The DNA Binding Domain of p53 Is Sufficient To Trigger a Potent

Subscriber access provided by Washington University | Libraries

Article

The DNA binding domain of p53 is sufficient to trigger a potent apoptotic response at the mitochondria Karina J. Matissek, Mohanad Mossalam, Abood Okal, and Carol S. Lim Mol. Pharmaceutics, Just Accepted Manuscript • DOI: 10.1021/mp400380s • Publication Date (Web): 23 Aug 2013 Downloaded from http://pubs.acs.org on August 28, 2013

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Molecular Pharmaceutics is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Molecular Pharmaceutics

The DNA binding domain of p53 is sufficient to trigger a potent apoptotic response at the mitochondria Karina J. Matissek1,2, Mohanad Mossalam1, Abood Okal1, Carol S. Lim1,* 1

Department of Pharmaceutics and Pharmaceutical Chemistry, University of Utah, Utah, USA

2

Department of Pharmaceutics and Biopharmacy, Philipps-Universität, Germany

KEYWORDS: p53, mitochondria, Bcl-XL, apoptosis, DBD, MBD, cancer

ABSTRACT The tumor suppressor p53 is one of the most studied proteins in human cancer 1-3. While nuclear p53 has been utilized for cancer gene therapy, mitochondrial targeting of p53 has not been fully exploited to date 4,5. In response to cellular stress, p53 translocates to the

ACS Paragon Plus Environment

1


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 40

mitochondria and directly interacts with Bcl-2 family proteins including anti-apoptotic Bcl-XL and Bcl-2 and pro-apoptotic Bak and Bax 6. Anti-apoptotic Bcl-XL forms inhibitory complexes with pro-apoptotic Bak and Bax preventing their homo-oligomerization 7. Upon translocation to the mitochondria, p53 binds to Bcl-XL, releases Bak and Bax from the inhibitory complex and enhances their homo-oligomerization 8. Bak and Bax homo-tetramer formation disrupts the mitochondrial outer membrane, releases anti-apoptotic factors such as cytochrome c and triggers a rapid apoptotic response mediated by caspase induction 9. It is still unclear if the MDM2 binding domain (MBD), the proline-rich domain (PRD) and/or DNA binding domain (DBD) of p53 are the domains responsible for interaction with Bcl-XL 10-17. The purpose of this work is to determine if a smaller functional domain of p53 is capable of inducing apoptosis similarly to full length p53. To explore this question, different domains of p53 (MBD, PRD, DBD) were fused to the mitochondrial targeting signal (MTS) from Bcl-XL to ensure Bcl-XL specific targeting 18. The designed constructs were tested for apoptotic activity (TUNEL, Annexin-V, and 7-AAD) in 3 different breast cancer cell lines (T47D, MCF-7, MDA-MB-231), in a cervical cancer cell line (HeLa) and in non-small cell lung adenocarcinoma cells H1373. Our results indicate that DBDXL (p53 DBD fused to the Bcl-XL MTS) reproduces (in T47D cells) or demonstrates increased apoptotic activity (in MCF-7, MDA-MB-231, and HeLa cells) compared to p53-XL (full length p53 fused to Bcl-XL MTS). Additionally, mitochondrial dependent apoptosis assays (TMRE, caspase-9), co-IP and over-expression of Bcl-XL in T47D cells suggest that DBD fused to XL MTS may bind to and inhibit Bcl-XL. Taken together, our data demonstrates for the first time that the DBD of p53 may be the minimally necessary domain for achieving apoptosis at the mitochondria in multiple cell lines. This work highlights the role of small functional domains of p53 as a novel cancer biologic therapy.


2

Page 3 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION The tumor suppressor p53 is one of the most commonly mutated genes in all cancers 1-3. Although nuclear-mediated transcriptional activity has been extensively characterized, mitochondrial targeting of p53 has yet to be fully exploited as a therapeutic approach 4,5. The main advantage of targeting p53 to the mitochondria is its ability to trigger a rapid apoptotic response, while in the nucleus p53 first has to form a tetramer, bind to DNA, and initiate transcription of various apoptotic genes. As a consequence of stress, p53 translocates to the mitochondria and initiates apoptosis through mitochondrial outer membrane permeabilization (MOMP) 6. Mitochondrial p53 directly interacts with anti- and pro-apoptotic members of the Bcl-2 family of proteins located in the mitochondrial outer membrane. In apoptosis resistant cells, the anti-apoptotic members, Bcl-XL, Bcl-2 and Mcl-1 form heterodimers with proapoptotic proteins Bak and Bax, preventing apoptosis 7. To trigger MOMP, p53 binds to Bcl-XL, Bcl-2 and Mcl-1 and frees pro-apoptotic Bak and Bax allowing them to oligomerize 8. Homotetramer formation of Bak and Bax in the mitochondrial outer membrane triggers the release of various pro-apoptotic proteins such as cytochrome c. APAF-1 and cytochrome c form the apoptosome and activate caspase-9 that can initiate the caspase cascade resulting in programmed cell death 9. It is unclear which domains of p53 are directly responsible for triggering apoptosis at the mitochondria, presumably by interacting with anti-apoptotic Bcl-XL 11-15. The structure of p53 can be divided into amino terminus, DNA binding domain (DBD) and C-terminal region (Fig. 1A) 10. The amino terminus consists of the MDM2 binding domain (MBD) and the proline-rich domain (PRD). The C-terminal region encloses the tetramerization domain (TD) and three nuclear localization signals (NLS) (Fig. 1A) 10. It has been reported that the DBD binds to anti-


3


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 40

apoptotic Bcl-XL in the mitochondrial outer membrane and the PRD functions as an enhancer that improves this binding 11-13. However, the MBD has been also proposed as a binding partner for Bcl-XL which is enhanced by the PRD 14-17. To our knowledge, no one has attempted to targert different domains of p53 to the mitochondria. Therefore, the purpose of this study is to determine if a smaller domain of p53 is capable of inducing apoptosis similar to full length p53 when targeted to the mitochondria. This will be achieved by fusing different domains of p53 (MBD, PRD, DBD, TD) to the mitochondrial targeting signal (MTS) from Bcl-XL (abbreviated XL) to ensure mitochondrial targeting (Fig. 1B) 18. This information will provide details on which domain is responsible for the rapid apoptotic response at the mitochondria. In addition to answering this mechanistic question, an overall goal is to decrease the size of the p53 construct for gene therapy purposes. Figure 1 A


4

Page 5 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1B

Figure 1: A: Schematic representation of wild type p53 (wt p53). The 393 amino acids of p53 are divided into amino terminus, DNA binding domain (DBD), and C-terminal region. The MDM2 binding domain (MBD) and proline-rich domain (PRD) are located in the amino terminus. The tetramerization (TD) domain and the nuclear localization signals (NLSs) are located in the C-terminus. B: Schematic representation of the main experimental constructs and controls including the rational for design. p53-XL shows the structure of full length p53 with the enhanced green fluorescence protein EGFP on the amino terminus and the MTS from Bcl-XL (XL) on the C-terminus. All the other constructs contain various combinations of the different domains of p53, in addition to EGFP and XL. The negative control (E-XL) consists of only EGFP and XL.


5


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 40

MATERIALS AND METHODS Cell Lines and Transient Transfections 1471.1 murine adenocarcinoma cells (gift of G. Hager, NCI, NIH), T47D human ductal breast epithelial tumor cells (ATCC, Manassas, VA), MCF-7 human breast adenocarcinoma cells (ATCC) 18, MDA-MB-231 human breast adenocarcinoma cells (a generous gift from Dr. David Bearss, University of Utah), HeLa human epithelial cervical adenocarcinoma cells (ATCC), and H1373 human non-small lung carcinoma cells (a kind gift from Dr. Andrea Bild, University of Utah) were grown as monolayers in DMEM (1471.1) and RPMI (T47D, MCF-7, MDA-MB-231, HeLa, H1373) (Invitrogen, Carlsbad, CA) supplemented with 10% FBS (Invitrogen), 1% penicillin-streptomycin (Invitrogen), 1% glutamine (Invitrogen) and 0.1% gentamycin (Invitrogen). T47D and MCF-7 cells were additionally supplemented with 4 mg/L insulin (Sigma, St. Louis, MO). Cells were maintained in a 5% CO2 incubator at 37ºC. 3.0 x 105 cells for T47D and MCF-7 cells, 1.0 x 105 cells for MDA-MB-231 and HeLa, 2.0 x 105 for H1373 were seeded in 6-well plates (Greiner Bio-One, Monroe, NC). Different amounts of cells were plated to account for varying cell growth rates in order to maximize transfection efficiency. Approximately 24 h after seeding, transfection was performed using 1 pmol of DNA per well and Lipofectamine 2000 (Invitrogen) following the manufacturer’s recommendations.


6

Page 7 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Plasmid Construction The main plasmids used in this work are depicted in Fig 1B. pEGFP-p53∆C-XL (p53∆C-XL): The DNA encoding p53∆C (amino acids 1-322), a truncated version of wt-p53 that lacks the C-terminus, was amplified via PCR with the primers 5’GCGCGCGCGCTCCGGAATGGAGGAGCCGCAGTCA-3’ and 5’GCGCGCGCGCGGTACCTCATGGTTTCTTCTTTGGCTGGGG-3’ using previously subcloned pEGFP-p53 18 as the template DNA. p53∆C was cloned into pEGFP-XL (E-XL) 18 using BspEI and KpnI sites. pEGFP-DBD-XL (DBD-XL): The DNA encoding the DBD was amplified via PCR from pEGFP-p53-XL (p53-XL) 18 using 5’CCGGGCCCGCGGTCCGGAACCTACCAGGGCAGCTACG-3’ and 5’CCGGGCCCGCGGGGTACCTTTCTTGCGGAGATTCTCTTCCT and cloned into E-XL 18 using BspEI and KpnI sites. pEGFP-PRD-DBD-XL (PRD-DBD-XL): The DNA encoding the PRD-DBD was amplified using PCR from p53-XL 18 with the primers 5’GCGCGCGCGCGGTACCGCTCCCAGAATGCCAGAGGC-3’ and 5’GCGCGCGCGCGGATCCTTTCTTGCGGAGATTCTCTT and cloned into E-XL 18 at the KpnI and BamHI site. pEGFP-TD-XL (TD-XL): The DNA encoding the TD was amplified via PCR from previously subcloned p53-XL 18 using 5’GCGCGCGCGCGGGATCCGGCTGGATGGAGAATATTTCACCCTTCA-3’ and 5’-


7


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 40

GCGCGCGCGCGGGAtCCTCACCCAGCCTGGGCATCCTT-3’ and cloned into E-XL 18 at the BamHI site. pEGFP-MBD-PRD-XL (MBD-PRD-XL): Previously subcloned p53-XL 18 was mutated via site-directed mutagenesis using the QuikChange II XL Site directed Mutagenesis Kit (Agilent, Santa Clara, CA) using 5’ TCCCTTCCCAGAAAAGGTACCAGGGCAGCTACGGT-3’ and its reverse complement to introduce an additional KpnI site (mutations underlined). Then the DBD and C-terminus were digested out using KpnI. Additionally, a frame shift mutation was corrected (one base pair deletion) by mutating the cloned plasmid using 5’TCGAGCTATGGAAACATTTTCAGACCTATGGAAACTACTTCCTGAACGGAATTCTG3’ and its complementary strand via site-directed mutagenesis. pEGFP-PRD-XL (PRD-XL): MBD-PRD-XL was mutated via site-directed mutagenesis using 5’ TTCACTGAAGACCCAGGTCCATCCGGAGCTCCCAGAATGCCAGA-3’ and its complementary strand to introduce an additional BspEI site. The MBD was cut out with BspEI to create PRD-XL pEGFP-CC (E-CC): pEGFP-CC was subcloned as before 19. pBFP-Bcl-XL (BFP-Bcl-XL): Bcl-XL was digested out from pSFFV-neo-Bcl-XL (gift from Dr. S. Korsmeyer, Addgene, Cambridge, MA) with EcoRI and cloned into the EcoRI site of the pTagBFP-C vector (Evrogen, Moscow, Russia). A frame shift mutation was conducted (one base pair addition) by mutating the cloned plasmid using 5’TCTCGAGCTCAAGCTTCGAATTCATTGGACAATGG-3’ and its complementary strand via site-directed mutagenesis.


8

Page 9 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Mitochondrial Staining, Microscopy, and Image Analysis Before live-cell imaging and mitochondrial staining of transfected cells was performed, media in live cell chambers was replaced with phenol red-free DMEM (Invitrogen) for 1471.1 cells or phenol red-free RPMI (Invitrogen) for T47D and MCF-7 cells containing 10% charcoal stripped fetal bovine serum (CS-FBS, Invitrogen). Cells were incubated with 150 nM MitoTracker Red FM (Invitrogen) for 15 min at 37 °C and protected from light. As previously, images were acquired using an Olympus IX71F fluorescence microscope (Scientific Instrument Company, Aurora, CO) with high quality (HQ) narrow band GFP filter (ex, HQ480/20 nm; em, HQ510/20 nm) and HQ:TRITC filter (ex, HQ545/30; em, HQ620/60) from Chroma Technology (Brattleboro, VT) with a 40× PlanApo oil immersion objective (NA 1.00) on an F-View Monochrome CCD camera 19-21. ImageJ software and JACoP plugin was used to analyze images for mitochondrial stain overlap with EGFP fusion constructs 18,22-24. As previously, JACoP was used to generate the colocalization statistic [i.e., Pearson’s correlation coefficient (PCC) post Costes’ automatic threshold algorithm] 23-27. PCC evaluates correlation between pairs of individual pixels from EGFP and MitoTracker stained cells. The higher the PCC value, the higher the correlation. According to Costes a PCC value of 0.6 or greater determines colocalization between a cellular compartment and the designed protein 25. Spatial representations of pixel intensity correlation have been generated using Colocalization Colormap (ImageJ) for increased visual clarity of mitochondrial localization of the EGFP-fused constructs 28. Microscopy was repeated in triplicate (n = 3), and 10 cells were analyzed for each construct.


9


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 40

7- AAD Assay Transfected T47D, MCF-7, MDA-MB-231, HeLa and H1373 cells were pelleted and resuspended in 500 µL PBS (Invitrogen) containing 1 µM 7-aminoactinomycin D (7-AAD) (Invitrogen) for 30 min prior to analysis following the recommended protocol from the manufacturer. The assay was performed 48 h after transfection for T47D 18, MCF-7 18 and H1373 and 24 h after transfection for MDA-MB-231 and HeLa. Only EGFP positive cells were analyzed by using the FACS Canto-II (BD- BioSciences, University of Utah Core Facility) with FACS Diva software. EGFP and 7-AAD were excited with the 488 nm laser, and were detected at 507 nm and 660 nm, respectively. Independent transfections of each construct were tested three times (n=3).

Annexin V Assay 48 h after transfection, T47D cells were pelleted and resuspended in 400 µL of annexin-V binding buffer (Invitrogen) and incubated with 5 µL of annexin-APC (annexin-V conjugated to allophycocyanin, Invitrogen) for 15 min as before 18. Only transfected cells were analyzed as mentioned in 7-AAD assay. EGFP and APC were excited at 488 nm and 635 nm wavelengths, respectively and detected at their corresponding 507 nm and 660 nm wavelengths. Independent transfections of each construct were tested three times (n=3).


10

Page 11 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


TUNEL Assay T47D cells were harvested 48 h after transfection. In situ Death Detection Kit, TMR red (Roche, Mannheim, Germany) was used following manufacturer’s recommendations as before 18,24

. Cells were resuspended in PBS (Invitrogen) and analyzed via the FACSAria-II (BD-

Biosciences, University of Utah Core Facility). EGFP and TMR red were excited at 488 nm and 563 nm, respectively, and FACSDiva software was used to analyze the data. Independent transfections of each construct were tested three times (n=3).

Colony Forming Assay (CFA) Transfected T47D cells were harvested 24h post transfection and resuspended in RPMI (Invitrogen) at a concentration of 3.0 x 105 cells/mL. The Cytoselect® 96-well cell transformation assay (Cell Biolabs, San Diego, CA) was used following manufacturer’s recommendations. Equal amount of 1.2% Agar Solution, 2X DMEM/20% FBS media, and cell suspension (1:1:1) were mixed and 75 µL of the mixture was added to a 96-well plate containing a solidified base agar layer (50 µL of previously solidified1.2% Agar Solution), and allowed to solidify at 4ºC for 15 min. The following steps were performed according to the manufacture’s recommendations. A Spectra Max M2 plate reader (Molecular Devices, Sunnyvale, CA) was used to detect fluorescence using a 485/520 nm filter set. Independent transfections of each construct were tested three times (n=3).


11


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 40

TMRE Assay 36 h after transfection T47D cells were incubated with 100 nM tetramethylrhodamineethylester (TMRE) (Invitrogen) for 30 min at 37ºC 29. T47D cells were pelleted and resuspended in 300 µL annexin-V binding buffer (1X) (Invitrogen). Only EGFP positive cells were analyzed by using the FACS Canto-II (BD- BioSciences, University of Utah Core Facility) with FACS Diva software. EGFP was excited with the 488 nm laser with emission filter 530/35 and TMRE was excited with the 561 nm laser with the emission filter 585/15. Mitochondrial depolarization (loss in TMRE intensity) correlates with an increase in MOMP. Independent transfections of each construct were tested three times (n=3).

Caspase-9 Assay T47D cells were probed 48 h after transfection using SR FLICA Caspase-9 Assay Kit (Immunochemistry Technologies, Bloomington, MN) 30,31. Cells were incubated with SR FLICA Caspase-9 reagent for 60 min per manufacturer’s recommendations, pelleted and resuspended in 300 µL 1X wash buffer (Immunochemistry Technologies). Only EGFP positive cells were analyzed by using the FACS Canto-II (BD- BioSciences, University of Utah Core Facility) with FACS Diva software. EGFP and FLICA were excited with the 488 nm (emission filter 530/35) and the 561 laser (emission filter 585/15), respectively. Independent transfections of each construct were tested three times (n=3).


12

Page 13 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Co-Immunoprecipitation (Co-IP) Anti-GFP antibody (ab290, Abcam) was coupled to dynabeads using Dynabeads Antibody Coupling Kit (Invitrogen). 24 h post transfection, T47D cells were prepared using the Dynabeads Co-Immunoprecipitation Kit (Invitrogen). Cell pellets were lysed using extraction buffer B (1 x IP, 100 nM NaCl, 2 mM MgCl2, 1 mM DTT, 1% protease inhibitor). The lysate was incubated for 30 min at 4ºC with 1.5 mg of dynabeads coupled with anti-GFP antibody, and co-IP was performed per the company’s protocol. The final protein complex was denatured and western blot was performed 19 by using Bcl-XL antibody (ab 2568, Abcam).

Rescue Experiment using BFP-Bcl-XL T47D cells were co-transfected with 1 pmol of EGFP constructs and 1 pmol of BFP-Bcl-XL (BFP tag is necessary for gating Bcl-XL transfected cells). 48 h after transfection the 7-AAD assay was performed as described above. FACSCanto-II (BioSciences, University of Utah Core Facility) and FACSDiva software were used for EGFP and BFP gating. Excitation was set at 488 nm, and detected at 507 nm and 660 nm for EGFP and 7-AAD, respectively. BFP was excited at 405 nm and detected at 457 nm. Independent transfections of each construct were tested three times (n=3).


13


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 40

Statistical Analysis: All experiments were conducted in a triplicate (n=3). Statistical significance was determined by one-way analysis of variance (ANOVA) with Tukey’s or Bonferroni’s post test as indicated in figure legends; Student t-test was used to analyze the rescue experiment data. The degree of colocalization was analyzed using odds ratio with Pearson’s Chi-square. A p value

The DNA Binding Domain of p53 Is Sufficient To Trigger a Potent

Recommend Documents