Temperature-Dependent Plasmonic Responses from Gold

Subscriber access provided by Kaohsiung Medical University

Interface-Rich Materials and Assemblies

Temperature-Dependent Plasmonic Responses from Gold Nanoparticle Dimers Linked by Double-Stranded DNA Laurent Lermusiaux, and Sébastien Bidault Langmuir, Just Accepted Manuscript • DOI: 10.1021/acs.langmuir.8b00133 • Publication Date (Web): 03 Aug 2018 Downloaded from http://pubs.acs.org on August 5, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

surface chemistries renders the longitudinal plasmon resonance of gold particle dimers nearly independent of the local temperature.

Keywords: DNA-driven self-assembly, plasmonics, single nanostructure spectroscopy, darkfield microscopy

Introduction The heat-induced disassembly of DNA-templated gold nanostructures can be used for the sequencing 1–4 or the controlled delivery 5–8 of DNA. However, when considering that groupings of various inorganic nanoparticles (metals, semiconductors or oxides), obtained through DNA hybridization, have found applications in biotechnology, 1,9–15 nanophotonics 16–22 or energetic materials, 23,24 having a low temperature-dependent stability can be an important drawback. On the other hand, nanostructures whose resonant optical responses are spectrally dependent on the local temperature could be used as smart contrast agents in functional imaging or in photothermal applications where a nonlinear response is required. Overall, for these different applications, it is crucial to analyze how the conformation of hybrid DNA-templated architectures depends on the temperature and unravel, in particular, the parameters that govern their long-term stability. 25 Previous studies have shown how melting the DNA scaffold 3,4,26 or disrupting the gold-thiol bonds between the particles and oligonucleotides 5–8 lead to the reversible or irreversible destruction of DNA-templated AuNP groupings. In this report, we perform experiments in milder conditions in order to study whether the morphology of DNA-templated nanostructures, and therefore their plasmonic properties, depend on the local temperature. By spectroscopically monitoring the plasmon resonance wavelengths of single nanostructures, we observe that the interparticle distance in AuNP dimers linked by a single DNA double-strand can shrink significantly at increasing temperatures, leading to an irreversible aggregation of the two gold nanoparticles on themselves. We attribute this phenomenon to both a disrupted 2

ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 26

surface chemistry of the gold particles and to increased thermal motion at temperatures higher than 50 ◦ C. By increasing the AuNP colloidal stability with an hydrophobic shield, DNA-linked gold particle dimers are rendered fully stable up to at least 64 ◦ C even though they also feature a larger conformational flexibility at high temperatures.

Experimental section Synthesis of AuNP dimers. DNA-linked 60 nm AuNP dimers are synthesized with two different passivating surface chemistries (chemical structures in fig. S1-a of the supporting information): a linear hydrophilic thiolated - methyl terminated - ethylene glycol hexamer (denoted EG, MW = 356.5 Da, Polypure) and a linear amphiphilic thiolated - alkyl hendecamer / ethylene glycol hexamer - carboxylic acid terminated ligand (denoted XEG, MW = 526.73 Da, Prochimia). The synthesis of EG-passivated 60 nm gold particle dimers is detailed elsewhere. 27 The synthesis of XEG-passivated 60 nm AuNP dimers is derived from a protocol developed for 40 nm gold particles that is described in detail elsewhere. 28 In brief, commercial 60 nm AuNPs (BBI) are coated with a negatively charged phosphine ligand (BSPP, Strem Chemicals) then rinsed and concentrated by centrifugation following published procedures. 27,29 The dimer assembly is driven by fully hybridizing a 50 base-long 3’-trithiolated DNA strand C (Fidelity Systems) with the 3’ end of a 5’-trithiolated 104 baselong S strand (Fidelity Systems), which is already hybridized over 50 bases at the 5’ end by an unmodified 84 base-long T strand (IDT DNA) (see inset fig 1-a for a schematic representation of the DNA template). PAGE-purified trithiolated S and T strands are hybridized in 100 mM NaCl, with a two-fold excess of T, by heating the mix at 80 ◦ C then leaving it to cool overnight. DNA functionalized AuNPs are obtained by incubating overnight 12 fmol 60 nm AuNPs with, respectively, 2 pmol and 1 pmol of trithiolated C and S+T strands in a 12 mM NaCl, 1.5 mM BSPP solution with a final volume of 10 µL. For EG-passivated dimers, AuNPs functionalized with the S+T strand are incubated with

3


Page 3 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

a 2.106 x molar excess of EG with respect to the 60 nm gold particles (24 µmol) for 30 min. The particles featuring the C strand are incubated with a 8:1 mix of the same ligand and a biotinylated / thiolated ethylene glycol hexamer (bioEG, Polypure, chemical structure in fig. S1-a). 27,29 A similar protocol is followed for XEG-passivated groupings, except that the ligand excess is reduced to 90000x (100 nmol) to avoid the formation of ligand multilayers. 28 The samples are then purified by agarose gel electrophoresis (1% weight) in 0.5x tris-borate EDTA buffer. The passivated DNA-functionalized AuNPs are cut from the gel and concentrated by centrifugation before being incubated overnight in stoechiometric amounts, in 15 mM NaCl for EG-passivated particles and 80 mM NaCl for XEG-passivated particles, to drive the formation of dimers through hybridization of the C and S+T strands. The obtained suspensions are once again purified by gel electrophoresis (0.75% weight) and concentrated by sedimentation. Images of the gels obtained for the purification of 60 nm AuNP dimers and typical cryo-EM images of the corresponding samples are provided in the supporting information (fig. S1 and S2). The DNA sequences are the following: S: 5’-trithiol-GGCTTACATGAGGAGCTTGCTTCTGCGAGAACACTCGCAGAAGCAA GCTCCTCTGCACGAAACCTGGACACCCCTAAGCAACTCCGTATCAGATGGGAAC AGCA-3’ T: 5’-TACGATAGTGGTATGATCGCTAGATCCGCAAGAGGAGCTTGCTTCTGCGAG TGTTCTCGCAGAAGCAAGCTCCTCATGTAAGCC-3’ C: 5’-TGCTGTTCCCATCTGATACGGAGTTGCTTAGGGGTGTCCAGGTTTCGTGC -trithiol-3’ Temperature-dependent scattering spectroscopy on single nanostructures. Microfluidic chambers are prepared using freshly cleaned 25 mm square glass coverslips that are stacked together with two layers of parafilm featuring a square hole (about 10 mm sides). Two micro-pipette tips (GELoader, Eppendorf) and a thermocouple (CHCO-002, Omega)

4


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 26

are introduced between the parafilm layers before melting them at 100 ◦ C to produce a 20-40 µL flow-chamber with a 250 µm height in which the local temperature can be monitored (see fig 1-a). Following published protocols, 29 the glass slides are functionalized with BSA-biotin (Merck) and NeutrAvidin (Thermo Fisher) before introducing the dimer suspension at a sub-nM concentration (45 min incubation) and rinsing the chamber with 200 µL of a 10 mM Tris, buffer solution (pH=8) that contains different NaCl concentrations depending on the AuNP surface chemistry: 5 mM for hydrophilic EG ligands and 100 mM for amphiphilic XEG ligands. The sample is positioned in an inverted optical microscope (IX71, Olympus) on top of a Peltier module (ET-032-14-15-RH-RS, Adaptive) that can heat the sample up to 46 ◦ C. The sample is illuminated with unpolarized white visible light from a 100 W halogen lamp using an air 0.8-0.92 NA darkfield condenser, after removing infrared light using a high-pass filter at 700 nm. The sample temperature can be increased up to 64 ◦ C by removing this filter and heating the sample with the Peltier module. Light scattered by the sample is collected with a 60x 0.7 NA objective. Darkfield images and spectra are collected using a color CCD camera (Quicam, Roper) or a fiber-coupled (50 µm core diameter) imaging spectrometer (Acton SP300 with Pixis 100 CCD detector, Princeton Instruments). All color images are obtained with a 100 ms acquisition time (see fig. 1-b-c-d). Polarization-dependent darkfield images can be measured by introducing a polarizer in the detection path (see fig. S6 in the SI for more details). To measure several scattering spectra in parallel (typically up to 10), the center of each AuNP grouping, with respect to the equivalent position of the fiber in the sample plane, is estimated on the color CCD image. The piezoelectric stage on which the sample is placed (P562-3CD, PI) is then programmed to align successively each grouping on the confocal detection volume of the fiber in order to measure a raw spectrum with a 5 s acquisition time. A background spectrum is measured with the same acquisition time on an empty area of the sample. The background is subtracted to the measured spectra before correction according

5


Page 5 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

to the wavelength-dependent illumination and detection (fig. 1-c-d).

Results and discussion The scattering spectroscopy of single gold nanoparticle dimers in darkfield microscopy is a powerful technique to infer nanoscale conformation information from optical measurements. 29–32 Indeed, the optical response of dimers is dominated by their longitudinally coupled mode with a corresponding resonance wavelength that varies with the interparticle distance between the AuNPs when the latter remains lower than the particle radii. 33 The idea in this study is therefore to monitor the longitudinal plasmon resonance wavelength of isolated nanostructures as a function of the temperature. A suspension of 60 nm AuNP dimers, linked by double-stranded DNA, is purified by gel electrophoresis before being introduced in a homemade flowchamber in which only one particle of each dimer binds to Neutravidin-coated glass slides, leaving the second AuNP unbound in the buffer solution. The DNA scaffold is composed of three DNA single-strands: a 50 base-long strand that is trithiolated on its 3’ side (denoted C), a 104 base-long strand that is trithiolated on its 5’ side (S) and a 84 base-long unmodified strand (T). The hybridization of the C and S strands over 50 base-pairs drives the formation of the dimers with a DNA double-strand perpendicular to the dimer axis. The S and T strands also hybridize over 54 bases to introduce a 54 bp DNA double-strand spacer along the dimer axis. One of the interests of this scaffold is that the S strand exhibits a hairpin loop in the sequence complementary to the T strand so that the removal of the T strand can lead to a reduced interparticle distance as demonstrated previously with 8 nm and 40 nm particles. 31,34 However, in all experiments performed in this study, the T strand is incorporated into the AuNP dimers during the fabrication process (see experimental section) so that the hairpin is fully hybridized and the DNA scaffold is composed of two double-stranded helices. Purified 60 nm dimer suspensions are prepared with two different passivating ligands for the

6


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 26

gold particles: either a hydrophilic thiolated ethylene glycol oligomer (denoted EG) or an amphiphilic ligand that combines a hydrophobic alkyl chain with a thiol end-group (to bind to the gold particle) to a hydrophilic ethylene glycol chain with a carboxylic acid end-group (XEG). The hydrophilic EG ligand provides a high colloidal stability to gold particles and DNA-templated AuNP dimers at moderate ionic strengths (typically Na+ concentrations of a few tens of mM). 31,35 Introducing an hydrophobic shield on the nanoparticle surface with the XEG ligand strongly increases this colloidal stability with regard to concentrations of monovalent 28,36,37 or divalent 38 cations but also minimizes surface ligand exchanges in cellular environments. 39,40 In practice, hydrophilic-hydrophobic repulsion between the head of the XEG ligand and its thiolated tail (that is linked to the AuNP surface) inhibits interpenetration of the ligand shells for two neighboring particles: this limits the minimum accessible interparticle distance. Furthermore, negative carboxylic end groups in XEG molecules provide the AuNPs with larger negative surface charges than the neutral methyl groups of EG ligands and, therefore, larger repulsive electrostatic forces between AuNPs. Both effects increase the interparticle repulsion and avoid aggregation driven by attractive Van der Waals interactions, 41 providing XEG-stabilized AuNPs with a larger colloidal stability 28,36–40 (see fig. S7 of the supporting information for a schematic representation of the balance between attractive and repulsive forces in charged colloids with surface ligands). The flowchamber, in which the dimers are introduced, features a thermocouple and is mounted on top of a heating Peltier module, to measure and control the temperature, before being introduced in a darkfield microscope as shown in fig. 1-a. Experiments are performed in buffer solutions with a controlled ionic strength (5 mM NaCl for EG ligands or 100 mM NaCl for XEG ligands). The low NaCl concentration used with EG-passivated dimers is chosen to avoid salt-induced aggregation effects that were observed in DNA-templated 40 nm AuNP dimers. 28,31 The increased 100 mM NaCl concentration used with the XEG passivating surface chemistry is to minimize detachment of dimers from the protein coated surface during the measurement, which can arise from the larger negative surface charges due to

7


Page 7 of 26

carboxylic end groups in XEG ligands or from repulsive interactions between the hydrophobic alkyl part of the ligand and the proteins covering the glass slides. 28 Overall, these two NaCl concentrations were chosen to allow a long-term stability to EG- and XEG-passivated DNA-templated dimers in the flowchamber at room temperature. Considering the doublestranded sequences that form the biochemical scaffold linking the two gold particles and the concentrations of cations (10 mM Tris and 5 mM or 100 mM NaCl), melting temperatures of the DNA template are estimated at 60 ◦ C and 77 ◦ C for EG- and XEG-passivated AuNP dimers, respectively. 42 These estimated temperatures do not take into account attractive or repulsive interactions between the gold nanoparticles that might influence the melting temperature of the entire hybrid nanostructure. Flowchamber

a Darkfield condenser

c

b

26 °C

White light

Thermocouple

64°C

Peltier module Piezoelectric stage Objective lens

d

Optical Fiber

26 °C

Removable Mirror

64°C Spectrometer Color CCD Camera

Normalized scattering intensity Normalized scattering intensity

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

1.0

EG

.8

26°C 53°C 64°C

.6 .4 .2

450 500 550 600 650 700 750 800

Wavelength (nm) 1.0

XEG

26°C 53°C 64°C

.8 .6 .4 .2

450 500 550 600 650 700 750 800

Wavelength (nm)

Figure 1: (a) Experimental setup: a flowchamber, featuring DNA-templated 60 nm AuNP dimers and a thermocouple, is positioned on top of a Peltier module in an inverted darkfield microscope (insets provide schematic representations of the flowchamber environment and of the DNA scaffold linking the two 60 nm AuNPs). (b) Typical darkfield image of 60 nm dimers passivated by hydrophilic ligands, denoted EG (scale bar is 10 µm). Typical zoomedin darkfield images of AuNP dimers passivated by the EG ligand (c, left) or by an amphiphilic ligand denoted XEG (d, left) at 26 ◦ C (top image) and 64 ◦ C (bottom image). The white dotted square in (b) corresponds to the top image of (c). Typical plasmon resonance spectra of a single EG-passivated (c, right) or XEG-passivated (d, right) 60 nm AuNP dimer at 26 ◦ C (blue data points), 53 ◦ C (green data points) and 64 ◦ C (red data points). Fig 1-b presents a typical darkfield image of EG-passivated dimers measured at room temperature. We observe isolated nanostructures as diffraction-limited points whose scattering 8


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 26

intensity and color allow us to differentiate dimers from isolated particles and larger aggregates. 31 In particular, a reference distribution of plasmon resonances for single 60 nm particles and darkfield images comparing single particles and dimers are provided in fig. S3 and S8 of the supporting information. Furthermore, polarization-resolved measurements clearly demonstrate that it is improbable to mistake single particles for dimers (see fig. S6). Therefore, large-scale darkfield images can be used to estimate the dimer purity in the final sample: 85% and 45%, respectively, for EG-passivated and XEG-passivated AuNP dimers. This difference in dimer purity comes from the quality of the electrophoretic purification step: with XEG ligands, the different bands corresponding to unreacted particles, dimers or larger assemblies are broader than with the EG ligand, indicating non-specific interactions with the agarose matrix (see Fig. S1 in the SI). Fig. 1-c-d show the typical evolution of darkfield images, from the same dimers, observed at room temperature, at 53 ◦ C and at 64 ◦ C. By spatially filtering light scattered by an isolated nanostructure using the entrance of a 50 µm multimode fiber as a confocal pinhole, it is possible to measure the plasmon resonance spectra of single 60 nm AuNP dimers as a function of the temperature as shown on fig. 1-c-d. We observe in fig 1-c, both on widefield darkfield images and in plasmon resonance spectra, that EG-passivated dimers exhibit a strong progressive redshift at temperatures of 53 ◦ C and 64 ◦ C. In particular, the spectra of fig. 1-c for a typical single EG-passivated 60 nm AuNP dimer demonstrate a 50 nm plasmon resonance wavelength redshift between 26 ◦ C and 53 ◦ C and an extra 70 nm redshift between 53 ◦ C and 64 ◦ C. Furthermore, we clearly observe on the spectra measured at 53 ◦ C and 64 ◦

C the appearance of the transverse mode of the coupled dimer around 560 nm. Inversely,

darkfield images from XEG-passivated dimers seem unchanged in this temperature range as verified in the spectra of fig. 1-d for a typical isolated dimer that features a weak 10 nm redshift between room temperature and 64 ◦ C. Complementary examples of the evolution of the plasmon resonance spectra from single EG- and XEG-passivated 60 nm AuNP dimers are provided in fig. 2-a and show a similar temperature-dependent trend. The resonance spectra

9


Page 9 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

of fig. 1 and fig. 2-a therefore indicate a strong reduction of the interparticle distance in dimers passivated by hydrophilic ligands when the temperature is raised above 50 ◦ C while the conformation of assemblies produced with amphiphilic ligands seems independent of the temperature in the studied range. Fig. 2-a also features strong variations of the relative scattered intensities from the transverse (at 560 nm) and longitudinal modes for the different dimers: this is due to the partial in-plane orientation of the dimers as discussed in the supporting information (see fig. S6). To retrieve more quantitative and statistical information on the temperature-dependent conformation of AuNP dimers, we plot in fig. 2-b-c-d the evolution of the plasmon resonance spectra of single dimers when the temperature is raised between room temperature and 64 ◦ C and when the sample is cooled back down to 28 ◦ C. These data are inferred from the analysis of, respectively, 80 and 42 isolated nanostructures with EG and XEG surface chemistries. The lower value with the amphiphilic surface chemistry is due to a lower concentration of attached nanostructures in the flowchamber and a lower dimer purity. In practice, some dimers break apart during one step of the measurement process (5 % for EG-passivated dimers and 20 % for XEG-passivated dimers), leaving a single particle on the substrate. Fig. S8 shows 3 examples in the SI of this phenomenon, demonstrating a strong blue-shift of the plasmon resonance wavelength and reduction in scattering intensity. It is important to note that the destruction of dimers in XEG-passivated nanostructures is observed with a similar probability at all studied temperatures (2 occurrences for each temperature increase between 26 ◦ C and 53 ◦ C, 3 occurrences when reaching 64 ◦ C), while the temperature always remains below the estimated melting temperature of the DNA template (77 ◦ C). Moreover, this phenomenon strongly depends on the surface chemistry as it occurs with a much lower probability in EG-passivated dimers even though the lower NaCl concentration should lead to a lower DNA melting temperature. Therefore, this disassembly process does not seem to originate predominantly from the temperature-induced melting of the DNA template, and might arise instead from repulsion between the DNA template and the hydrophobic part

10


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 26

of the XEG ligand, or from electrostatic repulsion between XEG-passivated particles that reduces the long-term stability of DNA-templated AuNP dimers. Furthermore, 5 % of analyzed nanostructures do not feature any spectral changes during the heating up and cooling down steps (all resonance wavelength shifts below 2.5 nm), indicating either dimers that are stuck in a given conformation (for instance if the AuNP without biotin groups is non-specifically adsorbed on the glass surface) or a large non-spherical single gold particle with a redshifted resonance. Such temperature-independent plasmon resonance wavelengths are always observed in single particles (see fig. S4 in SI). Finally, about 5-10 % of studied nanostructures feature non-Lorentzian shaped resonances, indicating dimers with strongly non-spherical particles or slightly larger aggregates (such as trimers), and are removed from the statistical sample (see fig. S9 in the SI for three examples). This is why the total numbers of occurrences in fig. 2-b correspond to 64 EG-passivated and 29 XEGpassivated 60 nm dimers in fig. 2-c. Fig. 2-b shows that a large majority of the statistical sample of EG-passivated dimers exhibit gradually redshifting plasmon resonance wavelengths above 50 ◦ C and that this redshift is irreversible when cooling down the sample. This trend is clearly visible in fig. 2-d that plots the average resonance wavelengths: we observe an average 60 nm redshift of the longitudinal plasmon resonance for 60 nm AuNP dimers passivated by the hydrophilic thiolated ethylene glycol ligand, followed by an extra 7 nm redshift during the cooling down process. This means that increasing the local temperature has led to a strong irreversible reduction of the interparticle distance and, probably, to the aggregation of the self-assembled nanostructures. To estimate quantitatively the conformational change experienced by 60 nm AuNP dimers as a function of the temperature, a theoretical calibration can be performed to infer average interparticle distances from the average measured wavelengths of fig. 2-d. In practice, Boundary Element Method calculations 43 were conducted to simulate the evolution of the longitudinal plasmon resonance of two 60 nm diameter gold spheres (see the measured diameter distribution in fig. S3) when the interparticle distance changes between 30 nm and 1

11


.8 .6 .4 .2

450 500 550 600 650 700 750 800

Wavelength (nm) 1.0

26°C 53°C 64°C

XEG

.8 .6 .4 .2

450 500 550 600 650 700 750 800

Wavelength (nm)

c

EG

10 5

26°C

1.0

EG

26°C 53°C 64°C

.8 .6 .4 .2

450 500 550 600 650 700 750 800

Wavelength (nm) 1.0

26°C 53°C 64°C

XEG

.8 .6 .4 .2

450 500 550 600 650 700 750 800

Wavelength (nm)

EG

26°C 53°C 64°C

.8 .6 .4 .2

450 500 550 600 650 700 750 800

Wavelength (nm) 1.0

26°C 53°C 64°C

XEG

.8 .6 .4 .2

450 500 550 600 650 700 750 800

Wavelength (nm)

d

XEG 26°C

5

1.0


26°C 53°C 64°C


EG

1.0

EG

26°C 53°C 64°C

.8 .6 .4 .2

450 500 550 600 650 700 750 800

Wavelength (nm) 1.0

26°C 53°C 64°C

XEG

.8 .6 .4 .2

450 500 550 600 650 700 750 800

Wavelength (nm)

e 660 20

35°C

10 5

560 580 600 620 640 660 680 700

560 580 600 620 640 660 680 700

560 580 600 620 640 660 680 700

10 5

53°C

560 580 600 620 640 660 680 700

64°C

560 580 600 620 640 660 680 700

53°C

5

560 580 600 620 640 660 680 700 10 5

46°C

5

Occurences

46°C

10 5

35°C

5

560 580 600 620 640 660 680 700

64°C

5

650

Average interparticle distance (nm)

560 580 600 620 640 660 680 700

Average resonance wavelength (nm)

b

1.0


a

Occurences

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir


Page 11 of 26

640

630

620

610

600

18 16 14 12 10 8 6

590

560 580 600 620 640 660 680 700

560 580 600 620 640 660 680 700

28°C

28°C

10 5

5

4 580

2 25

560 580 600 620 640 660 680 700

Wavelength (nm)

560 580 600 620 640 660 680 700

Wavelength (nm)

35

45

55

Temperature (°C)

65

25

35

45

55

65

Temperature (°C)

Figure 2: (a) Complementary examples of plasmon resonance spectra for single EGpassivated (top) or XEG-passivated (bottom) 60 nm AuNP dimers at 26 ◦ C (blue data points), 53 ◦ C (green data points) and 64 ◦ C (red data points). Distributions of longitudinal resonance wavelengths for EG-passivated (b) and XEG-passivated (c) 60 nm AuNP dimers measured when heating the sample between 26 ◦ C and 64 ◦ C (red bars in (b) and orange in (c)) and cooling it back down to 28 ◦ C (blue bars, bar is 5 nm). Evolution of the average plasmon resonance wavelength (d) and interparticle distance (e) as a function of the temperature for EG-passivated (red and blue solid lines) and XEG-passivated (orange and light blue dashed lines) 60 nm AuNP dimers. The error bar in (d) is the standard error when estimating the average values in the distributions of (b) and (c). Interparticle distances are inferred from the average plasmon resonance wavelengths and a theoretical calibration described in the SI.

12


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 26

nm (see fig. S5 and the SI for more details on the calibration method). Such calibration procedures were already successfully implemented to study the conformation of AuNP dimers using scattering spectroscopy at fixed temperatures but with varying lengths of the DNA template 29,30,32 or when changing the local ionic strength. 28,31 Fig. 2-e provides the interparticle distance changes estimated using the data of fig. 2-d and the simulated calibration. The initial distance is estimated at 12 nm for EG-passivated dimers and 17 nm for XEG-passivated dimers. These values are in qualitative agreement with the length of the 54 bp DNA double-strand (19 nm) that links the two gold nanoparticles but lower than the ones observed with 40 nm particles using the same DNA scaffold and surface chemistries (18 nm with EG-passivated dimers at 5 mM NaCl and 20 nm with XEGpassivated dimers at 100 mM NaCl). 28 The difference in distances observed with 60 nm and 40 nm particles could arise from a relative increase in interparticle attraction when increasing the volume to surface ratio of gold particles. The interparticle distance increase between EGand XEG-stabilized dimers, already observed in 40 nm AuNP dimers, is attributed to the stronger interparticle repulsion provided by carboxylic-terminated amphiphilic ligands. 28 As expected from the spectral measurements, the interparticle distance estimated in fig. 2-e reduces significantly above 50 ◦ C and reaches an estimated value below 3 nm at 64 ◦ C. Since the length of the EG ligands is estimated at 2 nm, 28 this corresponds to a partial interpenetration of the ligand shells. The extra reduction of the interparticle distance below 2.5 nm when cooling down the sample back to room temperature over 2 hours can arise from a slow aggregation of the touching AuNPs that is thermodynamically driven by Van der Waals attraction but kinetically unfavored by steric repulsion between surface ligands. This phenomenon was previously observed with EG-passivated 40 nm gold particle dimers over a 10 h timescale. 31 In practice, the origin of the strong conformational change for EG-passivated dimers from an interparticle distance larger than 10 nm to aggregated AuNPs cannot be explained by the influence of the temperature increase on the biochemical scaffold. Indeed, a partial or

13


Page 13 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

total dehybridization of the DNA double-helix will not favor the aggregation of the two gold nanoparticles forming the dimer. As observed with the examples of AuNP dimers breaking apart in fig. S8 of the SI, melting the DNA template would lead to the formation of two isolated gold particles: one dispersed in solution by Brownian motion and the other one bound to the Neutravidin coated glass slide with a strong blueshift of the measured plasmon resonance wavelength. Another indication that the observed irreversible aggregation is not due to the temperature-induced melting of the DNA template is provided by previous experiments performed on 40 nm AuNPs linked by the same DNA template and at room temperature: irreversible aggregation was also observed when raising the salt concentration above a threshold value 31 even though the stability of the DNA template was increased by the stronger ionic strength. In practice, aggregation is observed if attractive Van der Waals interactions become dominant over electrostatic and steric repulsions between particles (see fig. S7 for more details). Increasing the salt concentration screens repulsive electrostatic interactions and can lead to intra-dimer aggregation. 31 In the current study, we attribute the origin of the temperature-induced aggregation to a combination of two mechanisms: a disruption of the colloidal stability of the gold particles above 50 ◦ C, due to the removal of the hydrophilic passivating ligands; and increased conformational motion at high temperatures. Indeed, the analysis of fluorescently labeled thiolated ligands has demonstrated an increase of their irreversible release from the surface of gold nanoparticles at temperatures larger than 40 ◦ C 44 or 60 ◦ C. 45 Such breaking of Au-SH bonds should also lead to the breaking down of the dimer in isolated particles (observed in less than 5% of the studied EG-passivated dimers) but the DNA scaffold used in this study features trithiolated modifications to increase the thermodynamic stability of the Au-DNA interaction. 46 The release of thiolated ligands from the gold particle surface will, in practice, reduce the steric repulsion between the two AuNPs and favor Van der Waals attraction at short distances. 41 Additionally, DNAtemplated gold particle dimers have been shown to behave as damped harmonic oscillators

14


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 26

with local parabolic potential energy wells 32 and higher temperatures will allow more thermal motion of the AuNPs. A reduction of repulsive interactions between AuNPs thus corresponds to a lower potential energy barrier between the initial stable state of the dimer and the lowest energy state corresponding to aggregated particles, 41 while increasing the temperature will kinetically favor reaching the lowest energy state (see fig. S7-b). According to the data of fig. 1-c and fig. 2, the combination of both processes allows the dimers to reach conformations with short interparticle spacings where attractive forces become dominant, leading to an irreversible aggregation of the two AuNPs on themselves. While the relative position of the gold nanoparticles is unequivocally evidenced by the strongly redshifted plasmon resonances at high temperatures, it is impossible to infer from the data of fig. 2-c-e the morphology of the DNA template. With a final temperature of 64 ◦ C, above the estimated melting temperature for EG-passivated dimers, the biochemical scaffold could be partially dehybridized. However, since the DNA template is only a few tens of nanometers away from the negatively-charged protein coated slide, the increased cation concentration in its vicinity could raise the melting temperature above 64 ◦ C. The behavior of 60 nm AuNP dimers featuring amphiphilic ligands is strikingly different: fig. 2-c demonstrates that the distribution of resonance wavelengths from XEG-passivated nanostructures is independent of the temperature between 26 ◦ C and 64 ◦ C, whether the sample is heated up or cooled down. This is confirmed by the average wavelengths and corresponding interparticle distances, plotted in fig. 2-d-e, whose variations as a function of the temperature are within the standard error. These results demonstrate that the introduction of an hydrophobic shield on the particle surface not only increases the colloidal stability of AuNPs and DNA-templated assemblies but it also increases the stability of the surface chemistry with regard to temperature fluctuations. Since the amphiphilic ligand is longer than the ethylene glycol oligomer, a lower surface density is expected on the gold particles 47 and cannot explain this increased temperature-dependent stability. On the other hand, repulsion between the hydrophilic head of the ligand from one particle and the hydrophobic tail from

15


Page 15 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

the other AuNP hinders the ability of the particles to reach a distance where Van der Waals attraction becomes dominant and where they could aggregate. Furthermore, hydrophobichydrophobic interactions between the amphiphilic ligands could stabilize the self-assembled monolayer on the AuNPs. Importantly, these results clearly demonstrate that a combination of a DNA template with trithiolated moieties and of an amphiphilic surface chemistry leads to the synthesis of DNA-templated gold particle dimers with strong plasmonic responses and scattering cross-sections that are stable at biologically relevant temperatures. One of the interests of monitoring the plasmon resonance wavelengths of the same isolated AuNP dimers is the possibility to analyze the typical spectral shifts when changing the temperature and not only the average resonance wavelengths. Indeed, while the data of fig. 2-c-d seem to demonstrate that the optical response of XEG-passivated dimers is independent of the temperature, the spectral shifts plotted in fig. 3 indicate a more complex behavior. Fig. 3-a-b provide the distributions of plasmon resonance shifts of EG- and XEG-passivated dimers during the temperature increases studied in fig. 2. As expected, the spectral shifts observed with hydrophilic ligands are positive and significantly larger than the ones measured for nanostructures with an amphiphilic surface chemistry. However, the distributions of fig. 3-b for XEG-passivated dimers are broader when the temperature is increased, with both spectral blueshifts and redshifts. This is even more visible when plotting the average absolute spectral shifts in fig. 3-c: there are more variations of the plasmon resonance wavelengths of specific amphiphilic 60 nm dimers when the temperature is increased, and these changes are not observed when the sample is cooled down. These experiments therefore demonstrate that stable DNA-templated nanostructures exhibit a larger structural flexibility at increasing temperatures. Such interparticle distance variations can arise from increased thermal motion of the AuNPs allowing a conformational change of the DNA-templated dimer in its energy landscape, which could feature several similar metastable states; or from an evolution of the nanoenvironment of the nanostructure, in particular the protein layers that link one of the gold particles to the glass substrate.

16


Langmuir

26°C

35°C

15 10 5

35°C

46°C

15 10 5

46°C

53°C

15 10 5

53°C

64°C

15 10 5

64°C

28°C

-20 -10 0

10 20 30 40 50 60 70

Wavelength shift (nm)

XEG 5

5

5

5

5 -20 -10 0

c 26°C

35°C

35°C

46°C

46°C

53°C

53°C

64°C

64°C

28°C

10 20 30 40 50 60 70

Wavelength shift (nm)

Average absolute wavelength shift (nm)

b

EG 15 10 5

Occurences

a

Occurences

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 26

25 20 15 10 5 0

26°C 35°C 46°C 53°C 64°C 35°C 46°C 53°C 64°C 28°C

Figure 3: Distributions of longitudinal resonance wavelength shifts for EG-passivated (a) and XEG-passivated (b) 60 nm AuNP dimers measured when heating the sample between 26 ◦ C and 64 ◦ C (red bars in (a) and orange in (b)) and cooling it back down to 28 ◦ C (blue bars, bar is 3 nm). (c) Evolution of the average absolute wavelength shift when EG-passivated (red and blue solid lines) and XEG-passivated (orange and light blue dashed lines) dimers are heated up and then cooled down. The error bar is the standard error when estimating the average absolute shifts in the distributions of (a) and (b). Overall, our data demonstrate how simple scattering spectroscopy measurements performed on single hybrid DNA-gold nanostructures can unravel their temperature-dependent conformation changes. Importantly, by calibrating theoretically the measured spectral evolution with respect to the interparticle distance change, it is possible to provide quantitative in situ structural information, as a function of the temperature, of hybrid self-assembled dimers at the single nanostructure level. Because of drying effects, such information is not accessible in standard scanning or transmission electron microscopy measurements, while the 3D nature of cryogenic samples would require 3D reconstruction procedures in cryogenic electron microscopy. 29 Furthermore, as demonstrated previously when probing the stiffness of AuNP dimers at room temperature, 32 this experimental approach can be extended to the millisecond timescale that is inaccessible to electron microscopy, by using faster detectors and bandpass filters, in order to understand further the dynamic conformational fluctuations of plasmonic nanostructures assembled on DNA scaffolds.

17


Page 17 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Conclusion Scattering spectroscopy of DNA-templated 60 nm AuNP dimers allowed us to demonstrate drastically different temperature-dependent behaviors from gold nanoparticle assemblies passivated with hydrophilic or amphiphilic surface chemistries. Dimers stabilized by ethylene glycol oligomers undergo massive conformational changes above 50 ◦ C that we attribute to a disruption of the ligand shell and higher thermal motion of the AuNPs, leading to an irreversible aggregation. A statistical analysis over several tens of dimers demonstrates typical plasmon resonance redshifts of the order of 65 nm. Such resonant nanostructures whose scattering and absorption cross-sections depend strongly on the temperature could have applications for in situ temperature monitoring or as nonlinear light-induced sources of heat. Indeed, The strong color shift observed in 1-c on a simple color camera exemplifies the ability of such nanostructures to translate a target temperature into easily measurable optical signals. Furthermore, dimers that exhibit absorption spectra similar to fig. 1-c and fig. 2-a (top) could be used as self-limited photothermal sources when excited around 600 nm: above a threshold temperature, the heating efficiency would be significantly reduced by the redshift of the longitudinal plasmon resonance, providing a nonlinear response with respect to the excitation intensity. However, the irreversible nature of this temperature-dependent response is a drawback for the applicability of such nanostructures. Inversely, the introduction of alkyl chains to passivate the surface of gold particles renders the plasmonic response of DNA-templated dimers essentially independent of the temperature. A careful analysis of the resonance wavelength shifts when heating or cooling down the nanostructures indicate that dimers can undergo small but increasing conformational changes at higher temperatures, leading either to a shortening or a lengthening of the interparticle spacings. These results give a flavor of the complex energy landscapes that can be exhibited by hybrid assemblies combining biomolecules and inorganic colloidal particles in a given nanoenvironment and that is yet to be understood and controlled to fully engineer their optical properties. 18


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 26

Acknowledgement The authors thank J.-M. Guigner for the cryo-EM images. This work was supported by Agence Nationale de la Recherche via projects ANR 11 JS10 002 01 and ANR-15-CE09-000302, by LABEX WIFI (Laboratory of Excellence within the French Program ”Investments for the Future”) under references ANR-10-LABX-24 and ANR-10-IDEX-0001-02 PSL*, and by Region Ile-de-France in the framework of DIM Nano-K.

Supporting Information Available Electrophoretic purification of dimers and cryo-EM characterization, reference data on single 60 nm gold particles, Boundary Element Method simulations and polarization-dependent measurements: This material is available free of charge via the Internet at http://pubs.acs.org/.

References (1) Elghanian, R.; Storhoff, J. J.; Mucic, R. C.; Letsinger, R. L.; Mirkin, C. A. Selective Colorimetric Detection of Polynucleotides Based on the Distance-Dependent Optical Properties of Gold Nanoparticles. Science 1997, 277, 1078–1081. (2) Storhoff, J. J.; Elghanian, R.; Mucic, R. C.; Mirkin, C. A.; Letsinger, R. L. One-Pot Colorimetric Differentiation of Polynucleotides with Single Base Imperfections Using Gold Nanoparticle Probes. J. Am. Chem. Soc. 1998, 120, 1959–1964. (3) Stehr, J.; Hrelescu, C.; Sperling, R. A.; Raschke, G.; Wunderlich, M.; Nichtl, A.; Heindl, D.; Kurzinger, K.; Parak, W. J.; Klar, T. A.; Feldmann, J. Gold NanoStoves for microsecond DNA melting analysis. Nano Lett. 2008, 8, 619–623. (4) Hrelescu, C.; Stehr, J.; Ringler, M.; Sperling, R. A.; Parak, W. J.; Klar, T. A.; Feld19


Page 19 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

mann, J. DNA Melting in Gold Nanostove Clusters. J. Phys. Chem. C 2010, 114, 7401–7411. (5) Jain, P. K.; Qian, W.; El-Sayed, M. A. Ultrafast Cooling of Photoexcited Electrons in Gold Nanoparticle-Thiolated DNA Conjugates Involves the Dissociation of the GoldThiol Bond. J. Am. Chem. Soc. 2006, 128, 2426–2433. (6) Poon, L.; Zandberg, W.; Hsiao, D.; Erno, Z.; Sen, D.; Gates, B. D.; Branda, N. R. Photothermal Release of Single-Stranded DNA from the Surface of Gold Nanoparticles Through Controlled Denaturating and AuS Bond Breaking. ACS Nano 2010, 4, 6395– 6403. (7) Thibaudau, F. Ultrafast Photothermal Release of DNA from Gold Nanoparticles. J. Phys. Chem. Lett. 2012, 3, 902–907. (8) Goodman, A. M.; Hogan, N. J.; Gottheim, S.; Li, C.; Clare, S. E.; Halas, N. J. Understanding Resonant Light-Triggered DNA Release from Plasmonic Nanoparticles. ACS Nano 2017, 11, 171–179. (9) Chen, J. I. L.; Durkee, H.; Traxler, B.; Ginger, D. S. Optical Detection of Protein in Complex Media with Plasmonic Nanoparticle Dimers. Small 2011, 7, 1993–1997. (10) Tajon, C. A.; Seo, D.; Asmussen, J.; Shah, N.; Jun, Y. W.; Craik, C. S. Sensitive and Selective Plasmon Ruler Nanosensors for Monitoring the Apoptotic Drug Response in Leukemia. ACS Nano 2014, 8, 9199–9208. (11) Chou, L. Y. T.; Zagorovsky, K.; Chan, W. C. W. DNA assembly of nanoparticle superstructures for controlled biological delivery and elimination. Nat. Nanotechnol. 2014, 9, 148–155. (12) Kuzyk, A.; Schreiber, R.; Zhang, H.; Govorov, A. O.; Liedl, T.; Liu, N. Reconfigurable 3D plasmonic metamolecules. Nat. Mater. 2014, 13, 862–866. 20


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 26

(13) Vial, S.; Berrahal, Y.; Prado, M.; Wenger, J. Single-Step DNA Detection Assay Monitoring Dual-Color Light Scattering from Individual Metal Nanoparticle Aggregates. ACS Sens. 2017, 2, 251–256. (14) Kuzyk, A.; Urban, M. J.; Idili, A.; Ricci, F.; Liu, N. Selective control of reconfigurable chiral plasmonic metamolecules. Sci. Adv. 2017, 3 . (15) Kim, K.; Oh, J.-W.; Lee, Y. K.; Son, J.; Nam, J.-M. Associating and Dissociating Nanodimer Analysis for Quantifying Ultrasmall Amounts of DNA. Angew. Chem. Int. Ed. 2017, 56, 9877–9880. (16) Lim, D. K.; Jeon, K. S.; Kim, H. M.; Nam, J. M.; Suh, Y. D. Nanogap-engineerable Raman-active nanodumbbells for single-molecule detection. Nat. Mater. 2010, 9, 60– 67. (17) Tikhomirov, G.; Hoogland, S.; Lee, P. E.; Fischer, A.; Sargent, E. H.; Kelley, S. O. DNAbased programming of quantum dot valency, self-assembly and luminescence. Nature Nanotech. 2011, 6, 485–490. (18) Busson, M. P.; Bidault, S. Selective Excitation of Single Molecules Coupled to the Bright Mode of a Plasmonic Cavity. Nano Lett. 2014, 14, 284–288. (19) Bidault, S.; Devilez, A.; Ghenuche, P.; Stout, B.; Bonod, N.; Wenger, J. Competition between Forster Resonance Energy Transfer and Donor Photodynamics in Plasmonic Dimer Nanoantennas. ACS Photonics 2016, 3, 895–903. (20) Simoncelli, S.; Roller, E.-M.; Urban, P.; Schreiber, R.; Turberfield, A. J.; Liedl, T.; Lohmueller, T. Quantitative Single-Molecule Surface-Enhanced Raman Scattering by Optothermal Tuning of DNA Origami-Assembled Plasmonic Nanoantennas. ACS Nano 2016, 10, 9809–9815.

21


Page 21 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

(21) Vietz, C.; Kaminska, I.; Sanz Paz, M.; Tinnefeld, P.; Acuna, G. P. Broadband Fluorescence Enhancement with Self-Assembled Silver Nanoparticle Optical Antennas. ACS Nano 2017, 11, 4969–4975. (22) Pilo-Pais, M.; Acuna, G. P.; Tinnefeld, P.; Liedl, T. Sculpting light by arranging optical components with DNA nanostructures. MRS Bull. 2017, 42, 936–942. (23) Severac, F.; Alphonse, P.; Esteve, A.; Bancaud, A.; Rossi, C. High-Energy Al/CuO Nanocomposites Obtained by DNA-Directed Assembly. Adv. Funct. Mater. 2012, 22, 323–329. (24) Calais, T.; Bourrier, D.; Bancaud, A.; Chabal, Y.; Esteve, A.; Rossi, C. DNA Grafting and Arrangement on Oxide Surfaces for Self-Assembly of Al and CuO Nanoparticles. Langmuir 2017, 33, 12193–12203. (25) Bhatt, N.; Huang, P.-J. J.; Dave, N.; Liu, J. Dissociation and Degradation of ThiolModified DNA on Gold Nanoparticles in Aqueous and Organic Solvents. Langmuir 2011, 27, 6132–6137. (26) Jin, R.; Wu, G.; Li, Z.; Mirkin, C. A.; Schatz, G. C. What Controls the Melting Properties of DNA-Linked Gold Nanoparticle Assemblies? J. Am. Chem. Soc. 2003, 125, 1643–1654. (27) Bidault, S.; Devilez, A.; Maillard, V.; Lermusiaux, L.; Guigner, J. M.; Bonod, N.; Wenger, J. Picosecond Lifetimes with High Quantum Yields from Single-PhotonEmitting Colloidal Nanostructures at Room Temperature. ACS Nano 2016, 10, 4806– 4815. (28) Lermusiaux, L.; Bidault, S. Increasing the Morphological Stability of DNA-Templated Nanostructures with Surface Hydrophobicity. Small 2015, 11, 5696–5704.

22


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 26

(29) Busson, M. P.; Rolly, B.; Stout, B.; Bonod, N.; Larquet, E.; Polman, A.; Bidault, S. Optical and Topological Characterization of Gold Nanoparticle Dimers Linked by a Single DNA Double Strand. Nano Lett. 2011, 11, 5060–5065. (30) Reinhard, B. M.; Siu, M.; Agarwal, H.; Alivisatos, A. P.; Liphardt, J. Calibration of Dynamic Molecular Rulers Based on Plasmon Coupling between Gold Nanoparticles. Nano Lett. 2005, 5, 2246–2252. (31) Lermusiaux, L.; Maillard, V.; Bidault, S. Widefield Spectral Monitoring of Nanometer Distance Changes in DNA-Templated Plasmon Rulers. ACS Nano 2015, 9, 978–990. (32) Chen, T. H.; Hong, Y.; Reinhard, B. M. Probing DNA Stiffness through Optical Fluctuation Analysis of Plasmon Rulers. Nano Lett. 2015, 15, 5349–5357. (33) Jain, P. K.; Huang, W. Y.; El-Sayed, M. A. On the Universal Scaling Behavior of the Distance Decay of Plasmon Coupling in Metal Nanoparticle Pairs: A Plasmon Ruler Equation. Nano Lett. 2007, 7, 2080–2088. (34) Lermusiaux, L.; Sereda, A.; Portier, B.; Larquet, E.; Bidault, S. Reversible Switching of the Interparticle Distance in DNA-Templated Gold Nanoparticle Dimers. ACS Nano 2012, 6, 10992–10998. (35) Reinhard, B. M.; Sheikholeslami, S.; Mastroianni, A.; Alivisatos, A. P.; Liphardt, J. Use of Plasmon Coupling to Reveal the Dynamics of DNA Bending and Cleavage by Single EcoRV Restriction Enzymes. Proc. Natl. Acad. Sci. U.S.A. 2007, 104, 2667–2672. (36) Kanaras, A. G.; Kamounah, F. S.; Schaumburg, K.; Kiely, C. J.; Brust, M. Thioalkylated Tetraethylene Glycol: a New Ligand for Water Soluble Monolayer Protected Gold Clusters. Chem. Commun. 2002, 2294–2295. (37) Lee, S. E.; Chen, Q.; Bhat, R.; Petkiewicz, S.; Smith, J. M.; Ferry, V. E.; Correia, A. L.;

23


Page 23 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Alivisatos, A. P.; Bissell, M. J. Reversible Aptamer-Au Plasmon Rulers for Secreted Single Molecules. Nano Lett. 2015, 15, 4564–4570. (38) Borsley, S.; Flook, S.; Kay, E. R. Rapid and simple preparation of remarkably stable binary nanoparticle planet-satellite assemblies. Chem. Commun. 2015, 51, 7812–7815. (39) Maus, L.; Dick, O.; Bading, H.; Spatz, J. P.; Fiammengo, R. Conjugation of Peptides to the Passivation Shell of Gold Nanoparticles for Targeting of Cell-Surface Receptors. ACS Nano 2010, 4, 6617–6628. (40) Larson, T. A.; Joshi, P. R.; Sokolov, K. Preventing Protein Adsorption and Macrophage Uptake of Gold Nanoparticles via a Hydrophobic Shield. ACS Nano 2012, 6, 9182– 9190. (41) Russel, W. B.; Saville, D. A.; Schowalter, W. R. Colloidal Dispersions; Cambridge Monographs on Mechanics; Cambridge University Press: Cambridge, 1989. (42) Owczarzy, R.; Moreira, B. G.; You, Y.; Behlke, M. A.; Walder, J. A. Predicting Stability of DNA Duplexes in Solutions Containing Magnesium and Monovalent Cations. Biochemistry 2008, 47, 5336–5353. (43) Hohenester, U.; Trgler, A. MNPBEM A Matlab toolbox for the simulation of plasmonic nanoparticles. Comp. Phys. Commun. 2012, 183, 370–381. (44) Borzenkov, M.; Chirico, G.; DAlfonso, L.; Sironi, L.; Collini, M.; Cabrini, E.; Dacarro, G.; Milanese, C.; Pallavicini, P.; Taglietti, A.; Bernhard, C.; Denat, F. Thermal and Chemical Stability of Thiol Bonding on Gold Nanostars. Langmuir 2015, 31, 8081–8091. (45) Gustafson, T. P.; Cao, Q.; Wang, S. T.; Berezin, M. Y. Design of irreversible optical nanothermometers for thermal ablations. Chem. Commun. 2013, 49, 680–682.

24


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 26

(46) Li, Z.; Jin, R. C.; Mirkin, C. A.; Letsinger, R. L. Multiple thiol-anchor capped DNAgold nanoparticle conjugates. Nucleic Acids Res. 2002, 30, 1558–1562. (47) Hinterwirth, H.; Kappel, S.; Waitz, T.; Prohaska, T.; Lindner, W.; Lammerhofer, M. Quantifying Thiol Ligand Density of Self-Assembled Monolayers on Gold Nanoparticles by Inductively Coupled Plasma-Mass Spectrometry. ACS Nano 2013, 7, 1129–1136.

25


Page 25 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

TOC graphic 26°C

26°C 53°C 64°C

64°C

500 600 700 Wavelength (nm)

26


Temperature-Dependent Plasmonic Responses from Gold

Recommend Documents