The effects of silver nanoparticles exposure on the ... - ACS Publications

Subscriber access provided by Bibliothèque de l'Université Paris-Sud

Article

The effects of silver nanoparticles exposure on the testicular antioxidant system during pre-pubertal rat stage Ingra Monique Duarte Lopes, Isabela Medeiros de Oliveira, Paula Bargi-Souza, Monica Degraf Cavallin, Christiane Schineider Machado Kolc, Najeh Maissar Khalil, Sueli Pércio Quináia, Marco Aurelio Romano, and Renata Marino Romano Chem. Res. Toxicol., Just Accepted Manuscript • DOI: 10.1021/acs.chemrestox.8b00281 • Publication Date (Web): 01 Apr 2019 Downloaded from http://pubs.acs.org on April 1, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Chemical Research in Toxicology

1

The effects of silver nanoparticles exposure on the testicular antioxidant system during pre-pubertal rat stage

Ingra Monique Duarte Lopesa, Isabela Medeiros de Oliveiraa, Paula Bargi-Souzab,c, Mônica Degraf Cavallina, Christiane Schineider Machado Kolcc, Najeh Maissar Khalila, Sueli Pércio Quináiad, Marco Aurelio Romanoa and Renata Marino Romanoa*

a

Laboratory of Reproductive Toxicology and Pharmaceutical Nanotechnology Laboratory,

Department of Pharmacy, State University of Centro-Oeste (UNICENTRO), Rua Simeão Camargo Varela de Sa, 03, Zip-Code 85040-080, Parana, Brazil b

Department of Physiology and Biophysics, Institute of Biomedical Sciences, University of

São Paulo (USP), Av. Prof. Lineu Prestes, 1524, Zip-Code 05508-000, São Paulo, Brazil c

Department of Physiology and Biophysics, Institute of Biological Sciences, Federal

University of Minas Gerais, Avenida Presidente Antônio Carlos, 6627, Zip-Code 31270-901, Minas Gerais, Brazil d

Laboratory of Trace and Instrumentation Analysis Group, Department of Chemistry, State

University of Centro-Oeste (UNICENTRO), Rua Simeão Camargo Varela de Sa, 03, Zip-Code 85040-080, Parana, Brazil

*Corresponding author: Renata M Romano, R. Simeão Camargo Varela de Sa, 03, Guarapuava,

PR,

CEP

85040-080,

Brazil,

Phone:

55

42

36298184,

e-mail:

[email protected]

Key words: Sperm; enzyme activity; enzyme expression; catalase; superoxide dismutase; glutathione peroxidase; glutathione reductase

ACS Paragon Plus Environment

Chemical Research in Toxicology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 28

2

ABSTRACT

Humans and environmental are constantly exposed to a wide range of commercial products containing silver nanoparticles (AgNPs) in their composition. The hypothalamic-pituitarytesticular (HP-testicular) axis is sensitive to low doses of AgNPs with repercussions in the sperm functionality. The oxidative stress may be related with the pathogenesis of sperm alterations since ions Ag+ are released from AgNPs in the corporal fluids. This study aimed to investigate the effects of AgNPs exposure in the antioxidant defense system. For this, the transcript expression and the activity of catalase (CAT), superoxide dismutase (SOD), glutathione peroxidase (GPX) and glutathione reductase (GSR) enzymes were evaluated in the testis of rats exposed during the prepubertal period to increasing doses of AgNPs (1.875, 3.75, 7.5 or 15 μg of AgNPs / kg). The higher dose of AgNPs (15 µg / kg) investigated promoted an increase in the activity of CAT, GPX and GSR enzymes and in the expression of Gpx4 var1 transcript. The exposure to 7.5 µg / kg of AgNP increased the Gpx4 var1 mRNA expression. In the group that received 3.75 µg of AgNP / kg, the expression of Sod1, Gpx4 var2 and Gsr transcripts were decreased while the Gpx4 var1 mRNA expression was augmented. The lower dose of AgNPs tested (1.875 µg / kg) increased the expression of Cat and Gpx4 var1 transcripts. Thus, the AgNP alters the expression and activity of the antioxidant enzymes in a nonmonotonic dose-response curve and directly or indirectly modulates the events related to spermatogenesis process.


Page 3 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


3

INTRODUCTION

Among the nanomaterials, silver is commonly used in nano-enabled products in the commercial market, as water filters, paints, toys, cosmetics, deodorants, toothbrushes, clothes, plastics, detergents, disinfectants and biosensors 1, 2. The silver nanoparticles (AgNPs) present variable size (1 to 100 nm) and unique physical and chemical proprieties 3 (shape, catalytic and antimicrobial activity 4, high electrical and thermic conductivity 5) that are useful in several fields of science and technology

6, 7.

AgNPs are applied as coating of surgical instruments,

prostheses, catheters and bandages to prevent the bacterial infection 8, incorporated into clothes manufacture as anti-odor, -microbial and -humidity agent in the textile area 9, and used during the assembly of food packages to preserve it from fungal contamination in the food industry 10. Thus, humans and environmental are constantly exposed to a wide range of commercial products containing residues of AgNPs. The AgNP release was observed from the use of commercial AgNP-impregnated toothbrushes

11,

as well as from infant products (plush toy,

baby blanket, sippy cups) 12. Despite the potential risk be considered as minimal for infant 13, the relevance of human exposure to low doses of AgNP is a controversial issue since it may be released from several product 14-19. Therefore, is relevant to study possible toxic effects of low doses of AgNPs after oral exposure. Prepubertal period is highly sensitive to the action of chemical substances, reason why this period is chosen to evaluate the action of endocrine-disrupting chemicals (EDC) 20. The puberty is initiated by a differential modulation of GnRN neurons activity: before puberty their activity is predominantly inhibitory, while after puberty is mainly excitatory

21.

Prior to

puberty, a pulsatile release of gonadotropin-releasing hormone (GnRH) is increased and stimulatory events lead to the release of lutropin (LH) and follitropin (FSH) from pituitary 21, 22.

The pulse frequency of GnRH controls the differential expression of LH and FSH subunit



Page 4 of 28

4

genes by the gonadotrophs

23, 24.

In the testis, LH stimulates the synthesis of testosterone by

binding to the luteinizing hormone/choriogonadotropin receptor (LHCGR) in the plasma membrane of Leydig cells 25. Spermatogenesis events take place in the Sertoli cells, and are mainly influenced by the action of FSH, which binds to the follicle stimulating hormone receptor (FSHR) located at the plasma membrane of Sertoli cells to perform its action

25.

Besides Leydig and Sertoli cells, the testis presents a high amount of germ cells, which during spermatogenesis the spermatogonial stem cells are differentiated to spermatozoa 26. Our previous studies conducted on prepubertal male rats showed that the hypothalamicpituitary-testicular (HP-testicular) axis is highly sensitive to AgNPs

27.

Reduction on sperm

production and integrity, impairment of plasma and acrosomal membrane, decrease of mitochondrial activity, alterations on reproductive behavioral 28, as well as deregulation of the HP-testicular axis were observed in rats exposed to different doses of AgNPs during the prepubertal period 29. The sperm alterations observed in these studies 27-29 may be related to an unbalance between generation and removal of reactive oxygen species (ROS) in the testicular environment 30. The FSH modulates the gene expression, activates several signaling pathways and induces the secretion of many peptides in Sertoli cells involved in the development of the proper environment for the spermatozoa 31. For example, the cAMP response element binding protein (CREB) is an important transducer of FSH signals, and this family of transcription factor is recognized to induce gene expression in response to a number of signaling pathways induced by ROS overexpression 31. Thus the ROS formed during oxidative phosphorylation in the Sertoli cell can act by stimulating CREB but also its excess may impair the functioning of the cell and consequently and the efficiency of spermatogenesis 31. The plasma membrane of spermatozoa has an elevated content of polyunsaturated fatty acids (PUFA) turning the spermatozoa highly susceptible to oxidative damage by lipid peroxidation (LPO) 32. Besides,


Page 5 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


5

the high rates of cell division during spermatogenesis process contribute to the overexpression of reactive oxygen species (ROS) 30, which may impair the functioning of the Sertoli cell and consequently and the efficiency of spermatogenesis 31. In contrast, the testes present a complex antioxidant system that comprises vitamins, minerals, non- and enzymatic defense. The catalase (CAT), superoxide dismutase (SOD), glutathione peroxidase (GPX) and glutathione reductase (GSR) enzymes are associated to the antioxidant process. The SOD synthetizes H2O2 from O2- and H+, the H2O2 is metabolized to H2O by CAT or in greater proportion by GPX. The GSR enzyme converts the reduced form of glutathione (GSH) in oxidized glutathione (GSSG) in a NADPH dependent way, maintaining the balance in the GSH / GSSG ratio 31, 33, 34.

The ROS generation induced by AgNP may be an important mechanism of toxicity 35. Thus, the sperm alterations observed in prepubertal rats exposed to low doses of AgNPs could be related to an unbalance between generation and removal of reactive oxygen species (ROS) in the testicular environment 30. In this sense, considering the possibility of oral ingestion of AgNPs released from commercial products 14-19, the bioaccumulation of AgNPs in the testis 3638

and the higher susceptibility in the prepubertal period to the action of EDCs 29, the present

study aims to evaluate the consequences of AgNP exposure to the testicular antioxidant defense system by the evaluation of CAT, SOD, GPX and GSR mRNA expression and their enzymatic activity in animals exposed to low doses of AgNPs during the prepubertal period.

EXPERIMENTAL PROCEDURES

Experimental design All procedures were performed in accordance with the Conselho Nacional de Controle de Experimentação Animal (CONCEA) and were approved by the Universidade Estadual do



Page 6 of 28

6

Centro-Oeste Ethical Committee for Animal Research (protocol 013/2015). The experimental design was based in the prepubertal protocol from the Endocrine Disrupting Screening and Testing Advisory Committee (EDSTAC) and includes the evaluation of endocrine-disrupting chemical (EDC) effects in prepubertal and puberty 20. Forty newly weaned male Wistar rats (Rattus norvegicus var. albinus) were obtained from twenty pregnant female rats that had been monitored from the 17th day of pregnancy to determine the exact day of birth. On postnatal day 4 (PND4), the 10 litters were culled to 8 pups (4 males/4 females) per female and kept at this size until weaning (PND21). On PND23, the male offspring were divided into five groups containing 8 animals each, and received either 0 (control), 1.875, 3.750, 7.500 or 15 μg of AgNP/kg of body weight (BW) from PND23 to PND60 every other day in a volume of 0.25 ml/100 g BW by gavage in watery suspension (control group received only water). The doses used in this study were the same as Cavallin et al.29 in which the lowest observable adverse effect level (LOAEL) for sperm parameters was 1.875 μg/kg. During all experiments, the animals were kept in groups of four, housed in polypropylene cages (43 × 43 × 20 cm) with a 5-cm layer of wood shavings, fed commercial feed (Nuvilab CR- 1, Quimtia, PR, Brazil) and were allowed water ad libitum, under a 12:12 hour dark/light cycle in a temperature-controlled room (23 ± 1ºC).

Characterization of AgNPs A solution containing silver nanoparticles in dispersion (60 nm particle size, 0.02 mg/mL in aqueous buffer) was purchased from Sigma-Aldrich (catalog number 730815, Sigma-Aldrich Co., Seelze, Germany) and the dilution in water was performed just before it use. The nanoparticle stability in watery suspension was analyzed by the mean particle size and polydispersity index (PDI) by dynamic light scattering (DSL) (BIC 90 plus - Brookhaven


Page 7 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


7

Instruments Corp., USA) at a scattering angle of 90° and a temperature of 25°C. The estimated particle diameter was 79.5 ± 11 nm and the PDI was 0.575 ± 118 29.

Tissue collection The animals were subjected to deep anesthesia with ketamine and xylazine and euthanized by decapitation. Afterwards the testis was immediately excised, frozen in liquid nitrogen, pulverized in liquid nitrogen and maintained at -80 °C until further analysis of RTqPCR, enzyme activity and electrothermal atomic absorption spectrometry.

Reverse transcription followed by real-time quantitative PCR (RT-qPCR) Fifty milligrams of the pulverized testis was used for total RNA extraction using Trizol reagent (Life Technologies, Carlsbad, USA). The total RNA concentration was measured with a nanospectrophotometer (Kasvi, Brazil) and 2.5 µg were transcript reversed by GoScript Reverse Transcription System (Promega, Madison, USA) using oligo(dTs), according to the manufacturer’s instructions. The catalase (Cat), superoxide dismutase 1 (Sod1), glutathionedisulfide reductase (Gsr), glutathione peroxidase 4 variants 1 (Gpx4var1) and 2 (Gpx4var2) mRNA contents were evaluated in testis and the results obtained for each target gene per sample were normalized with the mRNA expression of ribosomal protein L19 (Rpl19), a housekeeping gene. The primer sequences and the GenBank access number of target genes are shown in Table 1. The product of reverse transcription (RT) was diluted according to the efficiency curve for each gene investigated. The real time PCR (RT-qPCR) was performed in a 10-μL mix reaction volume containing: the product of RT, 2 µM of primers (except for Gpx4var1: 1.6 µM and Gsr: 1 µM), 0.5 µM of ROX dye and 5 μL of Platinum® SYBR® Green qPCR SuperMix-UDG (Life Technologies, Carlsbad, USA). The amplification was performed with the resources of Applied Biosystems StepOnePlus™ Real-Time PCR System (Applied



Page 8 of 28

8

Biosystems, Singapore) and consisted of the following cycle conditions: 50 °C (2 min), 95 °C (2 min), and 40 cycles of 95 °C (15 s) and 60 °C (30 s). At the end of the reaction, a melting curve was generated and analyzed to confirm the specificity of the amplification. The average cycle threshold (Ct) was automatically determined using StepOne™ Software v2.3 (Applied Biosystems), and quantification was performed by the 2-ΔΔCt method, as described previously 39.

Antioxidant enzyme activity in the testis Twenty-five milligrams of pulverized testis was homogenized in a 250 µL of 0.5 mM Tris-HCl pH 7.4 and centrifuged at 590  g during 10 min at 4 °C. The supernatant was collected and the total protein content was estimated by Bradford method 40. The supernatant was then used in the enzymatic assays to determine the activities of superoxide dismutase (SOD), glutathione peroxidase (GPX), glutathione reductase (GSR) and catalase (CAT). These assays were performed using the SpectraMax 190 Microplate Reader (Molecular Devices, USA). The SOD activity was estimated according to the degree of formazan inhibition in the presence of xanthine and xanthine oxidase and detected by spectrophotometry 41. The analyses were performed following the manufacture instructions for the RANSOD Kit (Randox Laboratories Limited, Crumlin, Northern Ireland and the absorbance at 505 nm was measured. The SOD activity data was obtained for each sample by the absorbance / protein concentration ratio and the results were expressed as unit of SOD per microgram of protein (U of SOD  µg of Ptn-1). The GPX activity was measured using RANSEL Kit as previously described 42 (Randox Laboratories Limited, Crumlin, Northern Ireland). The GPX catalyzes the GSH oxidation to GSSG in the presence of cumene hydroperoxide. Reductions on absorbance were measured at


Page 9 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


9

340 nm. The GPX activity data was obtained for each sample by the absorbance / protein concentration ratio and the results were expressed as unit of GPX per liter per microgram of protein (U of GPX  L-1  µg of Ptn-1). The GSR activity was measured following the manufacture instructions for GLUTATHIONE REDUCTASE Kit (GLUT RED, Randox Laboratories Limited, Crumlin, Northern Ireland). The GSR catalyzes the GSSG reduction and the NADPH oxidation to NADP+ 43. The absorbance was measured at 340 nm. For each sample, the absorbance value was divided by the protein concentration. The results were expressed as unit of GSR per liter per microgram of protein (U of GSR  L-1  µg of Ptn-1). The catalase activity was measured by the H2O2 decay at 30 °C by spectrophotometry at 240 nm, according to the method described 44. Briefly, ten microliters of protein lysate was added to 500 µl of H2O2 (20 mM, pH 7.0) at 30 ºC and the absorbance was measured at 60 seconds in quartz cuvetttes using V-630 Bio UV-Vis Spectrophotometer (JASCO, USA). The results were expressed by the delta of absorbance (initial minus final) per second per μg of protein (Δ Abs  Sec-1  μg of Ptn-1).

Electrothermal atomic absorption spectrometry The rat testicle samples were prepared from acid digestion using concentrated HNO3 as previously described 45. Determination of AgNP was carried out in an electrothermal atomic absorption equipment, model AA 240Z from Varian (Agilent) with Zeeman background correction and graphite tube atomizer (GT 120) linked to an auto-sampler (PSD 120). The analysis was performed using one hollow cathode lamp operating at 328.1 nm with a current of 4 mA and a slit width of 0.5 nm. Argon as inert gas and pyrolytic graphite-coated graphite tubes with longitudinal heating were used.



Page 10 of 28

10

Statistical analysis The variables in question were first submitted to Kolmogorov–Smirnov tests for normality and the Bartlett test for homoscedasticity. The parameters were analyzed by ANOVA test followed by the post hoc of Tukey HSD (Honest Significance Difference) test. The Pearson correlation coefficient (r) was used to measure the linear correlation between the two variables: mRNA expression and enzymatic activity. The linear correlation ranges from -1 to 1 and was classified as strong (|r > 0.7|), moderate (|0.5 < r < 0.7|) or weak (|0.3 < r < 0.5|). When |0 < r < 0.3|, there is no linear correlation between the variables. All analysis were performed with Statistica 7.0 (Statsoft Inc, Tulsa, OK, USA). Statistical differences were considered significant when the value of P was lower than 0.05. The values were expressed as means and the standard error of the mean (± SEM).

RESULTS

Superoxide dismutase The expression of Sod1 transcript was reduced in the animals that received 3.750 μg of AgNP/kg of BW compared to control and 1.875 μg of AgNP/kg of BW groups. The SOD activity was not statically altered by AgNP exposure. It was observed a weak linear correlation between SOD transcript expression and activity according to the Pearson correlation coefficient analysis (r = 0.36; P = 0.025) (Fig. 1A-C).

Glutathione peroxidase The Gpx4 var1 mRNA content was increased in all groups treated with AgNP compared to control animals, while the expression of Gpx4 var2 transcript was reduced in the group that received 3.750 μg of AgNP/kg of BW in comparison to all others groups (Fig. 2A and B). The


Page 11 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


11

GPX activity was increased only in the group that received 15 μg of AgNP/kg of BW compared to all others groups (Fig. 2C). There was no statistical significance (P > 0.05) in the Pearson correlation coefficient analysis for the comparisons between Gpx4 var 1 or Gpx4 var 2 and GPX activity (data not shown).

Glutathione reductase The Gsr mRNA content was reduced in the group that received 3.750 μg of AgNP/kg of BW in comparison to control and 1.875 μg of AgNP/kg of BW (Fig. 3A). The GSR activity was reduced in the group that received 3.750 μg of AgNP/kg of BW compared to 1.875 and 15 μg of AgNP/kg of BW groups and increased in the group that received 15 μg of AgNP/kg of BW in comparison to control, 3.750 and 7.500 μg of AgNP/kg of BW (Fig. 3B). The Pearson correlation coefficient (r) between GSR transcript expression and activity was 0.49 (P = 0.002) (Fig. 3C).

Catalase The expression of Cat transcript was increased in the group that received 1.875 μg of AgNP/kg of BW compared to control and 15 μg of AgNP/kg of BW groups (Fig. 4A). The CAT activity was increased in the group that received 15 μg of AgNP/kg of BW in comparison to control and 3.750 μg of AgNP/kg of BW groups (Fig. 4B). The Pearson correlation coefficient (r) between CAT transcript expression and activity was 0.37 (P = 0.02) (Fig. 4C).

Quantification of AgNP in the testis The AgNP was detected in the testis of rats treated with doses higher than 3.750 µg/kg BW. The amount of AgNP (ng/g testis) detected is shown in Table 2.



Page 12 of 28

12

DISCUSSION

The puberty period is marked by changes in hypothalamic function. Before the puberty, the tonus controlling the GnRH neurons activity is predominantly inhibitory and during the puberty the change to excitatory tonus is associated with the increase in the pulsatile GnRH release and secretion of pituitary gonadotrophins, LH and FSH, which in turn trigger their actions in testicular cells and initiate the process of spermatogenesis 21, 22. The spermatogenesis process involves intense production of ROS 31, 46 and several fertility problems are associated with failures in ROS removal 30, 32, 47. The puberty period is sensitive to the action of AgNPs 27-29

and the induction of oxidative stress is also a factor related to the toxicity of AgNPs 48-50.

Indeed, it has been shown that the levels of AgNPs remains elevated in the testis several weeks after the end of exposure

36-38,

demonstrating a particular susceptibly of gonadal tissue to

AgNPs actions. Corroborating these findings, a range from 2.11 to 5.45 ng of AgNPs was detected per gram of testis of animals treated with 3.750 – 15.000 µg of AgNP /kg BW. The objective of this study was to evaluate whether the exposure to low doses of AgNPs during the prepubertal phase alter the expression and activity of the enzymes catalase (CAT), superoxide dismutase (SOD), glutathione peroxidase (GPX) and glutathione reductase (GSR) in the testes of rats, which could explain the impairment previously observed in the spermatogenesis induced by AgNPs. The AgNP altered the expression and activity of enzymes related to the testicular antioxidant system without following a classic dose-response pattern. The catalase transcript, e.g., showed maximum alteration in the group treated with the lower dose of AgNP (1.875 µg /kg), while the GSR activity was reduced in animals treated with 3.750 µg AgNP/kg and increased in the group that received 15 µg AgNP/kg. In a dose-response curve, the effects observed at the point where the signal of the slopes are inverted (negative to positive and vice


Page 13 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


13

versa) are classified as non-monotonic dose-response curve and are related to the occupation kinetics and receptor saturation 51. This pattern of response for certain chemical compounds observed in the experimental model hinders the establishment of important toxicological parameters as LOAEL (Lowest Observed Adverse Effect Level) and NOAEL (No Observed Adverse Effect Level - a higher dose that does not result in a toxic effect) 51-55. The testes are highly dependent on oxygen for the spermatogenesis process and very susceptible to the ROS toxic effects 56. The plasma membrane of spermatozoa has an elevated content of polyunsaturated fatty acids (PUFA) that are involved with the events associated to the fertilization process. However, the high levels of PUFA turn the spermatozoa highly susceptible to oxidative damage by lipid peroxidation (LPO)

32.

In human spermatozoa, the

superoxide radical (O2-.) is the predominant ROS 57 and it comes mainly from the mitochondrial electron transport chain 56. The O2-. is a potent initiator of the LPO cascade which can lead to membrane rupture and loss of sperm function 58. In this study, all groups showed alterations in the expression and / or activity of antioxidant enzymes investigated, however, considering that lower doses of AgNP (3.750 and 1.875 µg /kg) does not alter the sperm functionality 29, we assume that the generation and removal dynamics of ROS is modulated only by the higher doses of AgNPs. The excess of testicular ROS is one of the main factors for induction of germ cells apoptosis

46.

The testes present an efficient antioxidant enzyme system and also high

concentrations of antioxidants such as reduced glutathione (GSH), ascorbic acid and vitamin E 31, 57, 59,

which protects the germ cells from DNA damages 60, 61. The first enzyme involved in

the protection against oxidative damage is SOD, which catalyzes the reaction between O2-. and H+ to produce O2 e H2O2

62.

The SOD activity is stimulated by the increase in the oxygen

pressure 62 and inhibited by elevated the H2O2 concentration 63. The H2O2 is then metabolized



Page 14 of 28

14

by CAT or, to a greater portion, by GPX. GSR is a NADPH-dependent enzyme responsible for reducing GSH to oxidized glutathione (GSSG) maintaining the GSH / GSSG ratio 31, 33, 34. Although the activity of CAT, GPX and GSR enzymes was increased in the group treated with 15 µg AgNP/kg, these alterations were not sufficient to prevent the mitochondrial damage in the midpiece of spermatozoa, and the loss of the capacity to produces energy needed for the flagellum movement 29 impairing the movement of the sperm through the female genital tract 64. It is possible to assume that 15 µg of AgNP / kg directly triggers a toxic effect on sperm mitochondria and plasma membrane, as observed in cultured neuronal cells 65. In these cells, AgNPs alters the electron transport chain in the mitochondrial membrane, its permeability and protein composition, reducing the mitochondrial function 65. In this study, the treatment with 15 μg AgNP / kg also increased the Gpx4 var1 transcript expression. The translation of variant 1 of Gpx4 results in the long form of GPX, also known as phospholipid hydroperoxide glutathione peroxidase (phGPx), which present affinity by mitochondria 66. Thus, in addition to the positive effect on GPX enzyme activity, the AgNP also increases the transcription of the gene that codifies the glutathione peroxidase enzyme. All these data together indicates that the physiological mechanisms triggered in the testicular cells are not sufficient to prevent the oxidative damage induced by AgNP (at 15 μg / kg). The group treated with 7.500 μg AgNP / kg presented only the increase in the Gpx4 var1 expression, without alterations in the GPX activity, despite the reduced mitochondrial activity of the sperm

29.

Previously, we have shown that AgNP, in this intermediate dose,

increases the serum estradiol concentration

29.

The exogenous administration of estradiol

stimulates the testicular LPO and reduces the SOD and CAT activities 67, which in turn could alter the generation and removal of ROS. Thus, AgNP (at 7.500 μg / kg) would be exerting an indirect effect on the testicular antioxidant system. Interestingly, the GPX was the only enzyme


Page 15 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


15

that did not present correlation between the transcript content and enzymatic activity. In fact, the Gpx4 var1 encodes the gene for phGPx and, besides the action as antioxidant enzyme during spermatogenesis, phGPx was described as a structural protein in the mature spermatozoa, constituting about 50 % of the midpiece, and enzymatically inactive in this condition

68.

This functional change is synchronized with the relocation of phGPx from the

matrix to the intermembrane space of mitochondria during spermatogenesis 69. The groups that received the lowest doses of AgNP did not show spermatic functional changes

29,

indicating that the fine modulation of the antioxidant system was sufficient to

maintain the integrity of the spermatozoa membrane. The treatment with 3.750 μg AgNP / kg reduced the Sod1, Gpx4 var2 and Gsr expression and the GSR activity, while the expression of Gpx4 var1 was increased. The group that received 1.875 μg AgNP / kg showed an increase in the mRNA content of Cat and Gpx4 var1. The Gpx4 var1, as previously mentioned, has two important roles: a) acting as antioxidant enzyme and; b) being a structural protein of the mitochondria in the midpiece of sperm. Thus, the increase of Gpx4 var1 mRNA expression may influence the antioxidant defense system, as well as the mitochondrial composition in the midpiece of sperm. Gpx4 var2 encodes the specific sperm nuclei glutathione peroxidase (snGPx), which is related to the chromatin condensation in the final stages of spermatogenesis by cross-linked protamine thiols 70. In this sense, the reduction of Gpx4 var2 transcription could impair the DNA integrity in the chromatin, which in turn could increase the vulnerability of the offspring to xenobiotic agents affecting its healthy 71. The methods applied in these studies were not able to evaluate whether the AgNPs induced changes in the chromatin. In this study, we have used low doses of AgNP in attempt to compare to the unintentional ingestion of AgNPs residues released from commercial products. Recent studies have used very high doses of AgNPs to assess the possible effects on the antioxidant system and the results were very variable. A single and intraperitoneal dose of 5,000 μg AgNP / kg



Page 16 of 28

16

(2,666-fold > 1,875) administered to rats reduced the SOD, CAT and GPX activity in testis 72 and liver 73, while higher doses (100,000 and 200,000 μg AgNP / kg / 90 days - 53,333 and 106,666-fold > 1,875, respectively) increased the SOD and CAT activity in the liver of rats 74. However, the SOD, CAT and GPX activities were not altered in the serum of male Wistar rats exposed to 5,000 or 10,000 μg AgNP / kg / 28 days 75.

Conclusion In conclusion, the exposure to low doses of AgNPs during the pre-pubertal phase alters the expression and the activity of catalase, superoxide dismutase, glutathione peroxidase and glutathione reductase enzymes in the testes of rats, affecting directly or indirectly the events related to the spermatogenesis process. The response to different AgNP doses did not fit in a classic dose-response pattern, characterizing a non-monotonic dose-response curve.

Funding source

This study was supported by Capes (Coordenação de Aperfeiçoamento de Pessoal de Nivel Superior, 23038.009865/2013-32). IMDL was the recipient of a scholarship from Fundação Araucária.

REFERENCES

(1) (2) (3) (4)

Vance, M. E., Kuiken, T., Vejerano, E. P., McGinnis, S. P., Hochella, M. F., Jr., Rejeski, D., and Hull, M. S. (2015) Nanotechnology in the real world: Redeveloping the nanomaterial consumer products inventory. Beilstein journal of nanotechnology 6, 1769-1780. WWICS, W. W. I. C. f. S. (2018) Project on Emerging Nanotechnologies: Nanotechnology. Wei, L., Lu, J., Xu, H., Patel, A., Chen, Z.-S., and Chen, G. (2015) Silver nanoparticles: synthesis, properties, and therapeutic applications. Drug discovery today 20, 595-601. Xu, R., Wang, D., Zhang, J., and Li, Y. (2006) Shape-dependent catalytic activity of silver nanoparticles for the oxidation of styrene. Chemistry, an Asian journal 1, 888-893.


Page 17 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


17 (5) (6) (7) (8) (9) (10) (11) (12) (13) (14) (15) (16) (17) (18) (19)

(20)

(21) (22)

Alshehri, A. H., Jakubowska, M., Mlozniak, A., Horaczek, M., Rudka, D., Free, C., and Carey, J. D. (2012) Enhanced electrical conductivity of silver nanoparticles for high frequency electronic applications. ACS applied materials & interfaces 4, 7007-7010. Quang Huy, T., Van Quy, N., and Anh-Tuan, L. (2013) Silver nanoparticles: synthesis, properties, toxicology, applications and perspectives. Advances in Natural Sciences: Nanoscience and Nanotechnology 4, 033001. Keat, C. L., Aziz, A., Eid, A. M., and Elmarzugi, N. A. (2015) Biosynthesis of nanoparticles and silver nanoparticles. Bioresources and Bioprocessing 2, 47. Shenava, A., Sharma, S., Shetty, V., and Shenoy, S. (2015) Silver nanoparticles: A boon in clinical medicine. Journal of Oral Research and Review 7, 35-38. Velmurugan, P., Lee, S. M., Cho, M., Park, J. H., Seo, S. K., Myung, H., Bang, K. S., and Oh, B. T. (2014) Antibacterial activity of silver nanoparticle-coated fabric and leather against odor and skin infection causing bacteria. Applied microbiology and biotechnology 98, 8179-8189. Kumari, A., and Yadav, S. K. (2014) Nanotechnology in agri-food sector. Critical reviews in food science and nutrition 54, 975-984. Mackevica, A., Olsson, M. E., and Hansen, S. F. (2017) The release of silver nanoparticles from commercial toothbrushes. Journal of Hazardous Materials 322, Part A, 270-275. Quadros, M. E., Pierson, R., Tulve, N. S., Willis, R., Rogers, K., Thomas, T. A., and Marr, L. C. (2013) Release of Silver from Nanotechnology-Based Consumer Products for Children. Environmental Science & Technology 47, 8894-8901. Pang, C., Hristozov, D., Zabeo, A., Pizzol, L., Tsang, M. P., Sayre, P., and Marcomini, A. (2017) Probabilistic approach for assessing infants' health risks due to ingestion of nanoscale silver released from consumer products. Environment International 99, 199-207. Benn, T., Cavanagh, B., Hristovski, K., Posner, J. D., and Westerhoff, P. (2010) The release of nanosilver from consumer products used in the home. Journal of environmental quality 39, 1875-1882. Benn, T. M., and Westerhoff, P. (2008) Nanoparticle silver released into water from commercially available sock fabrics. Environ Sci Technol 42, 4133-4139. Echegoyen, Y., and Nerin, C. (2013) Nanoparticle release from nano-silver antimicrobial food containers. Food Chem Toxicol 62, 16-22. Farkas, J., Peter, H., Christian, P., Gallego Urrea, J. A., Hassellov, M., Tuoriniemi, J., Gustafsson, S., Olsson, E., Hylland, K., and Thomas, K. V. (2011) Characterization of the effluent from a nanosilver producing washing machine. Environ Int 37, 1057-1062. Rigo, C., Roman, M., Munivrana, I., Vindigni, V., Azzena, B., Barbante, C., and Cairns, W. R. (2012) Characterization and evaluation of silver release from four different dressings used in burns care. Burns : journal of the International Society for Burn Injuries 38, 1131-1142. Tulve, N. S., Stefaniak, A. B., Vance, M. E., Rogers, K., Mwilu, S., LeBouf, R. F., SchweglerBerry, D., Willis, R., Thomas, T. A., and Marr, L. C. (2015) Characterization of silver nanoparticles in selected consumer products and its relevance for predicting children's potential exposures. International journal of hygiene and environmental health 218, 345357. Stoker, T. E., Parks, L. G., Gray, L. E., and Cooper, R. L. (2000) Endocrine-disrupting chemicals: prepubertal exposures and effects on sexual maturation and thyroid function in the male rat. A focus on the EDSTAC recommendations. Endocrine Disrupter Screening and Testing Advisory Committee. Crit Rev Toxicol 30, 197-252. Abreu, A. P., and Kaiser, U. B. (2016) Pubertal development and regulation. The lancet. Diabetes & endocrinology 4, 254-264. Prevot, V. (2015) Chapter 30 - Puberty in Mice and Rats, In Knobil and Neill's Physiology of Reproduction (Fourth Edition) (Plant, T. M., and Zeleznik, A. J., Eds.) pp 1395-1439, Academic Press, San Diego.



Page 18 of 28

18 (23) (24) (25)

(26) (27) (28)

(29)

(30) (31) (32) (33) (34) (35) (36)

(37) (38)

Kaiser, U. B., Jakubowiak, A., Steinberger, A., and Chin, W. W. (1997) Differential Effects of Gonadotropin-Releasing Hormone (GnRH) Pulse Frequency on Gonadotropin Subunit and GnRH Receptor Messenger Ribonucleic Acid Levels in Vitro 1. Endocrinology 138, 1224-1231. Nagirnaja, L., Rull, K., Uusküla, L., Hallast, P., Grigorova, M., and Laan, M. (2010) Genomics and genetics of gonadotropin beta-subunit genes: unique FSHB and duplicated LHB/CGB loci. Molecular and cellular endocrinology 329, 4-16. O'Donnell, L., Meachem, S. J., Stanton, P. G., and McLachlan, R. I. (2006) Chapter 21 Endocrine Regulation of Spermatogenesis, In Knobil and Neill's Physiology of Reproduction (Third Edition) (Neill, J. D., Plant, T. M., Pfaff, D. W., Challis, J. R. G., de Kretser, D. M., Richards, J. S., and Wassarman, P. M., Eds.) pp 1017-1069, Academic Press, St Louis. Valli, H., Phillips, B. T., Orwig, K. E., Gassei, K., and Nagano, M. C. (2015) Chapter 15 Spermatogonial Stem Cells and Spermatogenesis, In Knobil and Neill's Physiology of Reproduction (Fourth Edition) pp 595-635, Academic Press, San Diego. Sleiman, H. K., Romano, R. M., Oliveira, C. A., and Romano, M. A. (2013) Effects of prepubertal exposure to silver nanoparticles on reproductive parameters in adult male Wistar rats. J Toxicol Environ Health A 76, 1023-1032. Mathias, F. T., Romano, R. M., Kizys, M. M., Kasamatsu, T., Giannocco, G., Chiamolera, M. I., Dias-da-Silva, M. R., and Romano, M. A. (2015) Daily exposure to silver nanoparticles during prepubertal development decreases adult sperm and reproductive parameters. Nanotoxicology 9, 64-70. Cavallin, M. D., Wilk, R., Oliveira, I. M., Cardoso, N. C. S., Khalil, N. M., Oliveira, C. A., Romano, M. A., and Romano, R. M. (2018) The hypothalamic-pituitary-testicular axis and the testicular function are modulated after silver nanoparticle exposure. Toxicology Research 7, 102-116. Aitken, R. J., Gibb, Z., Baker, M. A., Drevet, J., and Gharagozloo, P. (2016) Causes and consequences of oxidative stress in spermatozoa. Reproduction, Fertility and Development 28, 1-10. Guerriero, G., Trocchia, S., Abdel-Gawad, F. K., and Ciarcia, G. (2014) Roles of reactive oxygen species in the spermatogenesis regulation. Frontiers in endocrinology 5. Aitken, R. J. (2017) Reactive oxygen species as mediators of sperm capacitation and pathological damage. Molecular reproduction and development 84, 1039-1052. Bauche, F., Fouchard, M. H., and Jegou, B. (1994) Antioxidant system in rat testicular cells. FEBS Lett 349, 392-396. Wong, W. Y., Thomas, C. M., Merkus, J. M., Zielhuis, G. A., and Steegers-Theunissen, R. P. (2000) Male factor subfertility: possible causes and the impact of nutritional factors. Fertil Steril 73, 435-442. McShan, D., Ray, P. C., and Yu, H. (2014) Molecular toxicity mechanism of nanosilver. Journal of food and drug analysis 22, 116-127. van der Zande, M., Vandebriel, R. J., Van Doren, E., Kramer, E., Herrera Rivera, Z., SerranoRojero, C. S., Gremmer, E. R., Mast, J., Peters, R. J. B., Hollman, P. C. H., Hendriksen, P. J. M., Marvin, H. J. P., Peijnenburg, A. A. C. M., and Bouwmeester, H. (2012) Distribution, Elimination, and Toxicity of Silver Nanoparticles and Silver Ions in Rats after 28-Day Oral Exposure. ACS Nano 6, 7427-7442. Bachler, G., von Goetz, N., and Hungerbühler, K. (2013) A physiologically based pharmacokinetic model for ionic silver and silver nanoparticles. International Journal of Nanomedicine 8, 3365-3382. Kim, Y. S., Kim, J. S., Cho, H. S., Rha, D. S., Kim, J. M., Park, J. D., Choi, B. S., Lim, R., Chang, H. K., Chung, Y. H., Kwon, I. H., Jeong, J., Han, B. S., and Yu, I. J. (2008) Twenty-eight-day oral toxicity, genotoxicity, and gender-related tissue distribution of silver nanoparticles in Sprague-Dawley rats. Inhal Toxicol 20, 575-583.


Page 19 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


19 (39) (40) (41) (42) (43)

(44) (45) (46) (47) (48) (49) (50) (51) (52) (53) (54) (55) (56) (57) (58)

Livak, K. J., and Schmittgen, T. D. (2001) Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408. Bradford, M. M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry 72, 248-254. Beauchamp, C., and Fridovich, I. (1971) Superoxide dismutase: Improved assays and an assay applicable to acrylamide gels. Analytical Biochemistry 44, 276-287. Paglia, D. E., and Valentine, W. N. (1967) Studies on the quantitative and qualitative characterization of erythrocyte glutathione peroxidase. The Journal of Laboratory and Clinical Medicine 70, 158-169. Kaneko, T., Iuchi, Y., Kobayashi, T., Fujii, T., Saito, H., Kurachi, H., and Fujii, J. (2002) The expression of glutathione reductase in the male reproductive system of rats supports the enzymatic basis of glutathione function in spermatogenesis. European Journal of Biochemistry 269, 1570-1578. Aebi, H. (1984) [13] Catalase in vitro, In Methods in Enzymology pp 121-126, Academic Press. Butik, M., Kelte Filho, I., Peres, J. A., and Quinaia, S. P. (2018) Comparison between Alkaline Solubilization Methods and Acid Digestion of Animal Tissue for Determination of Metals by Flame Atomic Absorption Spectrometry. REVISTA VIRTUAL DE QUIMICA 10, 1039-1055. Xu, Y.-R., Dong, H.-S., and Yang, W.-X. (2016) Regulators in the apoptotic pathway during spermatogenesis: Killers or guards? Gene 582, 97-111. Aitken, R. J., Smith, T. B., Jobling, M. S., Baker, M. A., and De Iuliis, G. N. (2014) Oxidative stress and male reproductive health. Asian J Androl 16, 31-38. Foldbjerg, R., Jiang, X., Miclăuş, T., Chen, C., Autrup, H., and Beer, C. (2015) Silver nanoparticles – wolves in sheep's clothing? Toxicology Research 4, 563-575. Kim, S., Choi, J. E., Choi, J., Chung, K. H., Park, K., Yi, J., and Ryu, D. Y. (2009) Oxidative stressdependent toxicity of silver nanoparticles in human hepatoma cells. Toxicol In Vitro 23, 1076-1084. Zhang, W., Xiao, B., and Fang, T. (2018) Chemical transformation of silver nanoparticles in aquatic environments: Mechanism, morphology and toxicity. Chemosphere 191, 324-334. Vandenberg, L. N. (2014) Non-Monotonic Dose Responses in Studies of Endocrine Disrupting Chemicals: Bisphenol a as a Case Study. Dose-Response 12, dose-response.13020.Vandenberg. Diamanti-Kandarakis, E., Bourguignon, J. P., Giudice, L. C., Hauser, R., Prins, G. S., Soto, A. M., Zoeller, R. T., and Gore, A. C. (2009) Endocrine-disrupting chemicals: an Endocrine Society scientific statement. Endocrine reviews 30, 293-342. Welshons, W. V., Thayer, K. A., Judy, B. M., Taylor, J. A., Curran, E. M., and Vom Saal, F. S. (2003) Large effects from small exposures. I. Mechanisms for endocrine-disrupting chemicals with estrogenic activity. Environ. Health Persp. 111, 994-1006. Schug, T. T., Janesick, A., Blumberg, B., and Heindel, J. J. (2011) Endocrine disrupting chemicals and disease susceptibility. J. Steroid Biochem. Mol. Biol. 127, 204-215. Weiss, B. (2011) ENDOCRINE DISRUPTORS AS A THREAT TO NEUROLOGICAL FUNCTION. Journal of the neurological sciences 305, 11-21. Aitken, R. J., and Roman, S. D. (2008) Antioxidant systems and oxidative stress in the testes. Oxidative medicine and cellular longevity 1, 15-24. Henkel, R. R. (2011) Leukocytes and oxidative stress: dilemma for sperm function and male fertility. Asian J Androl 13, 43-52. Agarwal, A., Virk, G., Ong, C., and du Plessis, S. S. (2014) Effect of oxidative stress on male reproduction. The world journal of men's health 32, 1-17.



Page 20 of 28

20 (59) (60) (61) (62) (63) (64) (65) (66) (67) (68) (69)

(70)

(71) (72) (73) (74)

(75)

Saalu, L. C. (2010) The incriminating role of reactive oxygen species in idiopathic male infertility: an evidence based evaluation. Pakistan journal of biological sciences : PJBS 13, 413-422. Kasahara, E., Sato, E. F., Miyoshi, M., Konaka, R., Hiramoto, K., Sasaki, J., Tokuda, M., Nakano, Y., and Inoue, M. (2002) Role of oxidative stress in germ cell apoptosis induced by di(2-ethylhexyl)phthalate. The Biochemical journal 365, 849-856. Sanocka, D., and Kurpisz, M. (2004) Reactive oxygen species and sperm cells. Reprod Biol Endocrinol 2, 12. Fridovich, I. (1978) The biology of oxygen radicals. Science 201, 875. Bray, R. C., Cockle, S. A., Fielden, E. M., Roberts, P. B., Rotilio, G., and Calabrese, L. (1974) Reduction and inactivation of superoxide dismutase by hydrogen peroxide. The Biochemical journal 139, 43-48. Amaral, A., Lourenco, B., Marques, M., and Ramalho-Santos, J. (2013) Mitochondria functionality and sperm quality. Reproduction (Cambridge, England) 146, R163-174. Ma, W., Jing, L., Valladares, A., Mehta, S. L., Wang, Z., Li, P. A., and Bang, J. J. (2015) Silver nanoparticle exposure induced mitochondrial stress, caspase-3 activation and cell death: amelioration by sodium selenite. International journal of biological sciences 11, 860-867. Arai, M., Imai, H., Koumura, T., Yoshida, M., Emoto, K., Umeda, M., Chiba, N., and Nakagawa, Y. (1999) Mitochondrial phospholipid hydroperoxide glutathione peroxidase plays a major role in preventing oxidative injury to cells. J Biol Chem 274, 4924-4933. Chaki, S. P., Misro, M. M., Gautam, D. K., Kaushik, M., Ghosh, D., and Chainy, G. B. (2006) Estradiol treatment induces testicular oxidative stress and germ cell apoptosis in rats. Apoptosis 11, 1427-1437. Ursini, F., Heim, S., Kiess, M., Maiorino, M., Roveri, A., Wissing, J., and Flohe, L. (1999) Dual function of the selenoprotein PHGPx during sperm maturation. Science 285, 1393-1396. Haraguchi, C. M., Mabuchi, T., Hirata, S., Shoda, T., Yamada, A. T., Hoshi, K., and Yokota, S. (2003) Spatiotemporal changes of levels of a moonlighting protein, phospholipid hydroperoxide glutathione peroxidase, in subcellular compartments during spermatogenesis in the rat testis. Biol Reprod 69, 885-895. Pfeifer, H., Conrad, M., Roethlein, D., Kyriakopoulos, A., Brielmeier, M., Bornkamm, G. W., and Behne, D. (2001) Identification of a specific sperm nuclei selenoenzyme necessary for protamine thiol cross-linking during sperm maturation. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 15, 1236-1238. Aitken, R. J. (2018) Not every sperm is sacred; a perspective on male infertility. Mol Hum Reprod 24, 287-298. Ansar, S., Abudawood, M., Hamed, S. S., and Aleem, M. M. (2017) Sodium Selenite Protects Against Silver Nanoparticle-Induced Testicular Toxicity and Inflammation. Biological trace element research 175, 161-168. Ansar, S., Alshehri, S. M., Abudawood, M., Hamed, S. S., and Ahamad, T. (2017) Antioxidant and hepatoprotective role of selenium against silver nanoparticles. Int J Nanomedicine 12, 7789-7797. Blanco, J., Tomas-Hernandez, S., Garcia, T., Mulero, M., Gomez, M., Domingo, J. L., and Sanchez, D. J. (2018) Oral exposure to silver nanoparticles increases oxidative stress markers in the liver of male rats and deregulates the insulin signalling pathway and p53 and cleaved caspase 3 protein expression. Food Chem Toxicol 115, 398-404. Nakkala, J. R., Mata, R., Raja, K., Khub Chandra, V., and Sadras, S. R. (2018) Green synthesized silver nanoparticles: Catalytic dye degradation, in vitro anticancer activity and in vivo toxicity in rats. Materials Science and Engineering: C 91, 372-381.


Page 21 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


21

Table 1 – Primers used for RT-qPCR analyses. Gene

GenBank

Primer sequences (5´- 3´)

Sod1 (Superoxide dismutase 1)

NM_017050.1

F: GGGGACAATACACAAGGCTGT R: CATGCCTCTCTTCATCCGCT

Cat (Catalase)

NM_012520.2

F: TTCTTGTTCAGCGACCGAGG R: GATGCCCTGGTCAGTCTTGTA

Gpx4Var1 (Glutathione peroxidase 4, transcript variant 1)

NM_017165.2

F: GCCGTCTGAGCCGCTTATT R: ACGCAACCCCTGTACTTATCCA

Gpx4Var2 (Glutathione peroxidase 4, transcript variant 2)

NM_001039849.2

F: ACCTTCCCCAGACCAGCAAC R: ACGCAACCCCTGTACTTATCCA

Gsr (Glutathione-disulfide reductase )

NM_053906.2

F: ACTTCTCACCCCAGTTGCG R: CCACGGTAGGGATGTTGTCA

Rpl19 (Ribossomal protein L19)

NM_031103.1

F: AATGAAACCAACGAAATCG R: TCAGGCCATCTTTGATCAGCT

F, forward; R, reverse

Table 2 – Quantification of AgNP in the testis. Dose AgNP (µg/kg BW)

Detected AgNP (ng/g testis)

0.000

< detection limit

1.875

< detection limit

3.750

2.110 ± 1.30

7.500

3.288 ± 0.80

15.000

5.450 ± 0.07



Page 22 of 28

22

Figure legends

Figure 1 – Superoxide dismutase (A) mRNA relative expression, (B) enzyme activity and (C) correlation between mRNA and enzyme activity in male Wistar rats exposed to 0, 1.875, 3.750, 7.500 or 15 µg of AgNPs/kg BW during prepubertal period. Data are expressed as mean ± S.E.M.; ANOVA followed by Tukey HSD; n = 8/group; a,b differ P < 0.05. Pearson correlation coefficient (r) = 0.36; P = 0.025. Sod1: Superoxide dismutase 1; SOD: superoxide dismutase; Ptn: protein.

Figure 2 – Glutathione peroxidase 4 mRNA relative expression (A) transcript variant 1, (B) transcript variant e and (C) enzyme activity in male Wistar rats exposed to 0, 1.875, 3.750, 7.500 or 15 µg of AgNPs/kg BW during prepubertal period. Data are expressed as mean ± S.E.M.; ANOVA followed by Tukey HSD; n = 8/group; a,b differ P < 0.05. Gpx4var1: Glutathione peroxidase 4 transcript variant 1; Gpx4var2: Glutathione peroxidase 4 transcript variant 2; GPX: Glutathione peroxidase; Ptn: protein.

Figure 3 – Glutathione reductase (A) mRNA relative expression, (B) enzyme activity and (C) correlation between mRNA and enzyme activity in male Wistar rats exposed to 0, 1.875, 3.750, 7.500 or 15 µg of AgNPs/kg BW during prepubertal period. Data are expressed as mean ± S.E.M.; ANOVA followed by Tukey HSD; n = 8/group; a,b and g,h differ P < 0.05. Pearson correlation coefficient (r) = 0.39; P = 0.002. Gsr: Glutathione reductase; GSR: Glutathione reductase; Ptn: protein.

Figure 4 – Catalase (A) mRNA relative expression, (B) enzyme activity and (C) correlation between mRNA and enzyme activity in male Wistar rats exposed to 0, 0, 1.875, 3.750, 7.500


Page 23 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


23

or 15 µg of AgNPs/kg BW during prepubertal period. Data are expressed as mean ± S.E.M.; ANOVA followed by Tukey HSD; n = 8/group; a,b differ P < 0.05. Pearson correlation coefficient (r) = 0.37; P = 0.02. Cat: Catalase; CAT: Catalase; Abs: absorbance; Ptn: protein.



Figure 1 – Superoxide dismutase (A) mRNA relative expression, (B) enzyme activity and (C) correlation between mRNA and enzyme activity in male Wistar rats exposed to 0, 1.875, 3.750, 7.500 or 15 µg of AgNPs/kg BW during prepubertal period. Data are expressed as mean ± S.E.M.; ANOVA followed by Tukey HSD; n = 8/group; a,b differ P < 0.05. Pearson correlation coefficient (r) = 0.36; P = 0.025. Sod1: Superoxide dismutase 1; SOD: superoxide dismutase; Ptn: protein. 142x229mm (300 x 300 DPI)


Page 24 of 28

Page 25 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2 – Glutathione peroxidase 4 mRNA relative expression (A) transcript variant 1, (B) transcript variant e and (C) enzyme activity in male Wistar rats exposed to 0, 1.875, 3.750, 7.500 or 15 µg of AgNPs/kg BW during prepubertal period. Data are expressed as mean ± S.E.M.; ANOVA followed by Tukey HSD; n = 8/group; a,b differ P < 0.05. Gpx4var1: Glutathione peroxidase 4 transcript variant 1; Gpx4var2: Glutathione peroxidase 4 transcript variant 2; GPX: Glutathione peroxidase; Ptn: protein. 143x226mm (300 x 300 DPI)



Figure 3 – Glutathione reductase (A) mRNA relative expression, (B) enzyme activity and (C) correlation between mRNA and enzyme activity in male Wistar rats exposed to 0, 1.875, 3.750, 7.500 or 15 µg of AgNPs/kg BW during prepubertal period. Data are expressed as mean ± S.E.M.; ANOVA followed by Tukey HSD; n = 8/group; a,b and g,h differ P < 0.05. Pearson correlation coefficient (r) = 0.39; P = 0.002. Gsr: Glutathione reductase; GSR: Glutathione reductase; Ptn: protein. 142x224mm (300 x 300 DPI)


Page 26 of 28

Page 27 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4 – Catalase (A) mRNA relative expression, (B) enzyme activity and (C) correlation between mRNA and enzyme activity in male Wistar rats exposed to 0, 0, 1.875, 3.750, 7.500 or 15 µg of AgNPs/kg BW during prepubertal period. Data are expressed as mean ± S.E.M.; ANOVA followed by Tukey HSD; n = 8/group; a,b differ P < 0.05. Pearson correlation coefficient (r) = 0.37; P = 0.02. Cat: Catalase; CAT: Catalase; Abs: absorbance; Ptn: protein. 142x233mm (300 x 300 DPI)



Graphical abstract 329x102mm (96 x 96 DPI)


Page 28 of 28

The effects of silver nanoparticles exposure on the ... - ACS Publications

Recommend Documents