Article pubs.acs.org/jnp
The Flavone Luteolin Inhibits Liver X Receptor Activation Vera Francisco,†,‡ Artur Figueirinha,†,§ Gustavo Costa,†,§ Joana Liberal,†,‡ Isabel Ferreira,‡ Maria C. Lopes,†,§ Carmen García-Rodríguez,⊥ Maria T. Cruz,*,†,§ and Maria T. Batista†,‡,§ †
Center for Neurosciences and Cell Biology, University of Coimbra, 3000-214 Coimbra, Portugal Center for Pharmaceutical Studies, Faculty of Pharmacy, University of Coimbra, Pólo das Ciências da Saúde, Azinhaga de Santa Comba, 3000-548 Coimbra, Portugal § Faculty of Pharmacy, University of Coimbra, Pólo das Ciências da Saúde, Azinhaga de Santa Comba, 3000-548 Coimbra, Portugal ⊥ Instituto de Biología y Genética Molecular, Universidad de Valladolid−CSIC, C/Sanz y Forés 3, 47003 Valladolid, Spain ‡
ABSTRACT: Luteolin is a dietary flavonoid with medicinal properties including antioxidant, antimicrobial, anticancer, antiallergic, and antiinflammatory. However, the effect of luteolin on liver X receptors (LXRs), oxysterol sensors that regulate cholesterol homeostasis, lipogenesis, and inflammation, has yet to be studied. To unveil the potential of luteolin as an LXRα/β modulator, we investigated by realtime RT-PCR the expression of LXR-target genes, namely, sterol regulatory element binding protein 1c (SREBP-1c) in hepatocytes and ATP-binding cassette transporter (ABC)A1 in macrophages. The lipid content of hepatocytes was evaluated by Oil Red staining. The results demonstrated, for the first time, that luteolin abrogated the LXRα/β agonist-induced LXRα/β transcriptional activity and, consequently, inhibited SREBP-1c expression, lipid accumulation, and ABCA1 expression. Therefore, luteolin could abrogate hypertriglyceridemia associated with LXR activation, thus presenting putative therapeutic effects in diseases associated with deregulated lipid metabolism, such as hepatic steatosis, cardiovascular diseases, and diabetes.
N
useful in cancer and neurodegenerative diseases.3 However, current LXR agonists have profound effects on hepatic fat metabolism, increasing hepatic and plasma triglyceride (TG) levels. These effects are partially mediated by inducing sterol regulatory element binding protein 1c (SREBP-1c), the master regulator of genes involved in lipogenesis.10,11 By this way, oral administration of the potent synthetic agonist T0901317 increased hepatic fatty acid synthesis, hepatic steatosis, and VLDL-TG.12 Therefore, LXR activators are a double-edged sword, limiting their potential utility in a clinical setting. Natural products provide a source of potential drug leads from which over the millennia humankind has identified not only phytomedicines and herbal remedies but also most of our current drugs.13 Plant secondary metabolites have awoken significant interest as protective dietary agents. In particular, flavonoids, with a diphenylpropane backbone structure (C6− C3−C6), demonstrated therapeutic action against inflammation, cardiovascular disease, diabetes, cancer, and neurodegenerative disorders.14−18 Given the structural similarities between flavonoids and cholesterol derivatives, and the promiscuous nature of most nuclear receptors, flavonoids have emerged as potential pharmacological modulators of NRs.19 Luteolin is one of the most common flavonoids that
uclear receptors (NRs) are lipophilic compound sensors essential in development, reproduction, cell growth, metabolism, immunity, and inflammation,1 which make them relevant therapeutic targets. Pharmaceutical NR agonists or antagonists, such as dexamethasone for glucocorticoid receptor (targeted in inflammatory pathologies), thiazolidinediones for peroxisome proliferator-activated receptor (PPAR) γ (targeted in type II diabetes), or tamoxifen for estrogen receptors (targeted in breast cancer), are among the most commonly used drugs.2 As emerging drug targets within the NR family are the two related liver X receptors LXRα (NR1H3) and LXRβ (NR1H2). LXRs are oxysterol sensors that bind their cognate response elements as permissive heterodimers with the retinoid X receptor (RXR) and regulate lipid and cholesterol metabolism as well as inflammation.3,4 LXR activation leads to increased levels of plasma HDL and a net cholesterol efflux via up-regulation of ABC transporters (ABCA1, ABCG1, ABCG5, ABCG8).5,6 Additionally, LXR signaling represses the production of inflammatory mediators such as inducible nitric oxide synthase (iNOS), cyclooxygenase (COX)-2, and cytokines IL-6 and IL-1β, through transcriptional silencing of nuclear factor (NF)-kB.6,7 In mice, LXR agonists decreased atherosclerotic lesions through induction of peripheral cholesterol efflux and inhibition of inflammation.8 Similar beneficial effects have been observed in nonhuman primates.9 Moreover, there is evidence that LXR agonists might also be © XXXX American Chemical Society and American Society of Pharmacognosy
Received: February 26, 2016
A
DOI: 10.1021/acs.jnatprod.6b00146 J. Nat. Prod. XXXX, XXX, XXX−XXX
Journal of Natural Products
Article
occurs in carrot, pepper, celery, parsley, and spinach. This flavone possesses important pharmacological activities, including antioxidant, antimicrobial, anticancer, antiallergic, and antiinflammatory.17,20,21 Given its beneficial effects, several luteolin supplements are currently available in the market. In the last years, new nutraceutical formulations, such as nanostructured lipid carriers, microemulsions, or phyto-phospholipid complexation, have been developed to overcome bioavailability and efficacy problems of pure luteolin supplements,22,23 thus optimizing delivery of luteolin and establishing higher correlations between in vitro and in vivo bioactivities. Recently, it was demonstrated that luteolin enhances insulin sensitivity and decreases adipokines production as well as adipogenic differentiation by agonizing PPARγ in adipocytes.24,25 Structural analysis of the PPARγ ligand binding domain (LBD) reveals that luteolin binds PPARγ (preferentially the nominally inactive B-chain subunit of the PPAR crystallographic dimer), acting as weak agonist and cooperating with other ligands.19,26 The flavonol quercetin was described to inhibit PI3K-LXRα-dependent lipid accumulation,27 but, to the best of our knowledge, the effect of luteolin on LXRs has not yet been studied. Herein, we disclose the potential of luteolin as an LXR modulator by evaluating its effect on LXRα/β transcriptional activity, lipid levels, and SREBP-1c expression in hepatocytes, as well as ABCA1 expression in macrophages.
Figure 1. Luteolin inhibits LXRα and LXRβ transcriptional activity induced by the reference agonist T0901317. LXRα (A) and LXRβ (B) reporter cells, purchased from Indigo Biosciences, were maintained in culture medium or incubated with 0.01−10 μM T0901317 alone (●) or in the presence of 10 (■), 25 (▲), or 50 (▼) μM luteolin for 22 h. Then, the luminescence was measured according to the manufacturer’s instructions. Results represent the relative light units (RLU) as a function of the log of T0901317 concentration.
■
RESULTS AND DISCUSSION The effect of the flavonoid luteolin on the transcriptional activation of LXRα/β was evaluated in nonhuman mammalian cells with an LXR responsive luciferase reporter gene using a commercial kit (Indigo Biosciences). Consistent with the function of T0901317 as an LXRα/β agonist, the transcriptional activity of both LXR isoforms was strongly augmented by increasing concentrations of T0901317, obtaining a sigmoid curve with an EC50 = 290 nM for LXRα and an EC50 = 240 nM for LXRβ (Figure 1). Incubation with luteolin potently decreases the T0901317-induced transcriptional activity of LXRα (Figure 1A) and LXRβ (Figure 1B) in a dose-dependent manner. At 10 μM luteolin, T0901317 still activates both LXRα and LXRβ, but 25 and 50 μM luteolin completely abrogate the transcriptional activity induced by the LXRα/β agonist T0901317. Luteolin alone (without LXRα/β agonist) did not activate the LXRα or LXRβ transcriptional activity (data not shown). To the best of our knowledge, this is the first time that luteolin is shown to be a modulator of LXRα/β activity. Administration of LXR agonist, such as synthetic compounds T0901317 and GW3965, dramatically reduced the atherosclerotic lesions in both LDL receptor (LDLR) and apolipoprotein E (apoE) knockout-mediated atherosclerosis mouse models.28,29 Furthermore, LXR agonists ameliorate amyloid pathology and memory deficits in mouse models of Alzheimer’s disease30,31 and suppressed the proliferation of prostate, breast, colon, and lung human cancer cell lines and the growth of
LNCaP prostate cancer xenografts.32,33 However, the clinical use of current synthetic LXR agonists is limited by undesired side effects. Indeed, oral administration of T0901317 to mice and hamsters increased hepatic and plasma triglyceride levels34 (i.e., hypertriglyceridemia, a known risk factor for cardiovascular disease), hepatic fatty acid synthesis, hepatic steatosis, and VLDL-TG.12 These deleterious effects are derived from LXRregulated induction of genes involved in lipogenesis, such as SREPB-1c.34 Therefore, to achieve maximal benefits of LXR agonist administration, it is crucial to control their action on hepatic lipogenesis. The effect of luteolin on the expression of the SREBP-1c transcription factor, induced by the LXR agonist T0901317, was evaluated using real-time RT-PCR (Figure 2). The results show that 50 μM luteolin completely abrogated the SREBP-1c expression induced by the LXRα/β agonist T0901317. At 10 and 25 μM, luteolin produced a leftward shift of the curve. Luteolin alone did not affect the SREBP-1c expression in HepG2 human hepatocytes, and none of the treatments used affected cell viability assessed through the MTT assay (data not shown). We next evaluated the effect of luteolin on intracellular B
DOI: 10.1021/acs.jnatprod.6b00146 J. Nat. Prod. XXXX, XXX, XXX−XXX
Journal of Natural Products
Article
and SREBP-1c activation.41 Our current finding that luteolin can inhibit LXR activation is consistent with its ability to lower lipid levels and promote positive therapeutic outcomes, which emphasizes the important biological function of this flavone. Besides SREBP-1c expression, the LXR also regulates the transcription of ABC cholesterol transporters and, consequently, cholesterol efflux in macrophages, which is involved in the reduction of atherosclerotic lesions by LXR agonists.5,6 Thus, we further evaluated the effect of luteolin on ABCA1 expression in RAW 264.7 macrophages by real-time RT-PCR (Figure 4). The data showed that the expression of ABCA1 increases with T0901317 in a dose-dependent way (0.01−10 μM), similarly to LXR transcriptional activity (Figure 4A). The data also demonstrated that luteolin inhibits ABCA1 expression in a dose-dependent way, with a strong effect at 50 μM. In particular, to 1 μM T0901317, 10 μM luteolin has no effect on ABCA1 expression, but 25 and 50 μM luteolin significantly inhibited ABCA1 expression by 41 ± 13% and 64 ± 10%, respectively (Figure 4B). Luteolin alone did not affect the ABCA1 expression in RAW 264.7 macrophages, and none of the treatments used affected the cell viability, assessed through MTT assay (data not shown). Since luteolin alone did not affect LXRα/β transcriptional activity or SREBP-1c or ABCA1 expression, and its effect on LXRα/β activation with T0901317 is dose-dependent, an unspecific interference of luteolin in the assays can be ruled out. The expression of ABCA1 membrane transporters contributed to the reduction of atherosclerotic plaques.42,43 Thus, the inhibition of LXR-induced ABCA1 expression in macrophages could compromise the cardiovascular therapeutic potential of luteolin. However, luteolin has been reported to reduce vascular smooth muscle cell proliferation and migration, both crucial to atherosclerosis pathophysiology.44 Furthermore, cardiovascular pathologies are inflammatory-related diseases,45 and the anti-inflammatory properties of luteolin have been extensively reported,20,21 even though luteolin inhibits LXR activation, strongly associated with repression of inflammation.6,7 Therefore, luteolin combines an LXR-independent antiinflammatory activity with an LXR-dependent decrease in lipogenesis, which could be very relevant in the treatment of pathologies simultaneously associated with a pro-inflammatory status and with a deregulated lipid metabolism, such as steatosis, cardiovascular diseases, and diabetes.15,45,46 In summary, the present study assesses, for the first time, the effect of the dietary flavonoid luteolin on LXRα/β activity. It was demonstrated that luteolin decreases hepatic lipid content through inhibition of SREBP-1c expression. Therefore, luteolin could abrogate hypertriglyceridemia associated with activation of LXRs as well as other lipid-associated diseases such as hepatic steatosis. Furthermore, the dual activities of luteolin to decrease both lipogenesis and inflammation could be advantageous in the treatment of pathologies associated with deregulated lipid metabolism and inflammatory status such as cardiovascular diseases and diabetes. These findings suggest that LXRα/β may be a new molecular target of luteolin and further support its health claims.
Figure 2. Luteolin modulates SREBP-1c expression in HepG2 human hepatocytes. HepG2 hepatocytes were maintained in culture medium or preincubated with (A) 0.01−10 μM T0901317 alone (●) or (B) 0.05 or 1 μM T0901317 for 1 h and then incubated with 10 (■), 25 (▲), or 50 (▼) μM luteolin for 12 h. The SREBP-1c mRNA levels were evaluated by real-time RT-PCR. The results were analyzed by the Pfaffl method and report the gene expression as relative fold changes compared to control (cells maintained in culture medium) and normalized to the reference gene HPRT1. Each value represents the mean ± SEM from two independent experiments performed in duplicate.
lipid accumulation in hepatocytes, using Oil Red-O staining (Figure 3). Data demonstrated that luteolin inhibits lipid accumulation induced by T0901317 in hepatocytes, which is in accordance with inhibition of SREBP-1c expression. These results suggest that luteolin may have fewer side effects compared to currently available LXR agonists. The ability of luteolin to inhibit LXR-dependent SREBP-1c expression, and consequently intracellular lipid levels, suggests the potential of this flavone in the treatment of lipid disorders, such as hypertriglyceridemia and hepatic steatosis. Thus, luteolin has been reported to be a down-regulator of SREBP1c expression and lipid accumulation in palmitate-treated HepG2 as a cellular model of steatosis,35 and the dietary flavone luteolin-7-glucoside was also able to decrease the hepatic expression of SREBP-1.36 Furthermore, it was also recently demonstrated that luteolin inhibits adipogenesis in 3T3-L1 cells, due to inhibition of transcriptional regulators of adipogenesis, including SREBP-1c.37 Luteolin was described as effective in ameliorating ethanol-induced hepatic steatosis and injury by significant reductions in serum concentrations of triacylglycerol (TG) (22%), LDL cholesterol (52%), and lipid accumulation and SREBP transcriptional activity in the liver.38 Wang et al. showed that luteolin treatment induced a significant decrease in serum triacylglycerol, total cholesterol, and LDL and increased HDL in diabetic rats.39 Moreover, luteolin is an inductor of cancer cell apoptosis, through inhibition of lipid biosynthesis due to the inhibition of fatty acid synthase,40 a key lipogenic enzyme, the expression of which is induced by LXR
■
EXPERIMENTAL SECTION
Test Chemical. Luteolin (HPLC, ≥99%) was obtained from Extrasynthese (Genay, France), catalog no. 1125S. General Experimental Methods. Luminescence was measured in a Biotek Synergy HT spectrophotometer (Biotek, Winooski, VT, USA), using Gen 5 software (Biotek) to monitor the results. C
DOI: 10.1021/acs.jnatprod.6b00146 J. Nat. Prod. XXXX, XXX, XXX−XXX
Journal of Natural Products
Article
Figure 3. Luteolin inhibits lipid accumulation in HepG2 human hepatocytes. HepG2 hepatocytes were maintained in culture medium (control) or preincubated with 50 μM luteolin for 1 h. Then 5 μM T0901317 was added for 24 h. Cells were stained with Oil Red-O dye, as described in the Experimental Section, and microphotographs were obtained using an Axiovert 40CFL microscope (Carl Zeiss, Germany). Absorbance was recorded using an ELISA automatic microplate reader (SLT, Austria). The concentration and purity of the RNA samples were evaluated using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies Inc.). RNA reverse transcription was performed on a C1000TM thermal cycler (BioRad, Hercules, CA, USA), and real-time RT-PCR was performed on a Bio-Rad My Cycler iQ5 (BioRad). An Axiovert 40CFL microscope (Carl Zeiss, Jena, Germany) was used to acquire the images of the Oil Red-O dye assay. LXRα/β Transcriptional Activity. LXRα and LXRβ reporter cells, provided in the commercial kit of Indigo Biosciences (State College, PA, USA), were maintained in culture medium or incubated with 0.01−10 μM T0901317 (Tocris Biosciences, Bristol, UK) alone or in the presence of 10, 25, or 50 μM luteolin for 22 h. Then, the luminescence was measured according to the manufacturer’s instructions, using a read time of 500 ms. Cell Culture. HepG2 human hepatocytes (ATCC number HB8065), gently supplied by Dr. Henrique Faneca (Center for Neurosciences and Cell Biology, University of Coimbra, Portugal), were cultured in DMEM low glucose (5.56 mM) (Invitrogen, Paisley, UK) supplemented with 10% (v/v) inactivated fetal bovine serum (FBS) (Gibco, Paisley, UK), 100 U/mL penicillin (Sigma−Aldrich ́ Quimica, Madrid, Spain), and 100 μg/mL streptomycin (Sigma− ́ Aldrich Quimica). RAW 264.7 murine macrophages (ATCC number ́ Vieira (Center for NeuroTIB-71), kindly supplied by Dr. Otilia sciences and Cell Biology, University of Coimbra, Portugal), were cultured in DMEM (Invitrogen) supplemented with 10% (v/v) ́ noninactivated FBS, 100 U/mL penicillin (Sigma−Aldrich Quimica), ́ and 100 μg/mL streptomycin (Sigma−Aldrich Quimica). The cells were cultured at 37 °C in a humidified atmosphere of 95% air and 5% CO2, and morphological changes were monitored by microscope observation during the experiments. Cell Viability. Metabolically active cells were assessed by the 3(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT; ́ Sigma−Aldrich Quimica) reduction colorimetric assay, as previously reported.47 Briefly, after cell treatment, RAW 264.7 or HepG2 cells were incubated with MTT at 37 °C for 15 or 60 min, respectively.
Then, dark blue crystals of formazan were solubilized with acidic 2propanol and quantified at 570 nm, with a reference wavelength of 620 nm. RNA Extraction and Real-Time RT-PCR. Cells were maintained in culture medium or preincubated with 0.01, 0.05, 0.1, 1, or 10 μM T0901317 (Tocris Biosciences) for 1 h, and then 10, 25, or 50 μM luteolin was added to RAW 264.7 macrophages or HepG2 human hepatocytes for 3 or 12 h, respectively. Total RNA was isolated from cells with Trizol reagent (Invitrogen, Barcelona, Spain). The concentration and purity of the RNA samples were evaluated by spectrophotometry. RNA reverse transcription was performed using an iScript Select cDNA synthesis kit (BioRad), according to the manufacturer’s instructions. The resulting cDNA of the housekeeping gene hypoxanthine phosphoribosyltransferase 1 (HPRT1), used as endogenous control, ABCA1, and SREBP-1c were amplified by realtime RT-PCR, using the SYBR-Green (BioRad) assay to monitor the amplification reactions. For that purpose, specific primers (MWG Biotech, Ebersberg, Germany) were designed with Beacon Designer Software v7.2 (Primier Biosoft International) (Table 1). Gene expression changes were analyzed using the built-in iQ5Optical system software v2, with the Pfaffl method.48 Gene expression was expressed as relative fold changes compared to control (cells maintained in culture medium) and normalized to HPRT1. Oil Red Staining. HepG2 hepatocytes were maintained in culture medium or preincubated with 25 or 50 μM luteolin for 1 h, and then 5 μM T0901317 (Tocris Biosciences) was added for 24 h. Cells were fixed with p-formaldehyde (4% in PBS) for 20 min at room temperature and then washed twice with phosphate-buffered saline (PBS) and once with distilled water. Cells were then stained with Oil Red-O dye (6:4, 0.6% Oil Red-O dye in water) for 45 min at room temperature and later washed two times with water. Cells were then observed, and images acquired. Statistical Analysis. Statistical analysis was performed using oneway ANOVA followed by Dunnett’s test and applied using GraphPad Prism, version 5.02 (GraphPad Software, San Diego, CA, USA). The significance level was *p < 0.05. D
DOI: 10.1021/acs.jnatprod.6b00146 J. Nat. Prod. XXXX, XXX, XXX−XXX
Journal of Natural Products
Article
hepatocyte-like cell line HepG2. This study was supported by FEDER/COMPETE (FCOMP-01-0124-FEDER-011096) and Foundation for Science and Technology (FCT), by the projects PTDC/SAU-FCF/105429/2008, PEst-OE/SAU/UI0177/ 2011, and PEst-C/SAU/LA0001/2011, and Ph.D. fellowships SFRH/BD/46281/2008 and SFRH/BD/72918/2010.
■
Figure 4. Luteolin inhibits ABCA1 expression in RAW 264.7 murine macrophages. RAW 264.7 macrophages were maintained in culture medium or preincubated with (A) 0.01−10 μM T0901317 alone (●) or (B) 1 μM T0901317 for 1 h and then incubated with 10 (■), 25 (▲), or 50 (▼) μM luteolin for 3 h. The ABCA1 mRNA levels were evaluated by real-time RT-PCR. The results were analyzed by the Pfaffl method and report the gene expression as relative fold changes compared to control (cells maintained in culture medium) (A) or T0901317 (B) samples and normalized to the reference gene HPRT1. Each value represents the mean ± SEM from three independent experiments performed in duplicate (*p < 0.05).
Table 1. Oligonucleotide Primer Pairs Used for Real-Time RT-PCR primer sequence (5′−3′)a
gene name HPRT1 (mouse) ABCA1 (mouse) HPRT1 (human) SREBP-1C (human) a
F: GTTGAAGATATAATTGACACTG R: GGCATATCCAACAACAAAC F: TTCTTCCTCATTACTGTTC R: CTCATCCTCGTCATTCAA F: TGACACTGGCAAAACAATG R: GGCTTATATCCAACACTTCG F: GACCGACATCGAAGACATGC R: GAGAGGAGCTCAATGTGGCA
F: forward sequence; R: reverse sequence.
■
REFERENCES
(1) McKenna, N. J.; Cooney, A. J.; DeMayo, F. J.; Downes, M.; Glass, C. K.; Lanz, R. B.; Lazar, M. A.; Mangelsdorf, D. J.; Moore, D. D.; Qin, J.; Steffen, D. L.; Tsai, M.-J.; Tsai, S. Y.; Yu, R.; Margolis, R. N.; Evans, R. M.; O’Malley, B. W. Mol. Endocrinol. 2009, 23 (6), 740−746. (2) Gronemeyer, H.; Gustafsson, J.-A.; Laudet, V. Nat. Rev. Drug Discovery 2004, 3 (11), 950−964. (3) Jakobsson, T.; Treuter, E.; Gustafsson, J.-Å.; Steffensen, K. R. Trends Pharmacol. Sci. 2012, 33 (7), 394−404. (4) Laurencikiene, J.; Rydén, M. Int. J. Obes. 2012, 36 (12), 1494− 1502. (5) Repa, J. J.; Turley, S. D.; Lobaccaro, J. A.; Medina, J.; Li, L.; Lustig, K.; Shan, B.; Heyman, R. A.; Dietschy, J. M.; Mangelsdorf, D. J. Science 2000, 289 (5484), 1524−1529. (6) Zhu, R.; Ou, Z.; Ruan, X.; Gong, J. Mol. Med. Rep. 2012, 5 (4), 895−900. (7) A-González, N.; Castrillo, A. Biochim. Biophys. Acta, Mol. Basis Dis. 2011, 1812 (8), 982−994. (8) Im, S.-S.; Osborne, T. F. Circ. Res. 2011, 108 (8), 996−1001. (9) Quinet, E. M.; Basso, M. D.; Halpern, A. R.; Yates, D. W.; Steffan, R. J.; Clerin, V.; Resmini, C.; Keith, J. C.; Berrodin, T. J.; Feingold, I.; Zhong, W.; Hartman, H. B.; Evans, M. J.; Gardell, S. J.; DiBlasioSmith, E.; Mounts, W. M.; LaVallie, E. R.; Wrobel, J.; Nambi, P.; Vlasuk, G. P. J. Lipid Res. 2009, 50 (12), 2358−2370. (10) Repa, J. J. Genes Dev. 2000, 14 (22), 2819−2830. (11) Kim, Y. W.; Kim, Y. M.; Yang, Y. M.; Kim, T. H.; Hwang, S. J.; Lee, J. R.; Kim, S. C.; Kim, S. G. Free Radical Biol. Med. 2010, 48 (4), 567−578. (12) Grefhorst, A.; Elzinga, B. M.; Voshol, P. J.; Plösch, T.; Kok, T.; Bloks, V. W.; van der Sluijs, F. H.; Havekes, L. M.; Romijn, J. A.; Verkade, H. J.; Kuipers, F. J. Biol. Chem. 2002, 277 (37), 34182− 34190. (13) Cragg, G. M.; Newman, D. J. Biochim. Biophys. Acta, Gen. Subj. 2013, 1830 (6), 3670−3695. (14) Middleton, E.; Kandaswami, C.; Theoharides, T. C. Pharmacol. Rev. 2000, 52 (4), 673−751. (15) Perez-Vizcaino, F.; Duarte, J. Mol. Aspects Med. 2010, 31 (6), 478−494. (16) Francisco, V.; Costa, G.; Neves, B. M.; Cruz, M. T.; Batista, M. T. In Polyphenols in Human Health and Disease -vol 1; Watson, R., Preedy, V., Zibadi, S., Eds.; Elsevier, 2014; pp 373−392. (17) Costa, G.; Francisco, V.; Lopes, M. C.; Cruz, M. T.; Batista, M. T. Curr. Med. Chem. 2012, 19 (18), 2876−2900. (18) Romano, B.; Pagano, E.; Montanaro, V.; Fortunato, A. L.; Milic, N.; Borrelli, F. Phytother. Res. 2013, 27 (11), 1588−1596. (19) Avior, Y.; Bomze, D.; Ramon, O.; Nahmias, Y. Food Funct. 2013, 4 (6), 831−844. (20) López-Lázaro, M. Mini-Rev. Med. Chem. 2009, 9 (1), 31−59. (21) Seelinger, G.; Merfort, I.; Schempp, C. M. Planta Med. 2008, 74 (14), 1667−1677. (22) Khan, J.; Saraf, S.; Saraf, S. Pharm. Dev. Technol. 2016, 1−12. (23) Liu, Y.; Wang, L.; Zhao, Y.; He, M.; Zhang, X.; Niu, M.; Feng, N. Int. J. Pharm. 2014, 476 (1−2), 169−177. (24) Ding, L.; Jin, D.; Chen, X. J. Nutr. Biochem. 2010, 21 (10), 941− 947. (25) Park, H.-S.; Kim, S.-H.; Kim, Y. S.; Ryu, S. Y.; Hwang, J.-T.; Yang, H. J.; Kim, G.-H.; Kwon, D. Y.; Kim, M.-S. BioFactors 2009, 35 (4), 373−37910.1002/biof.38. (26) Puhl, A. C.; Bernardes, A.; Silveira, R. L.; Yuan, J.; Campos, J. L. O.; Saidemberg, D. M.; Palma, M. S.; Cvoro, A.; Ayers, S. D.; Webb,
AUTHOR INFORMATION
Corresponding Author
*Tel (M. T. Cruz): +351 239 488 400. Fax: +351 239 488 503. E-mail: trosete@ff.uc.pt. Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS The authors sincerely thank Dr. O. Vieira (CNC, University of Coimbra, Portugal) for the kind gift of the mouse macrophagelike cell line RAW 264.7, and Dr. H. Faneca (CNC, University of Coimbra, Portugal) for the kind gift of the human E
DOI: 10.1021/acs.jnatprod.6b00146 J. Nat. Prod. XXXX, XXX, XXX−XXX
Journal of Natural Products
Article
P.; Reinach, P. S.; Skaf, M. S.; Polikarpov, I. Mol. Pharmacol. 2012, 81 (6), 788−799. (27) Pisonero-Vaquero, S.; García-Mediavilla, M. V.; Jorquera, F.; Majano, P. L.; Benet, M.; Jover, R.; González-Gallego, J.; SánchezCampos, S. Lab. Invest. 2014, 94 (3), 262−274. (28) Joseph, S. B.; McKilligin, E.; Pei, L.; Watson, M. A.; Collins, A. R.; Laffitte, B. A.; Chen, M.; Noh, G.; Goodman, J.; Hagger, G. N.; Tran, J.; Tippin, T. K.; Wang, X.; Lusis, A. J.; Hsueh, W. A.; Law, R. E.; Collins, J. L.; Willson, T. M.; Tontonoz, P. Proc. Natl. Acad. Sci. U. S. A. 2002, 99 (11), 7604−7609. (29) Levin, N.; Bischoff, E. D.; Daige, C. L.; Thomas, D.; Vu, C. T.; Heyman, R. A.; Tangirala, R. K.; Schulman, I. G. Arterioscler. Thromb. Vasc. Biol. 2005, 25 (1), 135−142. (30) Donkin, J. J.; Stukas, S.; Hirsch-Reinshagen, V.; Namjoshi, D.; Wilkinson, A.; May, S.; Chan, J.; Fan, J.; Collins, J.; Wellington, C. L. J. Biol. Chem. 2010, 285 (44), 34144−34154. (31) Fitz, N. F.; Cronican, A.; Pham, T.; Fogg, A.; Fauq, A. H.; Chapman, R.; Lefterov, I.; Koldamova, R. J. Neurosci. 2010, 30 (20), 6862−6872. (32) Chuu, C.-P. Med. Hypotheses 2011, 76 (5), 697−699. (33) Fukuchi, J.; Kokontis, J. M.; Hiipakka, R. A.; Chuu, C.-P.; Liao, S. Cancer Res. 2004, 64 (21), 7686−7689. (34) Schultz, J. R. Genes Dev. 2000, 14 (22), 2831−2838. (35) Liu, J.-F.; Ma, Y.; Wang, Y.; Du, Z.-Y.; Shen, J.-K.; Peng, H.-L. Phytother. Res. 2011, 25 (4), 588−596. (36) Sá, C.; Oliveira, A. R.; Machado, C.; Azevedo, M.; PereiraWilson, C. Evid. Based. Complement. Alternat. Med. 2015, 2015, 647832. (37) Poudel, B.; Nepali, S.; Xin, M.; Ki, H.; Kim, Y.; Kim, D.; Lee, Y. Mol. Med. Rep. 2015, 12 (2), 3139−3145. (38) Liu, G.; Zhang, Y.; Liu, C.; Xu, D.; Zhang, R.; Cheng, Y.; Pan, Y.; Huang, C.; Chen, Y. J. Nutr. 2014, 144 (7), 1009−1015. (39) Wang, G.; Li, W.; Lu, X.; Bao, P.; Zhao, X. J. Diabetes Complications 2012, 26 (4), 259−265. (40) Brusselmans, K.; Vrolix, R.; Verhoeven, G.; Swinnen, J. V. J. Biol. Chem. 2005, 280 (7), 5636−5645. (41) Grønning-Wang, L. M.; Bindesbøll, C.; Nebb, H. I. In Lipid Metabolism; Baez, R. V., Ed.; InTech: Rijeka, 2013; pp 61−90. (42) Naik, S. U.; Wang, X.; Da Silva, J. S.; Jaye, M.; Macphee, C. H.; Reilly, M. P.; Billheimer, J. T.; Rothblat, G. H.; Rader, D. J. Circulation 2006, 113 (1), 90−97. (43) Lee, S. D.; Tontonoz, P. Atherosclerosis 2015, 242 (1), 29−36. (44) Jiang, D.; Li, D.; Wu, W. Nutrients 2013, 5 (5), 1648−1659. (45) Libby, P. Arterioscler., Thromb., Vasc. Biol. 2012, 32 (9), 2045− 2051. (46) Esser, N.; Legrand-Poels, S.; Piette, J.; Scheen, A. J.; Paquot, N. Diabetes Res. Clin. Pract. 2014, 105 (2), 141−150. (47) Francisco, V.; Figueirinha, A.; Neves, B. M.; García-Rodríguez, C.; Lopes, M. C.; Cruz, M. T.; Batista, M. T. J. Ethnopharmacol. 2011, 133 (2), 818−827. (48) Pfaffl, M. W. Nucleic Acids Res. 2001, 29 (9), e45.
F
DOI: 10.1021/acs.jnatprod.6b00146 J. Nat. Prod. XXXX, XXX, XXX−XXX
