA formed by d(T2AG3) and d(T2AG3)2 oligonucleotides was dissolved in 100 mM TE (pH 7.0). 5a solution (1 ml) was taken in a 1 cm path length cuvette and absorption spectra were recorded in the range of 220 nm to 325 nm. Titration was carried out after each addition of 5 µl telomeric Gquadruplex DNA formed by d(T2AG3) and d(T2AG3)2 oligonucleotides. All the solutions used were freshly prepared before starting the experiment and titration was carried out until saturation point is made. After each successive addition of G-quadruplex DNA to 5a solution, samples were equilibrated for 5 min prior to measurement. The data obtained was fitted to Eq.(1), to obtain the dissociation constant (Kd) taking into account the total amount of 1:1 ratio of 5a:G-quadruplex DNA complex formed, independently of the 5a derivative binding site(s).

Kd = [G-quadruplex DNA] [5a] / [G-quadruplex DNA.5a complex] -------------------- (1)

2.5. Fluorescence titration. Fluorescence titration is a valuable technique for understanding the binding mode of small molecules with DNA and to study the electronic environment around it.30 Since 5a is highly fluorescent, its interaction with G-quadruplex DNA can be effectively monitored by


Page 6 of 30

Page 7 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

making use of native fluorescence of the 5a derivative. 5a molecules were excited at 395 nm and emission spectra were recorded from 400 nm to 500 nm. On the interaction of Gquadruplex DNA formed by d(T2AG3) and d(T2AG3)2 sequences with 5a derivative, an emission peak was observed at 437 nm and 425 nm respectively. 15 µM G-quadruplex DNA formed by d(T2AG3) and d(T2AG3)2 oligonucleotides was taken in 100 mM TE (pH 7.0) and slowly added to 15 µM 5a. Both quadruplex DNA and 5a solutions were freshly prepared prior to fluorescent measurements.

2.6. Circular Dichroism studies. Circular Dichroism studies were carried out using JASCO 815 CD spectropolarimeter (JASCO, Tokyo, Japan) to examine the changes in DNA conformation upon interaction of 5a with G-quadruplex formed by d(T2AG3) and d(T2AG3)2. The d(T2AG3) and d(T2AG3)2 solutions were prepared in 100 mM TE (pH 7.0). To 15 µM of G-quadruplex DNA about 15 µM and 30 µM of 5a (1:1 and 1:2 ratio of G-quadruplex DNA: 5a) was added and CD spectra was recorded from 220 nm to 330 nm using a 1 mm path length cuvette. The spectra were averaged over 3 scans.

2.7. Cell cycle analysis by flow cytometry. This assay was performed to assess the effect of 5a derivative on different stages of the cell cycle. Flow cytometry experiments were carried out by following the protocol reported earlier.31 As 5a was showing higher cytotoxic effect on HeLa cells,6 they were incubated with 1.0 µM and 3.0 µM concentrations of 5a for 48 h. Untreated HeLa cells were used as control. Untreated and treated cells were harvested, washed with phosphate buffered saline (PBS), fixed in ice-cold 70 % alcohol and stained with propidium iodide (PI) (Sigma Aldrich). The cell cycle assay was performed using Becton Dickinson FACSCaliber flow cytometer.

2.8. Apoptosis assay by flow cytometry. 1×106 HeLa cells were treated with 1.0 µM and 3.0 µM of 5a for 24 h and subsequently washed with 2× binding buffer and suspended in 100 µl binding buffer and Annexin-VFITC from Abcam (1.0 µg). The cells were then incubated at room temperature for 10 min, followed by the addition of 400.0 µl of binding buffer containing 1.0 µl of propidium iodide (PI) (Sigma Aldrich). Stained cells were analysed using a FACSCalibur flow cytometer from B.D Biosciences. Annexin-V-FITC and PI labelled cells were excited


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

using a 488 nm solid-state laser, and fluorescence emission intensity of FITC and PI were captured using band pass filters set at 530±30 and 613±20 nm, respectively.

2.9. Identification of apoptotic cells by Hoechst staining. 1×105 HeLa cells were seeded on 18-mm cover slips and incubated for 24 h. After incubation, cells were treated with 5a derivative, at 1.0 µM and 3.0 µM concentration for 48 h. Hoechst 33258 (Sigma Aldrich) was added to the cells at a concentration of 0.5 mg/ml and incubated for 30 min at 37 oC. Later, HeLa cells were rinsed with PBS. Cells from each cover slip were captured from randomly selected fields under a confocal microscope (Leica TCS SP5, Heidelberg, Germany) to qualitatively determine the proportion of viable and apoptotic cells based on their relative fluorescence, cell morphology and nuclear fragmentation.

2.10. PCR Stop assay. Stop assay was carried out following the procedure reported earlier.32,33 Oligonucleotides containing sequence from the human telomeric region, HTG21 and the corresponding complementary sequences HTG21rev along with a pair of mutant primers namely HTG21mut and HTG21mutrev, that cannot form G-quadruplex DNA structure due to sequence modifications were used under the same reaction conditions to examine the effect of 5a on G-quadruplex DNA stabilization. The sequence of oligonucleotides used in the PCR stop assay is presented in Table 3. Table 3. The sequences of the oligonucleotides used in the PCR stop assay S. No. 1. 2. 3. 4.

Name and the sequence of oligonucleotide HTG21: 5’- GGGTTAGGGTTAGGGTTAGGG -3’ HTG21rev: 5’- ATCGCTTCTCGTCCCTAACC -3’ HTG21mut: 5′- GAGTTAGAGTTAGAGTTAGAG -3′ HTG21mutrev 5′- ATCGCTTCTCGTCTCTAACT -3′

To the reaction mixture (25 µl) containing 10 mM Tris–HCl (pH 8.3), with 50 mM KCl, 1.5 mM Mg(OAc)2, 5 µM of HTG21 and HTG21rev oligonucleotides (incubated at 4 °C for 16 h with various concentrations 0 µM, 1 µM, 3 µM, 6 µM, and 8 µM of 5a), 1 mM dNTPs, 5 units of Taq DNA polymerase were added and polymerase chain reaction (PCR) was performed. PCR reaction was carried out, under similar conditions, with HTG21mut and HTG21mutrev oligonucleotides. PCR was carried out with HTG21 and HTG21rev


Page 8 of 30

Page 9 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

oligonucleotides in the absence of 5a, will serve as controls. Stop assay was carried out using the ABI thermal cycler (Foster City, CA, USA). PCR was done by 20 repeated cycles each having 94 °C for 15 s, 58 °C for 30 s, and 72 °C for 30 s. After PCR, 5 µl of the amplified product was loaded on a 12 % non-denaturing polyacrylamide gel with 1×TBE and stained with ethidium bromide. Band intensity was measured using Bio Rad Gel Doc XR + system (USA) and percent inhibition of DNA synthesis was calculated using Eq. (2)

Percentage of inhibition = C−L x 100 ------------- (2) C C − band intensity with control. L − band intensity with 5a derivative.

2.11. Telomerase activity assay. 2 x 105, HeLa cancer cells were seeded in a 96-well plate containing DMEM medium (Invitrogen, USA). Each well contained 0 µM, 1 µM, 3 µM, 6 µM, and 8 µM of 5a, in triplicate. Likewise, other wells having HeLa cells that is devoid of 5a were also incubated under identical conditions, to serve as controls. Cells were cultured in an incubator at 37 ˚C, 5 % CO2, and 95 % humidity for 24 h. The cells were rinsed twice with PBS and lysed using lysis buffer. The lysate was centrifuged at 16,000 g for 20 min at 4 °C and the supernatant was collected in a fresh microfuge tube and assayed according to the protocol provided with TeloTAGGG Telomerase PCR ELISA kit. The optical density of the samples was quantified at 450 nm (with a reference wavelength at 690 nm) within 30 min after addition of the stop reagent. The experiment was repeated thrice and average reading was taken. Absorbance values were reported as the A450 nm–A690 nm. The “A” denotes the activity of telomerase was calculated by following the Eq. (3).

Activity of telomerase (A) = A450nm-A690nm -------------- (3)

2.12. Docking studies. The parallel propeller type X-ray G-quadruplex DNA structure formed by human telomeres (PDB 1KF1)34 was used as a model to study the interaction between the βcarboline–benzimidazole derivative (5a) and telomeric DNA. The preparation was done using the Schrodinger’s protein preparation tool (PPrep) followed by energy minimization using OPLS 2005 force field with Polak–Ribiere Conjugate Gradient (PRCG) algorithm.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Water molecules were removed from the PDB file, whereas the missing H atoms were added to the system. The derivative structure was built using the builder feature in Maestro and the structure was prepared for docking using Ligprep 2.7 followed by molecular mechanics energy minimization using Macro model 10.1. The docking binding site was defined by means of a regular box, which included the whole receptor structure, with a volume of 125000 A3.35 These geometrically optimized structures were submitted to flexible Glide (grid-based ligand docking with energetics) docking using the “Extra Precision” (XP) mode of Glide 6.0 for evaluating their recognition against all Gquadruplex DNA conformations. Upon culmination of each docking calculation, 100 poses per derivative were generated and the best docked structure was taken using a Glide Score (G score) function. The figures were rendered with PyMOL (www.pymol.org).

2.13. Statistical analysis. The data procured from different experiments were subjected to statistical analysis using student's two-tailed unpaired t-test using GraphPad Prism software version 4.0 (San Diego, CA, USA). Data was considered significant if p value ≤ 0.05.

3. Results and discussion

3.1.G-quadruplex DNA and dsDNA melting in the presence of 5a, 5d, 5h and 5r. DNA melting studies are useful to infer the potential of β-carboline–benzimidazole derivatives (5a, 5d, 5h and 5r) in stabilizing both dsDNA and G-quadruplex DNA. Melting studies were carried out with different G-quadruplex DNA (like h-Telo, c-Myc, Bcl-2 and c-KIT1 sequences) as well as synthetic dsDNA in the presence and absence of 5a, 5d, 5h and 5r derivatives. The difference in the temperature (∆Tm) was evaluated before and after the addition of 5a, 5d, 5h and 5r derivatives to each type of DNA. Higher the ∆Tm of a complex, greater is the molecule’s ability to stabilize DNA. The melting temperatures (Tm) of dsDNA and G-quadruplex DNA formed by h-Telo, c-Myc, Bcl-2 and c-KIT1 alone were found to be 67 ± 3, 55 ± 2, 71 ± 1, 56 ± 1 and 53 ± 2 respectively. The difference in melting temperature (∆Tm), upon addition of each derivative to dsDNA and different G-quadruplex DNA (h-Telo, c-Myc, Bcl-2 and c-KIT1) is depicted in Table 2. It was found that among the synthetic β-carboline–benzimidazole derivatives considered in the study (5a, 5d, 5h and 5r), the ∆Tm was high (∆Tm ≈ 12 °C) with telomeric Gquadruplex DNA-5a (h-Telo DNA-5a) complex. This suggests that among the derivatives


Page 10 of 30

Page 11 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

considered in this study, 5a has better ability to stabilize telomeric G-quadruplex DNA more efficiently over other quadruplexes, including double standard DNA (dsDNA).

3.2. Mass Spectrometry (ESI-MS studies). 3.2.1. Human telomeric intermolecular G-quadruplex DNA interaction with 5a at low concentration. Most of the molecular interactions in majority of binding assays are monitored at micromolar concentrations. The advantage of using electrospray ionization mass spectrometry (ESI-MS), a soft ionization technique is that it permits the detection of noncovalent interactions occurring at very low concentrations. The sensitivity of ESI-MS technique was utilized to study the stoichiometry and G-quadruplex DNA-5a interaction at nanomolar (nM) concentration. The negative ion ESI mass spectra of guanine rich single strand d(T2AG3) and d(T2AG3)2 clearly exhibit the deprotonated ions corresponding to single stranded as well as intermolecular G-quadruplex DNA structures formed by both d(T2AG3) and d(T2AG3)2 oligonucleotides (Fig. SA and SB). On careful analysis of the mass spectral results, it is evident that d(T2AG3) forms four stranded G-quadruplex DNA structure, whereas d(T2AG3)2 give rise to G-quadruplex structure formed by two hairpin structures. The four stranded intermolecular quadruplex formed by d(T2AG3) as well as the two hairpin stranded quadruplex formed by d(T2AG3)2 are represented as Qa and Qb respectively.The ESI-MS spectra obtained with d(T2AG3) G-quadruplex DNA after the addition of 5a was shown in Fig. SC (under supporting information). From the negative ion ESI-MS spectrum of d(T2AG3) G-quadruplex on interaction with 5a (Fig. SC), it is evident that the d(T2AG3) quadruplex interact with 5a at 1:1 stoichiometry. It is also clear that the peaks at m/z 658 and m/z 877 correspond to the adduct ions [Qa+5a+5NH4-2H]12and [Qa+5a+5NH4-2H]9- formed due to the interaction between d(T2AG3) G-quadruplex and 5a with the charge states of -12 and -9 respectively.

Besides the negative ion species corresponding to single stranded and Gquadruplex DNA formed by two hairpin strands, the ESI-MS spectrum of d(T2AG3)2 Gquadruplex with 5a (Fig. SD) exhibits the peaks correspond to the adduct ions formed by the interaction between G-quadruplex and 5a with the charge states of -8 ([Qb+5a+5NH4H]8-) and -15 ([Qb+5a+5NH4-H]15-) respectively. The details of negative ionic species

observed in each ESI-MS spectra were listed in Table 4. The peaks corresponding to intermolecular quadruplex DNA and adduct ions formed after interaction with 5a were


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 30

shown in Fig. SA. SB, SC and SD (under supporting information) and they were marked with ‘*’. Table 4. Details of telomeric oligonucleotides used in ESI-MS study. The table showing the m/z (Relative abundance) and stoichiometry on d(T2AG3) and d(T2AG3)2 interaction with 5a.

G-Quadruplex DNA

d(T2AG3)

d(T2AG3)

d(T2AG3)2

d(T2AG3)2

Derivative name

m/z(Relative abundance)

Charge of the complex

G-Quadruplex: 5a

No derivative

614 (32) 922 (100) 933 (18) 942 (16)

([SS]3-) ([SS]2-) ([Qa+5NH4-H]8-) ([Qa+4K-2H]8-)

0:0 0:0 1:0 1:0

658 (20)

([Qa+5a+5NH4-2H]12-)

1:1

922 (100)

([SS]2-)

0:0

933 (30)

([Qa+5NH4-H]8-)

1:0

877 (41)

([Qa+5a+5NH4-2H]9-)

1:1

625 (32)

([SS]6-)

0:0

5a derivative

No derivative

5a derivative

5-

750 (12)

([SS] )

938 (20)

([SS]4-)

0:0 0:0 8-

947 (34)

([Qb+4NH4-2H] )

1:0

1263 (10)

([Qb+4NH4-2H]6-)

1:0

535 (96)

([Qb+5a+5NH4-H]15-)

1:1

750 (12)

([SS]5-)

0:0

1003 (8)

([Qb+5a+5NH4-H]8-)

1:1

1263 (8)

([Qb+4NH4-2H]6-)

1:0

Note: Qa and Qb are the quadruplex DNA structures formed by four strands of d(T2AG3) and two hairpin strands of d(T2AG3)2 respectively.

3.3. 5a and telomeric quadruplex DNA binding studies. 3.3.1. Binding mode of 5a to telomeric quadruplex DNA - a UV-visible spectroscopic study. To better understand how small molecules exhibit potential biological activity with diverse DNA macromolecules, detailed binding studies were carried out using UV-visible spectroscopy. On addition of d(T2AG3) and d(T2AG3)2 G-quadruplex DNA to β-carboline– benzimidazole derivative, (5a) solution, the complex peaked around 267 nm and 304 nm


Page 13 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

and displayed hypochromicity (Fig. 2). No isosbestic point was observed upon interaction of 5a with the G-quadruplex DNA formed by d(T2AG3) will emphasise that only one type 5a-quadruplex DNA species exists in solution. When d(T2AG3)2 was added to 5a solution, the UV absorption spectra exhibited hypochromicity and an isosbestic point was noticed at 290 nm, indicating the existence of two different species (both the bound and free 5a molecules) in equilibrium with each other. Based on the UV-visible titration results obtained, the 5a-G-quadruplex DNA dissociation constant (Kd) was calculated as described in the experimental section (Eq.1). The Kd obtained when 5a interact with d(T2AG3) and d(T2AG3)2 G-quadruplex DNA are 120 µM and 32 µM respectively. From the Kd values it is clear that d(T2AG3)2 G-quadruplex has better binding and interaction with 5a compared to d(T2AG3) G-quadruplex. Nevertheless, with UV-visible titration studies alone, is not enough to gauge G-quadruplex DNA-5a interaction. To interpret the mode of binding and extent of telomeric G-quadruplex DNA and β-carboline– benzimidazole derivative (5a) interaction, other spectroscopic studies were carried out.

FIGURE 2. UV-visible absorption spectra will illustrate the binding interaction between 5a and G-quadruplex DNA. UV-visible spectra of 5a (25 µM) obtained upon the addition of increments of 0.125 µM G-quadruplex DNA each time is depicted in this figure (A) UV-visible spectra obtained when d(T2AG3) G-quadruplex in 100 mM TE (pH 7.0) was added to 5a at 20 °C. (B) UV-visible spectra obtained when d(T2AG3)2 G-quadruplex in 100 mM TE (pH 7.0) was added to 5a at 20 °C. The arrows indicate the direction in which the absorption peak move after 5a interaction with quadruplex DNA.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

3.3.2. Fluorescence titration studies to understand 5a interaction with quadruplex DNA. Since 5a is a β-carboline–benzimidazole derivative with fluorescent property, its interaction with G-quadruplex DNA can be monitored using fluorescence spectroscopy. On the interaction of both human telomeric G-quadruplex DNA with 5a derivative, the emission peak exhibited hyperchromicity. When the interacting fluorescent molecules approached close to the DNA bases, due to exchange of fluorescence energy from the fluorescence molecule and adjacent DNA bases, the fluorescence emission signal intensity increases.36 The possibility of 5a molecule coming close to DNA bases may occur only when it inserts between two stacked base pairs of quadruplex DNA. These results demonstrate that 5a molecule may possibly intercalate with both the form of human telomeric G-quadruplex DNA. The fluorescence spectra obtained when d(T2AG3) and d(T2AG3)2 G-quadruplex DNA on interaction with 5a are shown in Fig 3.

FIGURE 3. Fluorescence spectroscopic titration of 5a with G-quadruplex DNA. Fluorescence spectra of 5a (15 µM) obtained upon the addition of increments of 0.075 µM G-quadruplex DNA each time is shown in this figure. (A) Fluorescence spectra obtained when d(T2AG3) G-quadruplex in 100 mM TE (pH 7.0) was added to 15 µM 5a at 20 oC (B) Fluorescence spectra obtained when d(T2AG3)2 G-quadruplex in 100 mM TE (pH 7.0) was added to 15 µM 5a at 20 °C. The arrows indicate the direction in which the fluorescence peak moves after quadruplex DNA addition to 5a solution.

3.3.3. Role of 5a on quadruplex DNA conformation. From UV-visible and fluorescence spectroscopy studies, it is evident that 5a may intercalate with quadruplex DNA. In order to further understand the effect of β-carboline– benzimidazole derivative (5a), on telomeric G-quadruplex DNA conformation, circular dichroism studies were performed. The G-quadruplex DNA structure formed by the short oligonucleotides d(T2AG3) and d(T2AG3)2 from the telomeric region, show positive and negative CD bands at around 260 nm and 240 nm respectively indicating the existence of parallel quadruplex DNA conformation.37 On addition of 15 µM 5a to quadruplex DNA formed by a d(T2AG3)2, the positive CD band intensity has increased followed by slight bathochromic shift, indicating good interaction and stabilization of G-quadruplex DNA.38


Page 14 of 30

Page 15 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Further, on doubling the concentration of 5a (at 1:2 ratio), the positive band intensity increased further, suggesting that at higher 5a concentration, quadruplex DNA stability has further increased. However, when 5a is added to G-quadruplex complex formed by 6 mer d(T2AG3) oligonucleotide, the positive CD band showed gradual decrease in its intensity both at 1:1 and at 1:2 G-quadruplex DNA:5a ratio. The positive CD peaks did not show any shift. These results indicate that upon addition of 5a to G-quadruplex DNA formed by 6 mer d(T2AG3) oligonucleotide, the G-quadruplex DNA structure unwinds gradually due to interaction with 5a molecule.39 CD experimental results indicate that 5a interacts with telomeric G-quadruplex DNA formed by both d(T2AG3) and d(T2AG3)2 oligonucleotides and in turn alter their conformation. The CD spectra obtained with 5a complexes and Gquadruplex DNA is shown in Fig. 4.

FIGURE 4. Circular dichroism studies demonstrate the change in the quadruplex DNA DNA conformation upon interaction with 5a. (A) CD spectra obtained with G-quadruplex formed by d(T2AG3) in 100 mM TE (pH 7.0) at 20 °C and on addition of 1:1 and 1:2 ratio of quadruplex DNA: 5a (B) CD spectra obtained with G-quadruplex formed by d(T2AG3)2 in 100 mM TE (pH 7.0) at 20 °C and on addition of 1:1 and 1:2 ratio of quadruplex DNA: 5a. In both the titration reaction, to 15 µM of each G-quadruplex DNA, 15 µM and 30 µM of 5a was added (1:1 and 1:2 ratio of Gquadruplex DNA: 5a) and CD spectra was recorded. CD spectra were averaged over 3 scans. The arrows indicate the direction of movement of CD peaks with the addition of 5a.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

3.4. PCR stop assay: an in vitro assay to show the effect of 5a on human telomeric Gquadruplex DNA stabilization. From the preceding experiments, it is evident that 5a interacts with G-quadruplex DNA and effectively stabilize the complex. This assay was aimed at understanding the effect of 5a on telomeric G-quadruplex DNA stabilization leading to inhibition of in vitro DNA synthesis. DNA synthesis will be impeded when quadruplex formed by guanine rich DNA strand is stabilized by 5a. On the other hand, if 5a could not stabilize G-quadruplex DNA under in vitro conditions, the DNA synthesis proceeds without any interruption. As a result, an intense and thick band will be seen in the 12 % non-denaturing polyacrylamide gel. As shown in Table.3, in this assay, two sets of primers were used. DNA synthesis products obtained with HTG21 and HTG21rev primers in the presence of various concentrations of 5a were shown in Fig 5C. Further, the effect of 5a on DNA synthesis inhibition was studied with HTG21 and HTG21rev primers in the absence of 5a as well as with a set of mutant HTG21 primers (HTG21mut and HTG21mut rev) which are devoid of a series of guanine bases in their sequence and as a result they cannot form G-quadruplex DNA complex. The assay results indicate that with increasing concentration of 5a, from 0µM - 8µM, the percentage of inhibition in in vitro DNA synthesis with HTG21 and HTG21rev primers has increased ≈ 6-folds (Table 5). On the other hand, when PCR was carried out with HTG21 and HTG21rev primers in the absence of 5a as well as with HTG21mut and HTG21mut rev primers, the synthetic DNA band intensity remained near constant (Fig. 5A and 5B). From this assay results it is evident that ≈ 50 % inhibition of DNA synthesis by 5a occurs at a lower concentration range (≈ 1µM-3µM). The percentage DNA synthesis inhibition was calculated using Eq.(2), mentioned under materials and methods. The percentage of DNA synthesis inhibition observed when various concentrations of 5a were added to different primers considered in this assay was shown in Table 5. About 89 % inhibition of in vitro DNA synthesis was observed when 8 µM 5a was added to HTG21 and HTG21rev primers and much less inhibition (≈ 15 %) was seen in the absence of 5a. Similarly, with mutant primers also (HTG21mut and HTG21mutrev) inhibition of in vitro DNA synthesis was minimal (≈ 14 %). A bar graph illustrating the variation in the in vitro DNA synthesis inhibition at various 5a concentrations and a schematic diagram illustrating PCR stop assay with various primers used under different experimental conditions was depicted in Fig.5D and Fig.5E respectively. Collectively, the results from this assay confirms a direct correlation between G-quadruplex DNA


Page 16 of 30

Page 17 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

stabilization and inhibition of DNA synthesis and indicate that 5a has potential to stabilize quadruplex DNA and inhibit in vitro DNA synthesis.

FIGURE 5. Stop assay is an in vitro assay to find the role of quadruplex DNA stabilization by 5a. 12% Non-denaturing PAGE shows the DNA synthesis product obtained when Taq DNA polymerase was added and PCR was carried out with HTG21 and HTG21rev primers in the presence and absence of 5a and HTG21mut and HTG21mutrev primers with 5a. Lane –A. HTG21 and HTG21rev primers in the absence of 5a; Lane - B. 5a (0−8 µ M) HTG21mut and HTG21mutrev primers; Lane-C. 5a (0−8 µ M) with HTG21 and HTG21 rev primers. Each PCR cycle was repeated 20 times and each cycle consists of 94 °C for 15 s, 58 °C for 30 s, and 72 °C for 30 s. (D) A bar graph illustrating the effect of 5a (from 0 to 8 µ M) on the percentage of in vitro DNA synthesis inhibition with various primers. Blue bars indicate- HTG21 and


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 30

HTG21rev primers without 5a; Green bars indicate- HTG21 and HTG21rev primers with 5a; Red bars indicateHTG21mut and HTG21mutrev primers with 5a. (E) A schematic representation of stop assay with HTG21 and HTG21rev primers (in the presence and absence of 5a) and HTG21mut as well as HTG21mutrev primers in the presence of 5a was illustrated.

Table 5. Percentage of in vitro DNA synthesis inhibition in the presence and absence of various concentrations of 5a with HTG21/HTG21rev primers as well as when 5a was added to HTG21mut/HTG21mutrev.

S.No

Concentration of 5a

1. 2. 3. 4. 5.

0 µM 1 µM 3 µM 6 µM 8 µM

HTG21 and HTG21rev primers without 5a 06% 09% 12% 13% 15%

HTG21 and HTG21rev primers with 5a 05% 37% 56% 75% 89%

HTG21mut and HTG21mutrev primers with 5a 07% 08% 11% 12% 14%

3.5. The role of 5a as anticancer molecule. 3.5.1. Effect of 5a on normal and cancer cell cycle. In cancer cells, the cell cycle is often deregulated and undergoes unscheduled cell divisions. Therefore, inhibition of cell cycle provides an opportunity to identify a suitable molecule to treat proliferative diseases like cancer. Several studies done earlier has shown that molecules that stabilize G-quadruplex DNA are cytotoxic to cancer cells and function as anti-cancer molecules.40,41 Recently, a quadruplex DNA stabilizing molecule was reported to arrest cell cycle at M-phase and induce apoptosis.42 Further, from the present study it is evident that 5a will stabilize G-quadruplex DNA and through MTT assay, using various β-carboline–benzimidazole derivatives and different human cancer cell lines it was found that 5a is cytotoxic to HeLa cells.6 To understand the role of 5a on different phases of the cancer cell cycle, initially, the cell cycle assay was carried out with untreated HeLa cells, and it was considered as control. The percentage of cells accumulated in subG1, G1, S and G2/M phases are 2.86 %, 63.43 %, 17.80 % and 15.84 % respectively. On treating HeLa cells with 1 µM 5a, the percentage of cells in G1 phase was reduced to 58.40 %, while the percentage of cells in subG1 phase has increased to 16.42 % (Fig 6). On further increasing the concentration to 3 µM, the population of cells in sub-G1 phase has enhanced to 50.05 %. Increase of subG1 population of cells in the cell cycle on treatment with 5a is an indication of induction of apoptosis.43 The details of the cell cycle assay and the corresponding cell cycle histograms are depicted in Table 6 and Fig. 6.


Page 19 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

FIGURE 6. Cell cycle studies indicate the effect of 5a on cell cycle arrest. (A) HeLa cells without 5a treatment (B) HeLa cells treated with 1µM 5a for 48 h (c) HeLa cells treated with 3 µM 5a for 48 h. The analysis of cell cycle distribution was performed by using propidium iodide staining method. With the increase in the concentration of 5a from 0 µM to 3 µM, the cell cycle arrest was noticed at subG1 level indicating the onset of apoptosis among HeLa cells.

Table 6. Data obtained from cell cycle study, indicating the percentage of cells distributed in different phases of cell cycle before (control) and after the addition of 1 µM and 3 µM 5a.

S.No.

Derivative

Sub G1

G1

S

G2/M

1. 2. 3.

Control 5a (1 µM) 5a (3 µM)

02.86 16.42 50.05

63.43 58.40 35.56

17.80 18.26 10.40

15.84 04.78 01.99

3.5.2. Role of 5a in apoptosis induction among cancer cells. Having demonstrated that 5a derivative effectively arrest the cell cycle at subG1 phase in HeLa cells, we then verified the percentage of cancer cells undergoing apoptosis on treatment with increasing concentration of 5a. HeLa cells, which were harvested in the absence of 5a, exhibited about 99.83 % viable cells and only 0.17 % apoptotic cells. However, if HeLa cells were treated with 1 µM 5a, the percentage of apoptotic cells


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 30

increased to 9.69 % compared to untreated HeLa cells (0.17 %). Further, upon increasing the 5a concentration to 3 µM, the percentage of apoptotic cells has further increased to 17.80 %, Fig. 7. These results indicate that 5a will induce apoptosis among HeLa cells in the concentration range 1 µM to 3 µM. The percentages of distribution of cells in different phases, are documented in Table 7.

FIGURE 7. Flow cytometry analysis to determine the percentage of apoptosis induced among HeLa cells before and after 5a treatment, was studied with Annexin V-FITC/propidium iodide (PI) staining. Annexin V-FITC vs Propidium Iodide plots (dot plots) obtained from the gated cells show the population of cells corresponding to viable or nonapoptotic (Annexin V– - PI–), early (Annexin V+ -PI–), and late (Annexin V+ -PI+) apoptotic cells. In the untreated (control) sample, the majority of cells (99.83 %) were viable and non-apoptotic (LL or Annexin V– - PI–). When cells were treated with 1 µM of 5a for 24 hours, there was an increase in early apoptotic cell population (LR or Annexin V+PI–, from 0.0 % to 4.31 %). A slight increase (5.38 %) in the (UR or Annexin V+-PI+) population was also observed which indicates late apoptotic or dead cells. On further increasing 5a concentration to 3 µM, the percentage of cells in early apoptotic stage (LR or Annexin V+-PI–) remained almost same (4.12 %) but the cell population in the late apoptotic stage (UR- Annexin V+- PI+) has increased (from 5.38 % to 13.68 %). The percentage of necrotic cells (UL- Annexin V- PI+) has slowly increased (from 0.0 % to 65.27 %) with the increase in the concentration of 5a from 0 µM to 3 µM. (a) Dot plot of HeLa cells without 5a treatment (LR + UR = 00.17 % ); (b) Dot plot of HeLa cells treated with 1 µM 5a for 24 h (LR + UR = 09.69 %); (c) Dot plot of HeLa cells treated with 3µM 5a for 24 h (LR + UR = 17.80 %). LR = Early apoptotic cells; UR= Late apoptotic cells.

Table 7. Data obtained from dot plots indicating the percentage of viable and apoptotic HeLa cells present, before and after the 5a treatment.

S.No. 1. 2. 3.

Derivative Control 5a (1 µM) 5a (3 µM)

Percentage of Viable Cells (LL) 99.83% 41.67% 16.93%

Percentage of apoptotic cells UR LR 00.17% 00.00% 05.38% 04.31% 13.68% 04.12%

LL- Lower left quadrant in the dot plot; LR- Lower right quadrant in the dot plot; UR- Upper right quadrant in the dot plot.


Page 21 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

3.6. Confocal microscopy: Identification of apoptotic cells using Hoechst staining. Induction of apoptosis among cancer cells occurs due to multiple reasons. In majority of them, it was reported earlier that the primary feature observed upon onset of apoptosis is the fragmentation of nuclear DNA and chromatin condensation.44 Several apoptotic cells with condensed and fragmented DNA was noticed on treating the cells with 1 µM 5a. With further increasing the concentration of 5a to 3 µM, the number of apoptotic cells has increased. There is a significant increase in the percentage of apoptotic cells with condensed and fragmented DNA when 5a concentration was increased from 1 µM to 3 µM (Fig.8). Our earlier studies with 5a and dsDNA6, indicate that 5a possibly intercalate with double stranded DNA. Studies reported earlier emphasized that majority of synthetic small molecules like doxorubicin,45 mitoxantrone,46 acridine orange47 exhibit anticancer activity through dsDNA intercalation.48 We speculate that an enhanced anticancer activity of 5a may be due to its intercalation with dsDNA as well as G-quadruplex DNA stabilization.

FIGURE 8. A confocal microscopy pictures showing morphological variation among apoptosis induced HeLa cells, stained with Hoechst 33258. HeLa cells were treated with 5a for 48 h (A) Untreated HeLa cells (control) do not show chromatin condensation and fragmented nucleus. (B) HeLa cells treated with 1 µM 5a. It shows few apoptotic cells that are wrinkled and having condensed chromatin. (C) This will depict the HeLa cells after treatment with 3 µM 5a. The condensed chromatin after Hoechst 33258 labeling can be seen as bright blue spot under the fluorescence microscope. The white arrows point the apoptotic cells which are bright blue in color, wrinkled, having condensed chromatin. Scale bars: 25 µm.

3.7. Inhibition of telomerase activity in HeLa cancer cells by 5a derivative. Chromosome ends are GC-rich and have the potential to form quadruplex structure. From DNA binding experiments and stop assay it is evident that 5a is capable of stabilizing the telomeric G-quadruplex DNA and thereby inhibit DNA synthesis. In a cell, telomere length decreases with each cell division and aging.49 It has been reported earlier that the ribonucleoprotein enzyme namely, telomerase is able to synthesize the hexanucleotide terminal ‘TTAGGG’ telomeric repeats without a template of the existing DNA strand and can thus reverse the telomere shortening.50 Since tumor cells divide continuously, the


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

activity of telomerase will be high in tumor cells compared to normal cells.51 Inhibition of telomerase by small synthetic molecules may lead to continuous telomere shortening followed by growth arrest and senescence in tumour cells. Due to this reason, telomerase was chosen as a target for antitumor therapies. Further, it was shown earlier that Telomestatin, a natural product isolated from Streptomyces anulatus 3533-SV4 and DFSPNi complex, stabilized G-quadruplex DNA and inhibited telomerase.41,52 From the present study, it is evident that 5a is efficient in stabilizing the telomeric quadruplex structure. Considering these aspects, a study to understand the potential of 5a as a telomerase inhibitor was carried out. The HeLa cells were treated with various concentrations of 5a (0 µM to 8 µM). The results obtained from the Telomerase PCR, ELISA assay indicate that 5a effectively inhibit telomerase activity in HeLa cells when compared to untreated, control HeLa cells (Fig. 9).

FIGURE 9. Telomere activity assay will indicate the activity of telomerase in HeLa cells in the presence and absence of 5a (0-8 µM). Green bars indicate the activity of telomerase in HeLa cells after they were treated with 5a. The red bars indicate the activity of telomerase in HeLa cells that are devoid of 5a. The assay was repeated thrice and the average values were considered for plotting the graph.

3.8. Docking Studies. All the studies indicate that 5a interacts and stabilizes G-quadruplex DNA. To have a closer view on the possible interaction between 5a derivative and G-quadruplex DNA, docking studies was then performed. The parallel propeller-type X-ray G-quadruplex DNA structure (PDB 1KF1)34 was used as a model to study the interaction between the synthetic 5a molecule and G-quadruplex DNA. The preparation was done using the Schrodinger’s protein preparation tool (PPrep). The details of 5a interaction with telomeric G-quadruplex DNA are depicted in (Fig 10). While analysing the binding modes, we found that the


Page 22 of 30

Page 23 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

planar pyridoindole ring and benzimidazole linker that form the central pharmacophore of 5a molecule interact strongly with the guanines of G-quadruplex DNA and protrudes in between the two stacks of quadruplex DNA complex. It was also noticed that the benzimidazole moiety may also make hydrogen bonding and electrostatic interactions with the G-quadruplex DNA. The –OCH3 and –NH groups of the benzimidazole moiety of 5a displayed hydrogen bonding with the residues dG3 and dA7 respectively. Additionally, interactions with dG2, dG4, dT5, dT6, dG8, dG9 and dG10 were also observed. All these interactions together contribute to the hypothesis that effective interaction and stabilization of the telomeric G-quadruplex DNA by 5a is possible, mostly due to the presence of linkers on the benzimidazole derivative.

Moreover, the binding modes of other benzimidazole derivatives, 5d, 5h and 5r were also analysed in detail (Fig 11). The –NH group of the benzimidazole moiety in 5d, 5h and 5r displayed hydrogen bonding with dA7. However, the compound 5h displayed additional hydrogen bonding interaction between the –OCH3 group and dG3. In comparison with 5a, the compound 5h displayed fewer interactions with dG2, dG4, dT5, dG8 and dG10. From these observations, we inferred that the presence of linkers on the benzimidazole derivatives would be effective for the interaction and stabilization of the telomeric Gquadruplex DNA. Among all the synthesized compounds, the compound 5a could effectively stabilize the telomeric G-quadruplex DNA through these interactions.

Figure 10. Putative binding mode of 5a (stick) with G-quadruplex DNA (PDB 1KF1) analysed using PyMOL molecular graphic system. 3D projection displays the hydrogen bonding interaction with dG3, dA7 (pink lines) and other non-polar interactions with G-quadruplex within 4Å distance.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 11. A) The putative binding mode of 5d with G-quadruplex; B) Binding mode of 5h with G-quadruplex; C) Binding mode of 5r with G-quadruplex. 3D projection displays the possible hydrogen bonding interaction (pink dashed lines) and other non-polar interactions with G-quadruplex within 4Å distance.

4. Conclusions It is evident that among 5a, 5d, 5h and 5r β-carboline–benzimidazole derivatives, 5a showed maximum ∆Tm, indicating its ability to effectively stabilize telomeric Gquadruplex DNA. In addition, spectroscopy studies indicate that the derivative βcarboline–benzimidazole (5a) interacts well with G-quadruplex DNA, possibly through intercalation. Additionally, 5a is efficient in inhibiting the cell cycle at subG1 phase leading to induction of apoptosis. Fluorescence microscopy studies demonstrate that 5a derivative has potential to induce apoptosis. Further, 5a is capable of showing interaction with G-quadruplex DNA and inhibit DNA synthesis. Above all, it is evident that telomerase activity was reduced in cancer cells upon 5a treatment. Molecular docking experimental results reveals that among the β-carboline–benzimidazole derivatives considered in the study, the 5a molecule exhibit higher stability to the quadruplex DNA, mostly due to the presence of linkers on the benzimidazole derivative and formation of hydrogen bonds between dG3, dA7 and –OCH3 and –NH groups.

Acknowledgements Narayana Nagesh (NN) would like to thank Director, CCMB for the support and encouragement to complete the part of the work reported here. NN is thankful to Dr. Vijaya Gopal for the useful discussions and suggestions. K.Y. is thankful to UGC, New Delhi for the award of a Senior Research Fellowship.


Page 24 of 30

Page 25 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

References

[1] Chen, Q., Chao, R., Chen, H., Hou, X., Yan, H., Zhou, S., Peng, W. and Xu, A. (2004) Antitumor and neurotoxic effects of novel harmine derivatives and structure-activity relationship analysis. Int. J. Cancer, 114, 675–682. [2] Xiao, S., Lin, W., Wang, C., and Yang, M. (2001) Synthesis and biological evaluation of DNA targeting flexible side-chain substituted β-carboline derivatives. Bioorg. Med. Chem Lett., 11, 437-441. [3] Hayashi, K., Nagao, M., and Sugimura, T. (1977) Interactions of norharman and harman with DNA. Nucleic Acids Res., 4, 3679–3685. [4] Deveau, A.M., Labroli, M.A., Dieckhaus, C.M., Barthen, M.T., Smith, K.S., and Macdonald, T. L. (2001) The synthesis of amino-acid functionalized betacarbolines as topoisomerase II inhibitors. Bioorg. Med. Chem Lett., 11, 1251-1255. [5] Zhao, M., Bi, L., Wang, W., Wang, C., Baudy-Floc’h, M., Ju, J., and Peng, S. (2006) Synthesis and cytotoxic activities of beta-carboline amino acid ester conjugates. Bioorg. Med. Chem.14, 6998-7010. [6] Kamal, A., NarasimhaRao, M.P., Swapna, P., Srinivasulu, V., Bagul, C., Shaik, A.B., Mullagiri, K., Kovvuri, J., Santhosh Reddy, V., Vidyasagar, K., and Narayana Nagesh. (2014) Synthesis of β-carboline-benzimidazole conjugates using lanthanum nitrate as a catalyst and their biological evaluation. Org. Biomol. Chem. 12(15), 2370-2387. [7] Formagio, A.S.N., Dusman, L.T.D., Foglio, M.A., Madjarof, C., Carvalho, J.E.,Costa, W. F., Cardoso, F.P., and Sarragiott, M.H. (2008) Synthesis and antitumoral activity of novel 3-(2-substituted-1,3,4-oxadiazol-5-yl) and 3-(5substituted-1,2,4-triazol-3-yl) beta-carboline derivatives. Bioorg. Med. Chem. 16, 9660-9667. [8] Wu, J., Zhao, M., Qian, K., Lee, K.H., Morris-Natschke, S., and Pen, S. (2009) Novel N-(3-carboxyl-9-benzyl-beta-carboline-1-yl)ethylamino acids: synthesis, anti-tumor evaluation, intercalating determination, 3D QSAR analysis and docking investigation. Eur. J. Med. Chem., 44 (10), 4153-4161. [9] Boursereau, Y., and Coldham, I. (2004) Synthesis and biological studies of 1-amino beta-carbolines. Bioorg. Med. Chem. Lett. 14(23), 5841-5844.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

[10] Laughlan, G., Murchie, A.I., Norman, D.G., Moore, M.H., Moody, P.C., Lilley, D.M., and Luisi, B. (1994) The high-resolution crystal structure of a parallelstranded guanine tetraplex. Science. 265, 520-524. [11] Williamson, J.R. (1994) G-quartet structures in telomeric DNA. Annu. Rev Biophys.Biomol Struct. 23, 703-730. [12] Burge, S., Parkinson, G.N., Hazel, P., Todd, A.K., and Neidle, S. (2006) Quadruplex DNA: sequence, topology and structure. Nucleic Acids Res. 34(19), 5402-5415. [13] Davis, J.T. (2004) G-quartets 40 years later: from 5'-GMP to molecular biology and supramolecular chemistry. Chem.,Int. Ed. Engl. 43(6), 668-698. [14] Patel, D.J., Phan, A.T., and Kuryavyi, V. (2007) Human telomere, oncogenic promoter and 5'-UTR G-quadruplexes: diverse higher order DNA and RNA targets for cancer therapeutics. Nucleic Acids Res. 35 (22), 7429-7455. [15] Rangan, A., Fedoroff, O.Y., and Hurley, L.H. J. (2001) Induction of duplex to Gquadruplex transition in the c-myc promoter region by a small molecule. Biol Chem. 276(7), 4640-4646. [16] Todd, A.K., Haider, S.M., Parkinson, G.N., and Neidle, S. (2007) Sequence occurrence and structural uniqueness of a G-quadruplex in the human c-kit promoter. Nucleic Acids Res. 35 (17), 5799-5808. [17] Rezler, E.M., Bearss, D.J., and Hurley, L.H. (2003) Telomere inhibition and telomere disruption as processes for drug targeting. Annu. Rev Pharmacol. Toxicol. 43, 359-579. [18] Eddy, J., and Maizels, N. (2006) Gene function correlates with potential for G4 DNA formation in the human genome. Nucleic Acids Res. 34(14), 3887-3896. [19] Hurley, L.H., Von Hoff, D.D., Siddiqui-Jain, A., and Yang, D. (2006) Drug targeting of the c-MYC promoter to repress gene expression via a G-quadruplex silencer element. Semin, Oncol. 33(4), 498-512. [20] Siddiqui-Jain, A., Grand, C.L., Bearss, D.J., and Hurley, L.H. (2002) Direct evidence for a G-quadruplex in a promoter region and its targeting with a small molecule to repress c-MYC transcription. Proc. Natl. Acad. Sci. U.S.A. 99(18), 11593-11598. [21] DeCian, A., Lacroix, L., Douarre, C., Temime-Smaali, N., Trentesaux, C., Riouand, J.F., and Mergny, J.L. (2008) Targeting telomeres and telomerase. Biochimie. 90(1), 131-155.


Page 26 of 30

Page 27 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

[22] Neidle S., and Parkinson, G. (2002) Telomere maintenance as a target for anticancer drug discovery. Nat. Rev. Drug. Discov. 1(5), 383-393. [23] OganesianL., and Bryan, T.M. (2007) Physiological relevance of telomeric Gquadruplex formation: a potential drug target. BioEssays. 29(2), 155-165. [24] Lia, W., Zhang, M., Zhang, J., Li, H., Zhang, X., Sun, Q., and Qiu. (2006) Interactions of daidzin with intramolecular G-quadruplex. FEBS Letts. 580 (20), 4905-4010. [25] Shalaby, T., Fiaschetti, G., Nagasawa, K., Shin-ya, K., Baumgartner, M., and Grotzer, M. (2013) G-quadruplexes as potential therapeutic targets for embryonal tumors. Molecules. 18(10), 12500-12537. [26] Cuenca, F., Greciano, O., Gunaratnam, M., Haider, S., Munnur, D., Nanjunda, R., Wilson, W.D., and Neidle, S. (2008) Tri- and tetra-substituted naphthalene diimides as potent G-quadruplex ligands. Bioorg. Med. Chem. Lett. 18(5), 1668-1673. [27] Gunaratnam, M., Swank, S., Haider, S.M., Galesa, K., Reszka, A.P., Beltran, M., Cuenca, F., Fletcherand J.A., Neidle. S. (2009) Targeting human gastrointestinal stromal tumor cells with a quadruplex-binding small molecule. J Med Chem. 52(12), 3774-3783. [28] Hampel, S.M., Sidibe, A., Gunaratnam, M., Riou, J.F., and Neidle. S. (2010) Tetrasubstituted naphthalene diimide ligands with selectivity for telomeric Gquadruplexes and cancer cells. Bioorg. Med Chem.Lett. 20(22) 6459-6463. [29] Collie, G.W., Promontorio, R., Hampel, S.M., Micco, M., Neidle, S., and Parkinson. G.N. (2012) Structural basis for telomeric G-quadruplex targeting by naphthalene diimide ligands. J. Am. Chem. Soc. 134(5), 2723-2731. [30] Adhikary, A., Buschmann, V., Mu Èllerand, C., and Sauer, M. (2003) Ensemble and single-molecule fluorescence spectroscopic study of the binding modes of the bis-benzimidazole derivative Hoechst 33258 with DNA. Nucleic Acids Res. 31(8), 2178-2186. [31] Justin , P J., Gupta, G., Kumar, J.M., Srinivas,G., Nagesh,N., and Therrien,B. (2013) Biological Studies of Chalcogenolato-Bridged Dinuclear Half-Sandwich Complexes. Inorg. Chem., 52, 13663−13673. [32] Zheng, X. H., Zhong, Y. F., Tan, C. P., Ji, L. N., and Mao, Z. W. (2012) Pt(II) squares as selective and effective human telomeric G-quadruplex binders and potential cancer therapeutics.Dalton Trans. 41, 11807–11812.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

[33] Wang, J. T., Zheng, X.H., Xia,Q., Mao, Z.W., Ji, L.N., and Wang. K. (2010) 1,10Phenanthroline platinum(II) complex: a simple molecule for efficient G-quadruplex stabilization. Dalton Trans. 39(31), 7214–7216. [34] Parkinson, G. N., Lee, M.P., and Neidle, S. (2002) Crystal structure of parallel quadruplexes from human telomeric DNA. Nature, 417 (6891), 876-880. [35] Alcaro, S., Musetti, C., Distinto, S., Casatti, M., Zagotto, G., Artese, A., Parrotta, L., Moraca, F., Costa, G., Ortuso, F., Maccioni, E., and Sissi, C. (2013) Identification and characterization of new DNA G-quadruplex binders selected by a combination of ligand and structure-based virtual screening approaches. J. Med. Chem.,56(3), 853-855. [36] Olmsted, J., and Kearns, D.R. (1977) Mechanism of ethidium bromide fluorescence enhancement on binding to nucleic acids. Biochemistry, 16 (16), 3647–3654. [37] Keating, L.R., and Szalai. V.A. (2004) Parallel-stranded guanine quadruplex interactions with a copper cationic porphyrin. Biochemistry. 43(50), 15891-15900. [38] Chang, Y.-M., Chen, C. K.-M., and Hou, M.-H. (2012) Conformational Changes in DNA upon ligand binding monitored by circular dichroism. Int. J. Mol. Sci., 13, 3394-3413. [39] Fukuda, H., Katahira, M., Tsuchiya, N., Enokizono, Y., Sugimura, T. Nagao, M., and Nakagama, H. (2002) Unfolding of quadruplex structure in the G-rich strand of the minisatellite repeat by the binding protein UP1. PNAS, USA, 99(20), 12685– 12690. [40] Shin-ya, K., Wierzba, K.,

Matsuo, K., Ohtani, T., Yamada, Y., Furihata, K.,

Hayakawa, Y., and Seto, H. (2001) Telomestatin a novel telomerase inhibitor from Streptomyces anulatus. J Am Chem Soc., 123(6), 1262–1263. [41] Kim, MY., Vankayalapati, H., Shin-Ya, K., Wierzba, K., and Hurley, L.H. (2002) Telomestatin a potent telomerase inhibitor that interacts quite specifically with the human telomeric intramolecular G-quadruplex. J Am Chem Soc.,124(10), 2098– 2099. [42] Tsai, Y.C., Qi, H., Lin, C.P., Lin, R.K., Kerrigan, J.E., Rzuczek,S.G., LaVoie, E.J., Rice, J.E., Pilch, D.S., Lyu, Y.L., and Liu, L.F. (2009) A G-quadruplex Stabilizer Induces M-phase Cell Cycle Arrest. J Biol.Chem., 284(34), 22535– 22543. [43] Kajstura, M., Halicka, H.D., Pryjma, J., and Darzynkiewicz, Z. (2007) Discontinuous fragmentation of nuclear DNA during apoptosis revealed by


Page 28 of 30

Page 29 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

discrete ‘‘SubG1’’ peaks on DNA content histograms. Cytometry A, 71(3), 125– 131. [44] Wyllie, A. H. (1980) Glucocorticoid-induced thymocyte apoptosis is associated with endogenous endonuclease activation. Nature, 284 (5756), 555-556. [45] Larsen, R.W., Jasuja, R., Hetzler, R.K., Muraoka, P.T., Andrada, V.G., and Lameson, D.M. (1996) Spectroscopic and molecular modeling studies of caffeine complexes with DNA intercalators. Biophys J., 70, 443–452. [46] Piosik, J., Zdunek, M., and Kapuscinski, J. (2002) The modulation by xanthines of the DNA-damaging effect of polycyclic aromatic agents. Part II. The stacking complexes of caffeine with doxorubicin and mitoxantrone. Biochem Pharmacol., 63, 635–646. [47] Lyles, M.B., and Cameron, I.L. (2002) Interactions of the DNA intercalator acridine orange, with itself, with caffeine, and with double stranded DNA. Biophys Chem., 96, 53–76. [48] Tragonos, F., Kapuscinski, J., and Darzynkiewicz, Z. (1991) Caffeine modulates the effects of DNA-intercalating drugs in vitro: A flow cytometric and spectrophotometric analysis of caffeine interaction with novantrone, doxorubicin, ellipticine, and the doxorubicin analogue AD198. Cancer Res., 51, 3682–3689. [49] Harley, C. B., Futcher, A. B., and Greider, C.W. (1990) Telomeres shorten during ageing of human fibroblasts. Nature, 345, 458–460. [50] Greider, C.W. (1998) Telomerase activity, cell proliferation, and cancer. Proc Natl Acad Sci., USA. 95, 90–92. [51] Cortez-Gonzalez, X., and Zanetti, M. (2007) Telomerase immunity from bench to bedside: round one. J. Transl. Med., 5, 1-12. [52] Ali, A., Kamra,M., Roy,S., Muniyappa,K., and Bhattacharya,S. (2017) Enhanced G-Quadruplex DNA Stabilization and Telomerase Inhibition by Novel Fluorescein Derived Salen and Salphen Based Ni(II) and Pd(II) Complexes. Bioconjugate Chem. 28, 341−352. [53] Williamson, J. R., Raghuraman, M. K., and Cech, T.R. (1989) Monovalent cationinduced structure of telomeric DNA: the G-quartet model. Cell, 59 (5), 871-80.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

For Table of Contents use only


Page 30 of 30

Telomerase Inhibition and Human Telomeric G-Quadruplex DNA

Recommend Documents