The Mechanism of Ca2+ Movement in the Involvement of Baicalein

Jul 8, 2015 - The Mechanism of Ca2+ Movement in the Involvement of Baicalein-Induced Cytotoxicity in ZR-75-1 Human Breast Cancer Cells. Hong-Tai Chang...
1 downloads 6 Views 3MB Size
Download PDF
Article pubs.acs.org/jnp

The Mechanism of Ca2+ Movement in the Involvement of BaicaleinInduced Cytotoxicity in ZR-75‑1 Human Breast Cancer Cells Hong-Tai Chang,† Chiang-Ting Chou,‡,§ Daih-Huang Kuo,⊥ Pochuen Shieh,⊥ Chung-Ren Jan,∥ and Wei-Zhe Liang*,∥ †

Department of Surgery, Kaohsiung Veterans General Hospital, Kaohsiung 813, Taiwan, Republic of China Department of Nursing, Division of Basic Medical Sciences, Chang Gung University of Science and Technology, Chia-Yi 613, Taiwan, Republic of China § Chronic Diseases and Health Promotion Research Center, Chang Gung University of Science and Technology, Chia-Yi 613, Taiwan, Republic of China ⊥ Department of Pharmacy, Tajen University, Pingtung 907, Taiwan, Republic of China ∥ Department of Medical Education and Research, Kaohsiung Veterans General Hospital, 386 Ta-Chung 1st Road, Kaohsiung 813, Taiwan, Republic of China ‡

ABSTRACT: Baicalein (5,6,7-trihydroxyflavone) (1) has been found to be active against a wide variety of cancer cells. However, the molecular mechanism underlying the effects of 1 on the induction of Ca2+ movement and cytotoxicity in human breast cancer cells is unknown. This study examined the relationship between 1-induced Ca2+ signaling and cytotoxicity in ZR-75-1 human breast cancer cells. The in vitro investigations reported herein produced the following results: (i) Compound 1 increased intracellular Ca2+ concentration ([Ca2+]i) in a concentration-dependent manner. The signal was decreased by approximately 50% by removal of extracellular Ca2+. (ii) Compound 1-triggered [Ca2+]i increases were significantly suppressed by store-operated Ca2+ channel blockers 2-aminoethoxydiphenyl borate (2-APB) and the PKC inhibitor GF109203X. (iii) In Ca2+-free medium, compound 1-induced [Ca2+]i increases were also inhibited by GF109203X. Furthermore, pretreatment with the endoplasmic reticulum Ca2+ pump inhibitor thapsigargin (TG) or 2,5-ditert-butylhydroquinone (BHQ) abolished 1-induced [Ca2+]i increases. Inhibition of phospholipase C (PLC) with U73122 abolished 1-induced [Ca2+]i increases. (iv) Compound 1 (20−40 μM) caused cytotoxicity, increased reactive oxygen species (ROS) production, and activated caspase-9/caspase-3. Furthermore, compound 1induced apoptosis was significantly inhibited by prechelating cytosolic Ca2+ with BAPTA-AM (1,2-bis(2-aminophenoxy)ethaneN,N,N′,N′-tetraacetic acid acetoxymethyl ester) or by decreasing ROS with the antioxidant NAC (N-acetylcysteine). Together, baicalein (1) induced a [Ca2+]i increase by inducing PLC-dependent Ca2+ release from the endoplasmic reticulum and Ca2+ entry via PKC-dependent, 2-APB-sensitive store-operated Ca2+ channels. Moreover, baicalein (1) induced Ca2+-associated apoptosis involved ROS production in ZR-75-1 cells.

B

widely studied in several malignancies.6,7 It has been shown that 1 has cytotoxic effects on cancer cells including AGS human gastric cancer cells, HeLa human cervical cancer cells, and MCF7 human breast cancer cells.8 Previous studies have shown that 1 can induce apoptosis by increasing the intracellular Ca2+ concentration ([Ca2+]i) in human SCC-4 human tongue cancer cells9 and MDA-MB-231 human breast cancer cells.10 However, the mechanism of Ca2+ signaling pathway has not been established in human breast cancer cells. Therefore, the effect of 1 on Ca2+ signaling pathways needs to be studied in detail. Apoptosis is one of the most important processes leading to cell death. Interference with the apoptotic process is considered a

reast cancer is the most prevalent cancer in the world. Each year breast cancer accounts for the mortality of more than 400000 females worldwide. Most cases occur in women over the age of 50.1,2 The goal of treating early breast cancer is to get rid of the cancer and keep it from coming back. Treatment for early breast cancer includes combination of surgery, radiation therapy, and chemotherapy, but the cure rates are not satisfactory.3 Therefore, new agents acting on targets of breast cancer need further investigation. Phytochemicals are naturally occurring, plant-based substances that have garnered much interest in the research world for their biological properties, both as therapeutics and as components of the diet for chemoprevention.4,5 Baicalein (5,6,7trihydroxyflavone) (1), one such phytochemical derived from the root of Scutullaria baialensis Georgi (Lamiaceae), has been © XXXX American Chemical Society and American Society of Pharmacognosy

Received: February 26, 2015

A

DOI: 10.1021/acs.jnatprod.5b00173 J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products

Article

crucial part of cancer prevention and therapy.11,12 The ability of Ca2+ signaling to regulate apoptotic pathways suggests that modulating Ca2+ signaling in cancer cells might be a therapeutic option.13,14 However, apoptosis can occur both in Ca2+dependent and Ca2+-independent mechanisms. It has been shown that diindolylmethane, derived from indole-3-carbinol in cruciferous vegetables, induced apoptosis in C33A human cervical cancer cells independent of increased [Ca2+]i, whereas diindolylmethane-induced apoptosis in DU145 human prostate cancer cells required elevated [Ca2+]i for full response.15 Therefore, the role of Ca2+ in apoptosis needs to be established for each stimulant and cell type. In the present study, we employed ZR-75-1 human breast cancer cells which express an elevated level of plasma membrane Ca2+-ATPase. This enzyme is an important regulator of free intracellular Ca2+ concentration ([Ca2+]i), making ZR-75-1 human breast cancer cells a useful model for evaluating agentinduced effects on Ca2+ regulation.16 Furthermore, in this cell, [Ca2+]i can be increased in response to the stimulation of various agents such as bombesin17 or tamoxifen.18 Therefore, the ZR-751 cell line was used in this study because it produces measurable [Ca2+]i increases upon pharmacological stimulation. This study was aimed to explore the mechanisms underlying the effects of baicalein (1) on [Ca2+]i, cell viability, and apoptosis in ZR-75-1 cells. The [Ca2+]i increases were characterized, the concentration−response plots were established, and the pathways underlying the Ca2+ entry and Ca2+ release were explored. The cytotoxic effect of baicalein (1) and the involvement of apoptotic pathways were investigated.

■

RESULTS AND DISCUSSION Baicalein (1) Raised [Ca2+]i in Either Ca2+-Containing Medium or Ca2+-Free Medium. The effect of 1 on basal [Ca2+]i was examined. Figure 1A shows that the basal [Ca2+]i was 50 ± 3 nM. At concentrations between 20 and 40 μM, compound 1 induced [Ca2+]i increases in a concentration-dependent manner in Ca2+-containing medium. At a concentration of 10 μM, compound 1 did not alter [Ca2+]i. At 40 μM, compound 1 increased [Ca2+]i to 220 ± 3 nM (n = 3; baseline subtracted). The Ca2+ response saturated at 40 μM 1 because 50 μM 1 triggered a similar response as that did by 40 μM 1 (data not shown). Figure 1B shows that in Ca2+-free medium, the basal [Ca2+]i was 50 ± 2 nM and 40 μM 1 induced [Ca2+]i increases of 103 ± 3 nM. When Ca2+-free experiments were performed, 0.1 mL of cell suspension was added to 0.9 mL of Ca2+-free medium that was contained in a cuvette in the chamber of the fluorescence detecting instrument. Then the fluorescence recording was immediately conducted. The basal [Ca2+]i was detected only after cells were exposed to the Ca2+-free medium for seconds. Therefore, the basal [Ca2+]i levels in Ca2+-containing medium and Ca2+-free medium were similar. Figure 1C shows the concentration−response plots of 1-induced responses. The EC50 value was 25 ± 3 or 35 ± 3 μM in Ca2+-containing medium or Ca2+-free medium, respectively, fitting to a Hill equation. Baicalein (1)-Induced Mn2+ Influx. Experiments were performed to confirm that 1-induced [Ca2+]i increases involved Ca2+ influx. Because Mn2+ enters cells through similar pathways as Ca2+ but quenches fura-2 fluorescence at all excitation wavelengths,19 quenching of fura-2 fluorescence excited at the Ca2+-insensitive excitation wavelength of 360 nm by Mn2+ implies Ca2+ influx. Figure 2 shows that 40 μM 1 induced an immediate decrease in the 360 nm excitation signal by 35 ± 5 (n

Figure 1. Baicalein (1)-induced [Ca2+]i increases in fura-2-loaded human breast cancer cells. (A) Compound 1 was added to cells at 25 s at concentrations indicated. Ca2+-containing medium was used in these experiments. (B) Compound 1-induced [Ca2+]i increases in Ca2+-free medium. Compound 1 was added at 25 s. (C) Plots of concentration− response relationships of 1-evoked [Ca2+]i increases in the presence or absence of extracellular Ca2+. The y axis is the percentage of the net (baseline subtracted) area under the curve (25−250 s) of the [Ca2+]i increase induced by 50 μM 1 in Ca2+-containing medium. Data are mean ± SEM of three separate experiments. *p < 0.05 compared to open circles. Data are mean ± SEM of three separate experiments.

= 3) arbitrary units (trace b compared to trace a). This suggests that 1-induced [Ca2+]i increases involved Ca2+ influx. Pathways of Baicalein (1)-Induced [Ca2+]i Increases. Because compound 1-induced Ca2+ response saturated at 40 μM (Figure 1), this concentration of 1 was used as control in subsequent experiments. The store-operated Ca2+ channel blockers 2-aminoethoxydiphenyl borate (2-APB) (30 μM), econazole (0.5 μM), and SKF96365 (5 μM), the PKC activator phorbol 12-myristate 13 acetate (PMA; 1 nM), and the PKC inhibitor GF109203X (2 μM) were applied 1 min before 40 μM 1 in Ca2+-containing medium. Addition of 2-APB, econazole, SKF96365, PMA, or GF109203X alone did not alter basal [Ca2+]i (data not shown). In Ca2+-containing medium, both 2APB and GF109203X inhibited 1-induced [Ca2+]i increases by 48 ± 5% or 94 ± 3%, respectively (p < 0.05; Figure 3A). Figure 3B shows that in Ca2+-free medium, GF109203X also inhibited B

DOI: 10.1021/acs.jnatprod.5b00173 J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products

Article

Figure 2. Effect of baicalein (1) on Ca2+ influx by measuring Mn2+ quenching of fura-2 fluorescence. Experiments were performed in Ca2+containing medium. MnCl2 (50 μM) was added to cells 1 min before fluorescence measurements. The y axis is fluorescence intensity (in arbitrary units) measured at the Ca2+-insensitive excitation wavelength of 360 nm and the emission wavelength of 510 nm. Compound 1 (40 μM) was added as indicated. Data are mean ± SEM of three separate experiments.

1-induced [Ca2+]i increases by 96 ± 3% (p < 0.05). Figure 3C shows the original tracings of 2-APB- and GF109203X-induced inhibition of 1-induced [Ca2+]i increases. Pretreatment with Endoplasmic Reticulum Ca2+ Pump Inhibitors Blocks 1-Induced [Ca 2+ ] i Increases and Pretreatment with 1 Increase the [Ca2+]ER. Data presented in Figure 1 illustrate that removing extracellular Ca2+ reduced the ability of 1 to increase [Ca2+]i. Therefore, we explored the Ca2+ stores that were involved in 1-induced Ca2+ release. Data presented in Figure 4A show that thapsigargin (TG; 1 μM), an inhibitor of endoplasmic reticulum Ca2+ pumps,20 increased [Ca2+]i to 102 ± 3 nM, and that subsequent addition of 1 (40 μM) failed to change [Ca2+]i. Figure 4B shows that in Ca2+-free medium, addition of 40 μM 1 prevented the [Ca2+]i increases induced by TG. Another endoplasmic reticulum Ca2+ pump inhibitor 2,5-di-tert-butylhydroquinone (BHQ; 50 μM)21 was used to confirm the TG’s effect. Figure 4C shows that BHQ evoked [Ca2+]i increases of 101 ± 3 nM, and subsequently added 1 had no effect on [Ca2+]i. Conversely, Figure 4D shows that BHQ did not induce [Ca2+]i increases after 1 incubation. In Ca2+free medium, TG or BHQ increased [Ca2+]i by blocking the ability of the endoplasmic reticulum Ca2+ pump to pump Ca2+ into the endoplasmic reticulum, leading to depletion of the Ca2+ store. Store depletion can secondarily activate plasma membrane Ca2+ channels, allowing an influx of Ca2+ into the cytosol.20,21 Therefore, it suggests that the mechanism of Ca2+ release from the endoplasmic reticulum activated by 1 appears to be similar to that of TG or BHQ. The higher [Ca2+]ER in 1-treated cells, estimated using the TG-induced Ca2+ release method, was confirmed using the direct quantification of luminal [Ca2+]ER (Figure 4F). The luminal [Ca2+]ER was significantly higher in 1treated cells (0.875 ± 0.02) compared with control cells (0.67 ± 0.02). Thus, it suggested that the [Ca2+]i increases by 1 induced could be linked to the high luminal [Ca2+]ER. Involvement of Orai1 and Stromal Interaction Molecule 1 (STIM1) Proteins in 1-Induced Store-Operated Ca2+ Entry in ZR-75-1 Cells. Because both Orai1 and STIM1 are key proteins in store-operated Ca2+ entry in breast cancer cells,22 the involvement of the Orai1 and STIM1 proteins in the effects of 1 on Ca2+ signaling in ZR-75-1 cells were explored. The cells were treated with Orai1 or STIM1 targeting siRNA (siOrai1 or siSTIM1 20 nM) for 48 h during the 1 treatments of the cells.

Figure 3. Effect of Ca2+ channel modulators on baicalein (1)-induced [Ca2+]i increases. (A) Experiments were performed in Ca2+-containing medium. In blocker- or modulator-treated groups, the reagent was added 1 min before 1 (40 μM). The concentration was 30 μM for 2APB, 0.5 μM for econazole, 5 μM for SKF96365, 10 nM for phorbol 12myristate 13-acetate (PMA), and 2 μM for GF109203X. Data are expressed as the percentage of 40 μM 1-induced [Ca2+]i increases (150 s interval; net area under the curve) and are mean ± SEM of three separate experiments. (B) Similar to (A), in Ca2+-free medium, GF109203X (2 μM) was added 1 min before 1 (40 μM). Data are mean ± SEM of three separate experiments. *p < 0.05 compared to 1st column. (C) Trace a: control (40 μM 1). Trace b: 2-APB was added 1 min before 1. Trace c: GF109203X was added 1 min before 1. C

DOI: 10.1021/acs.jnatprod.5b00173 J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products

Article

Figure 4. Ca2+ stores for baicalein (1)-induced Ca2+ release. (A−D) Experiments were performed in Ca2+-free medium. Compound 1 (40 μM), thapsigargin (TG; 1 μM), and BHQ (50 μM) were added at time points indicated. Compound 1 pretreatment greatly inhibited TG or BHQ-induced [Ca2+]i increases, and conversely, TG or BHQ pretreatment also inhibited compound 1-induced Ca2+ release. Experiments were performed in Ca2+-free medium. (E) Measurement of [Ca2+]ER in response to 100 μM IP3 (Ca2+ release), followed by 0.4 mM ATP (Ca2+ reload), as indicated in the figure. Lower trace: control. Upper trace: compound 1 (40 μM). Data are mean ± SEM of three separate experiments.

Then Ca2+ measurement experiments were performed. As shown in Figure 5A, the treatment of the cells by siOrai1 or siSTIM1 suppressed the 1-induced [Ca2+]i increases by 48 ± 5% or 48 ± 4%, respectively. Parts B and C of Figure 5 show the original tracings of siOrai1 and siSTIM1-induced inhibition of 1-induced [Ca2+]i increases. These data suggest that both Orai1 and STIM1 proteins are involved in the store-operated Ca2+ entry induced by 1. Inhibition of PLC Abolishes 1-Induced [Ca2+]i Increases. The data presented in Figure 4 demonstrate that compound 1 released Ca2+ from the endoplasmic reticulum. Because PLC-dependent production of inositol 1,4,5-trisphosphate is a key process for releasing Ca2+ from the endoplasmic reticulum,23 the role of PLC in this process was examined. It has been shown that ATP can influence biological processes via P2X purinoreceptors.24 Previous studies have shown that ATP can serve as a PLC-dependent agonist of [Ca2+]i increase via P2X purinoreceptors in breast cancer cells.25 Therefore, we chose to use ATP to examine the role of PLC in our study. U73122, a PLC inhibitor in breast cancer cells,26 was used to determine whether

Figure 5. Effect of Orai1 or STIM1 knockdown on Ca2+ entry induced by baicalein (1) treatments in ZR-75-1 cells. (A) Forty-eight hours prior to recording Ca2+ signals by Ca2+ measurements, cells were divided into paired groups and transfected with control siRNA (siCTL), siOrai1, or siSTIM1 in the presence of 1 (40 μM). Using the same protocol described above, data are expressed as the percentage of 40 μM 1induced [Ca2+]i increases (net area under the curve) and are mean ± SEM of three separate experiments. (B,C) For Ca2+ recording, cells were treated with TG (1 μM) in Ca2+-free medium (0 mM CaCl2) and exposed to 2 mM extracellular Ca2+ (2 mM CaCl2) as indicated.

the activation of this enzyme was required for 1-induced Ca2+ release. First, we established the effectiveness of U73122 as a PLC inhibitor under our experimental conditions. Figure 6 shows that incubation with 2 μM U73122 did not change basal [Ca2+]i but abolished ATP-induced [Ca2+]i increase. This suggests that U73122 effectively suppressed PLC activity. Figure D

DOI: 10.1021/acs.jnatprod.5b00173 J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products

Article

Figure 6. U73122-induced inhibition of baicalein (1)-induced Ca2+ release. Experiments were performed in Ca2+-free medium. (A) Trace a: compound 1 (40 μM) was added at 25 s. Trace b: ATP (10 μM) was added at 25 s. Trace c: U73122 (2 μM) was added at 25 s. Trace d: compound 1 was added 60 s after U73122 (25 s). Trace e: ATP was added 60 s after U73122 (25 s). Trace f: compound 1 was added 90 s after ATP (60 s) and U73122 (25 s). (B) First column is 40 μM 1-induced [Ca2+]i increases. Second column shows that 2 μM U73122 did not alter basal [Ca2+]i. Third column shows that U73122 pretreatment for 200 s abolished 40 μM 1-induced [Ca2+]i increases (*p < 0.05 compared to first column). Fourth column shows the ATPinduced [Ca2+]i increases compared to 1 control. Fifth column shows that U73122 pretreatment for 200 s abolished ATP-induced [Ca2+]i increases (*p < 0.05 compared to first column). Sixth column shows that U73122 and ATP pretreatment (for 200 and 50 s, respectively) abolished 40 μM 1-induced [Ca2+]i increases (*p < 0.05 compared to first column). Data are mean ± SEM of three separate experiments.

20−50 μM 1, cell viability decreased in a concentrationdependent manner. Figure 6 also shows that 5 μM BAPTAAM treatment alone did not affect cell viability. In the presence of 20−50 μM 1, BAPTA-AM treatment partially reversed 1induced cell death by 14.2 ± 1.1%, 22.4 ± 0.8%, 24.2 ± 0.5%, or 16.8 ± 0.5%, respectively (p < 0.05). Baicalein (1) Induced Ca2+-Associated Apoptosis. Because apoptosis plays an important role in cell death, the next set of experiments explored whether 1-induced cell death involved apoptosis. Annexin V/PI staining was applied to detect apoptotic cells after 1 treatment. Data presented in Figure 8A,B show that 1 at 20, 30, or 40 μM can induce apoptosis that can be partially blocked by BAPTA-AM at 14.1 ± 1.4%, 36.1 ± 1.3%, or 38.6 ± 1.5%, respectively (p < 0.05). Baicalein (1)-Induced Apoptosis Involves the Production of Reactive Oxygen Species (ROS). Because ROS is involved in apoptotic pathways,29 we explored the effect of 1 on ROS production. Cells were treated with the probe dichlorofluorescein diacetate (DCFH-DA) to detect the changes in intracellular redox status. Figure 9A,B shows that 2′,7′-

6 also shows that 40 μM 1-evoked [Ca2+]i increases were set as 100% (control). Incubation with U73122 inhibited 1-induced [Ca2+]i increases by 95 ± 3%, and the combination of U73122 and ATP also abolished 1-induced [Ca2+]i increases. This suggests that compound 1-induced Ca2+ release was solely via a PLC-dependent mechanism, given the release was abolished when PLC activity was inhibited by U73122. Baicalein (1)-Induced Cell Death is Preceded by an Increase in [Ca2+]i. Because elevated [Ca2+]i can cause cell death, experiments were performed to examine whether 1induced cytotoxicity was triggered by an increase in [Ca2+]i in ZR-75-1 cells. In various cancer cell types including breast cancer cells, the intracellular Ca2+ chelator BAPTA-AM has been shown to prevent [Ca2+]i increases during 1 treatment.27,28 5 μM BAPTA-AM treatment abolished 40 μM 1-induced [Ca2+]i increases in Ca2+-containing medium. Furthermore, 5 μM BAPTA-AM treatment for 25 h produced the same results (data not shown). This suggests that BAPTA-AM effectively prevented an increase in [Ca2+]i during 1 treatment. In Figure 7, cells were treated with 0−50 μM 1 for 24 h. In the presence of E

DOI: 10.1021/acs.jnatprod.5b00173 J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products

Article

Figure 7. Pretreatment with the Ca2+ chelator BAPTA-AM reduces baicalein (1) cytotoxicity. Cells were treated with 0−50 μM 1 for 24 h, and cell viability assay was conducted. Data are mean ± SEM of three separate experiments. Each treatment had six replicates (wells). Data are expressed as percentage of control that is the increase in cell numbers in 1-free groups. Control had 11677 ± 326 cells/well before experiments and 12127 ± 655 cells/well after incubation for 24 h. *p < 0.05 compared to control. #p < 0.05 compared to the pairing group. In each group, the Ca2+ chelator BAPTA-AM (5 μM) was added to cells, followed by treatment with 1 in Ca2+-containing medium. Cell viability assay was subsequently performed.

dichlorofluorescein (DCF) fluorescence intensity was increased in 1-treated cells. In the presence of 20−40 μM 1, ROS production were increased by 3.6%, 22.7%, 32.7%, or 43.2%, respectively (baseline level of H2O2 was subtracted). BAPTAAM treatment partially decreased 1-increased ROS production by 9.3 ± 1.4%, 16.9 ± 1.3%, or 24.4 ± 1.5%, respectively (p < 0.05). Given that acute incubation with 1 significantly increased ROS production, experiments were performed to examine whether 1-induced apoptosis involved ROS production. NAcetylcysteine (NAC) is an aminothiol and synthetic precursor of intracellular cysteine and glutathione and is thus considered as an important antioxidant.30 NAC was used to prevent H2O2 production during 1 treatment. Figure 9C shows that 5 μM NAC treatment did not change the control value of cell viability. In the presence of 20−50 μM 1, NAC treatment partially reversed 1induced cell death by 8.6 ± 1.1%, 20.8 ± 1.1%, 14.7 ± 0.7%, or 10.2 ± 0.6%, respectively (p < 0.05). Furthermore, in Figure 9D,E, at a concentration of 20, 30, or 40 μM 1, NAC treatment partially decreased 1-induced apoptosis by 15.7 ± 1.5%, 38.6 ± 1.2%, or 43.7 ± 1.2%, respectively (p < 0.05). In addition, in Figure 8F, when cells were pretreated with the combination of BAPTA-AM and NAC, both BAPTA-AM and NAC treatments partially reversed 1-induced cell death by 11.4 ± 1.1%, 21.6 ± 0.8%, 19.5 ± 0.5%, or 13.5 ± 0.5%, respectively (p < 0.05). The results suggest that pretreatment with the combination of BAPTA-AM and NAC did not enhance the reversing ability of each treatment alone in 1-induced cell death. Baicalein (1)-Induced [Ca2+]i Increase Is Associated with Caspase-9/Caspase-3 Activation. Because the cleavage of caspase-9 and caspase-3 plays a key role in apoptosis,11 experiments were conducted to explore whether 1 activated caspase-9 and caspase-3. Parts A and D of Figure 10 show that cleaved caspase-9 or caspase-3 level was increased by treatment with 20, 30, or 40 μM 1 for 24 h. In the BAPTA-AM or NAC group, 5 μM BAPTA-AM or 5 μM NAC loading did not activate

Figure 8. Effect of combination of baicalein (1) and BAPTA-AM on apoptosis. (A) Cells were treated with 20−40 μM 1, respectively, for 24 h, and BAPTA-AM (5 μM) was added to cells followed by treatment with 1 in BAPTA-AM-containing medium. Cells were then processed for Annexin V/PI staining and analyzed by flow cytometry. (B) Percentage of early apoptotic cells and late apoptotic cells. Data are mean ± SEM of three experiments. The three experiments were independent biological replicates. *p < 0.05 compared to the pairing group.

caspase-9 and caspase-3. Figure 10B shows that 5 μM BAPTAAM inhibited 20, 30, or 40 μM 1-induced caspase-9 activation by 3.3 ± 1.2, 8.4 ± 1.1, or 7.8 ± 1.1 fold, respectively (p < 0.05). Figure 10C shows that 5 μM BAPTA-AM also inhibited 20, 30, or 40 μM 1-induced caspase-3 activation by 2.2 ± 0.8, 6.7 ± 1.1, or 9.9 ± 1.2 fold, respectively (p < 0.05). Similarly, Figure 10E shows that 5 μM NAC inhibited 20, 30, or 40 μM 1-induced caspase-9 activation by 3.2 ± 1.1, 6.7 ± 1.2, or 6.9 ± 1.1 fold, respectively (p < 0.05). Figure 10F shows that 5 μM NAC also inhibited 20, 30, or 40 μM 1-induced caspase-3 activation by 5.3 ± 1.2, 9.4 ± 1.3, or 7.8 ± 1.2 fold, respectively (p < 0.05). In previous research, compound 1 induced various biological effects related to Ca2+ signaling in different cell models. It has been shown that cellular Ca2+ modulates 1-induced cell death in SCC-4 human tongue cancer cells,9 MDA-MB-231 human breast F

DOI: 10.1021/acs.jnatprod.5b00173 J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products

Article

Figure 9. Relationship between baicalein (1)-increased ROS production and apoptosis. (A) Representative histogram showing differences between DCF fluorescence intensity in untreated cells and cells treated with 20−40 μM 1 for 24 h. In BAPTA-AM group, BAPTA-AM (5 μM) was added to cells followed by treatment with 1 in Ca2+-containing medium. (B) M1 represents the percentage of H2O2 production. A baseline level of H2O2 counts was obtained when cells were incubated with phosphate buffered saline (PBS) alone and without 10 μM dichlorofluorescein diacetate (DCFH-DA) for 30 min at 37 °C. The baseline level of H2O2 was 0.05%. *p < 0.05 compared to control. #p < 0.05 compared to the pairing group. Data are mean ± SEM of three separate experiments. (C) In each group, the antioxidant NAC (5 μM) was added to cells, followed by treatment with 1 (20−50 μM) in NACcontaining medium. Cell viability assay was subsequently performed. *p < 0.05 compared to control. #p < 0.05 compared to the pairing group. (D) Cells were treated with 1 (20−40 μM), respectively, for 24 h, and NAC (5 μM) was added to cells followed by treatment with 1 in NAC-containing medium. Cells were then processed for Annexin V/PI staining and analyzed by flow cytometry. (E) Percentage of early apoptotic cells and late apoptotic cells. Data are mean ± SEM of three experiments. The three experiments were independent biological replicates. *p < 0.05 compared to the pairing group. (F) In each group, the Ca2+ chelator BAPTA-AM (5 μM) and the antioxidant NAC (5 μM) were added to cells followed by treatment with 1 (20−50 μM) in medium. Cell viability assay was subsequently performed. *p < 0.05 compared to control. #p < 0.05 compared to the pairing group.

cancer cells,10 and human N18 mouse−rat hybrid retina ganglion cells.31 In cardiomyocytes, compound 1 protects lysophosphatidylcholine-induced cytotoxicity from inhibition of Ca2+ over-

load.32 In rat primary mesencephalic cultures, compound 1 played a neuromodulatory role in inhibiting glutamate-induced [Ca2+]i increases.33 Therefore, it appears that 1 has different Ca2+ G

DOI: 10.1021/acs.jnatprod.5b00173 J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products

Article

Figure 10. Effect of combination of BAPTA-AM or NAC and baicalein (1) on activation of caspase-9/caspase-3. (A,D) Protein extracts were prepared 24 h after exposure to various concentrations of 1. In BAPTA-AM or NAC group, BAPTA-AM (5 μM) or NAC (5 μM) was added to cells followed by treatment with 1 in medium. Data are typical of three separate experiments. (B,C,E,F) Effect of 1 on activation of caspase-9/caspase-3 as quantified by densitometry. The figure normalizes intensities of the bands of cleaved caspase-9/caspase-3 against the bands of β-actin using NIH image 1.61. *p < 0.05 compared to control. #p < 0.05 compared to the pairing group. Data are mean ± SEM of three separate experiments.

the measurement of 200 s, suggesting that Mn2+ influx continuously occurred throughout this interval. Store-operated Ca2+ channels have been shown to play an important role in Ca2+ influx in different human breast cancer cells.34,35 Therefore, the role of store-operated Ca2+ channels was explored in 1-induced [Ca2+]i levels. These three compounds have often been applied as blockers of store-operated Ca2+ entry in different breast cancer cell types including ZR-75-1 cells which our study used.36−40 Our study shows that 2-APB inhibited 1induced [Ca2+]i increases by approximately 50% in Ca2+containing medium, which was similar to the magnitude of 1induced Ca2+ influx. Furthermore, this study further shows that directly knockdown the expression of Orail and STIM1 in storeoperated Ca2+ entry significantly inhibited 1-induced Ca2+ increase. Therefore, the results suggest that 1 may cause Ca2+

signaling effects on various cells depending on the experimental conditions. In this study, the results indicate that 1 induced a concentration-dependent [Ca2+]i increase in ZR-75-1 human breast cancer cells. Compound 1 has also been shown to induce [Ca2+]i increases in MDA-MB-231 human breast cancer cells.10 Because the mechanisms of the [Ca2+]i increase had not been explored in ZR-75-1 cells previously, this study would focus on this cell to investigate the effect of 1 on Ca2+ signaling pathway. Compound 1 increased [Ca2+]i, partly by depleting intracellular Ca2+ stores. Another contribution of the [Ca2+]i increase was from Ca2+ entry because removing extracellular Ca2+ reduced approximately 50% of 1-induced [Ca2+ ] i increase. Mn 2+ quenching data suggest that 1 induced Ca2+ entry. The magnitude of 1-induced Mn2+ quenching did not change during H

DOI: 10.1021/acs.jnatprod.5b00173 J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products

Article

dependent manner. Moreover, BAPTA-AM treatment significantly decreased 1-increased ROS production. The data suggest that 1-increased ROS production was related to a previous [Ca2+]i increase. Furthermore, treatment with the antioxidant NAC significantly decreased 1-induced apoptosis. Therefore, 1induced apoptosis appears to involve ROS production. Previous studies showed that compound 1 reduced TGF-β1mediated epithelial−mesenchymal transition (EMT) by reducing the expression level of EMT-related transcription factor, Slug via the NF-κB pathway, and subsequently increased migration in MCF10A normal breast epithelial cells. Furthermore, compound 1 inhibited TGF-β1-mediated EMT, anchorage-independent growth and cell migration in MDA-MB-231 human breast cancer cells.46 The results suggest that compound 1 may suppress the EMT of breast epithelial cells and the tumorigenic activity of breast cancer cells. Thus, this compound could have a potential as therapeutic or supplementary agent for the treatment of breast cancer. To address the concern that 1 could achieve relevant antitumor concentrations in vivo, the measurement of 1 locally in plasma levels is imperative. Previous studies explored the plasma concentration of 1 after oral ingestion. BioResponse 1 (BR- 1)-related adverse effects were reported at doses up to 100 mg. A single 100 mg dose of BR-1 resulted in a mean Cmax of ∼30 μM after 24 h.47,48 Thus, our study may have clinical relevance. In sum, baicalein (1) induced Ca2+ release from endoplasmic reticulum in a PLC-dependent manner and also caused Ca2+ entry through PKC-dependent, store-operated Ca2+ channels in ZR-75-1 human breast cancer cells. Furthermore, our study shows that baicalein (1)-induced cell death involved the production of ROS and the activation of caspase-9/caspase-3 in a Ca2+ dependent manner. Thus, it appears that baicalein (1)induced Ca2+-associated apoptosis involved ROS production in ZR-75-1 human breast cancer cells.

influx via 2-APB-sensitive, econazole and SKF96365-insensitive store-operated Ca2+ entry. Regarding the Ca2+ stores involved in 1-evoked Ca2+ release, the TG/BHQ-sensitive endoplasmic reticulum store seemed to be the dominant one, given that pretreatment with TG or BHQ abolished 1-induced [Ca2+]i increases, and conversely, incubation with 1 abolished TG or BHQ-induced [Ca2+]i increases, the mechanism of Ca2+ release from the endoplasmic reticulum activated by 1 appears to be similar to that of TG or BHQ, namely, by inhibiting the endoplasmic reticulum Ca2+-ATPase. In our study, TG or BHQ pretreatment abolished 1-induced [Ca2+]i increases, and conversely, 1 pretreatment also abolished TG or BHQ-induced Ca2+ release. This suggests that these three compounds all can prevent the refilling of the Ca2+ store in the endoplasmic reticulum. The activity of many protein kinases is directly or indirectly coupled to Ca2+.41−43 In this study, the PKC activator (PMA) and inhibitor (GF109203X) were applied to explore whether 1 induced Ca2+ influx via PKC activity. These two agents have often been applied as modulators of Ca2+ entry through PKC activity in different breast cell types including normal epithelial cells or cancer cells.44,45 Our data show that 1-induced [Ca2+]i increases were decreased when PKC activity was inhibited. In contrast, activation of PKC did not enhance the [Ca2+]i increases. This might be because the 40 μM 1-induced [Ca2+]i increases had reached the maximal level. In Ca2+ -free medium, GF109203X also fully inhibited 1-induced [Ca2+]i increases, suggesting that inhibition of PKC suppressed Ca2+ release, which in turn, blocked store-operated Ca2+ entry. The data further show that the Ca2+ release was via a PLC-dependent mechanism given the release was abolished when PLC activity was inhibited. Cellular activation by many agonists results in the stimulation of PLC and the subsequent hydrolysis of phosphatidylinositol 4,5bisphosphate to IP3 and diacylglycerol (DAG).41,42 Each of these two molecules exerts a specific effect on the cell. The increased DAG concentration leads to the activation of PKC, while IP3 binds to the IP3 receptor (IP3R), an intracellular Ca2+-release channel located in the endoplasmic reticulum, thereby inducing Ca2+ release from internal stores.41,42 Therefore, the data suggest that 1 induced [Ca2+]i increases by evoking PLC-dependent Ca2+ release from the endoplasmic reticulum and Ca2+ entry via the PKC-regulated IP3 signaling pathway. Cell death could be Ca2+-dependent or -independent, depending on cell type and the stimulant.15 In this study, compound 1-induced cell death was partially reversed when cytosolic Ca2+ was chelated by BAPTA-AM. This implies that 1induced cell death was partially triggered by a [Ca2+]i increase. The data further show that 1 induced apoptosis through the activation of caspase-9 and caspase-3. In addition, BAPTA-AM treatment significantly decreased 1-induced apoptosis. Therefore, it suggests that Ca2+ plays an important role in 1-induced apoptosis. Previous studies showed that 1 between 25 and 75 μM induced apoptosis in MDA-MB-231 cells.10 However, our study shows that treatment with 20−40 μM 1 induced apoptosis in ZR75-1 cells. Therefore, it appears that 1-induced apoptosis is concentration-related in breast cancer cells. Various physiological effects including cytotoxicity can result from oxidative stress-induced apoptotic signaling that is consequent to ROS increases, disruption of intracellular redox homeostasis, and irreversible oxidative modifications of lipid, protein, or DNA.29 Therefore, this study explored whether 1 induced apoptosis in ZR-75-1 cells via ROS production. The results show that 1 increased ROS production in a concentration-

■

EXPERIMENTAL SECTION

Chemicals. The reagents for cell culture were purchased from Gibco (Gaithersburg, MD, USA). Fura-2-AM and BAPTA-AM were from Molecular Probes (Eugene, OR, USA). The antioxidant NAC (N-acetylL-cysteine) was from Calbiochem (La Jolla, CA, USA). Baicalein (1) and the other compounds were from Sigma-Aldrich (St. Louis, MO, USA). The purity of baicalein (1) (95.2%) was determined by HPTLC densitometry.49 Cell Culture. ZR-75-1 human breast cancer cells were purchased from Bioresource Collection and Research Center (Taiwan) and were cultured in RPMI-1640 medium supplemented with 10% heatinactivated fetal bovine serum, 100 U/mL penicillin, and 100 μg/mL streptomycin at 37 °C in a humidified 5% CO2 atmosphere. Experimental Solutions. Ca2+-containing medium (pH 7.4) contained 140 mM NaCl, 5 mM KCl, 1 mM MgCl2, 2 mM CaCl2, 10 mM HEPES, and 5 mM glucose. Ca2+-free medium (pH 7.4) contained 140 mM NaCl, 5 mM KCl, 3 mM MgCl2, 0.3 mM EGTA, 10 mM HEPES, and 5 mM glucose. Lysis buffer (pH 7.5) contained 20 mM Tris, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton, 2.5 mM sodium pyrophosphate, 1 mM β-glycerophosphate, 1 mM Na3VO4, 1 μg/mL leupeptin, and 1 mM phenylmethylsulfonyl fluoride. TBST (pH 7.5) contained 25 mM Tris, 150 mM NaCl, and 0.1% (v/v) Tween 20. Phosphate buffer saline (PBS, pH 7.4) contained 137 mM NaCl, 10 mM phosphate, and 2.7 mM KCl. Compound 1 was dissolved in DMSO as a 0.1 M stock solution. The other reagents were dissolved in water, ethanol, or DMSO. The concentration of organic solvents in the experimental solution was less than 0.1% and did not alter basal [Ca2+]i, cell viability or apoptosis. [Ca2+]i Measurements. Confluent cells grown on 6 cm dishes were trypsinized and made into a suspension in RPMI-1640 medium at a concentration of 1 × 106 cells/mL. Cell viability (>95%) was assured by I

DOI: 10.1021/acs.jnatprod.5b00173 J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products

Article

multiwall plate reader. Absolute optical density was normalized to the absorbance of unstimulated cells in each plate and expressed as a percentage of the control value. Alexa Fluor 488 Annexin V/Propidium iodide (PI) Staining for Apoptosis. Annexin V/PI staining assay was employed to further detect cells in early apoptotic and late apoptotic stages. Cells were exposed to 1 at concentrations of 20−40 μM for 24 h. Cells were harvested after incubation and washed in cold phosphate-buffered saline (PBS). Cells were resuspended in 400 μL of solution with 10 mM HEPES, 140 mM NaC1, and 2.5 mM CaC12 (pH 7.4). Alexa Fluor 488 annexin V/PI staining solution (Probes Invitrogen, Eugene, OR, USA) was added in the dark. After incubation for 15 min, the cells were collected and analyzed in a FACScan flow cytometry analyzer. Excitation wavelength was at 488 nm, and the emitted green fluorescence of annexin V (FL1) and red fluorescence of PI (FL2) were collected using 530 and 575 nm band pass filters, respectively. A total of at least 20000 cells were analyzed per sample. Light scatter was measured on a linear scale of 1024 channels, and fluorescence intensity was on a logarithmic scale. The amount of early apoptosis and late apoptosis were determined, respectively, as the percentage of annexin V+/PI− or annexin V+/PI+ cells. Data were later analyzed using the flow cytometry analysis software WinMDI 2.8 (by Joe Trotter, freely distributed software). The x and y coordinates refer to the intensity of fluorescence of annexin V and PI, respectively. Measurements of Intracellular Contents of ROS. Cells cultured in 6-well plates were treated with 20−40 μM 1 for 24 h. Subsequently, cells were trypsinized and made into suspensions (1 × 106 cells/mL). For measuring intracellular ROS content, cells were treated with the probe dichlorofluorescein diacetate (DCFH-DA) that responds to changes in intracellular redox status. Cells were incubated with 10 μM membrane-permeable probe DCFH-DA for 30 min at 37 °C. Inside cells, the acetate moieties of DCFH-DA were cleaved and oxidized, primarily by H2O2, to green fluorescent 2′,7′-dichlorofluorescein (DCF).53 Flow cytometry was performed by using a flow cytometer (FACScan; Becton Dickinson, Mountain View, CA, USA). A 15 mm aircooled argon-ion laser was used to excite fluorescent DCF at 488 nm, and the emitted fluorescence was measured using a 530/30 nm band pass optical filter. Samples were run using 10000 cells per test sample. Data were analyzed using the CELL QUEST programs (Cellquest Wireless, Flushing, MI, USA). Assessment of Cleavage of Caspase-9 and Caspase-3 Levels by Western Immunoblotting. Cells were seeded to 6 cm culture dishes (3 × 106 cells/dish). After cells were grown to confluence, cells were treated with 20, 30, or 40 μM 1 for 24 h. The treatments were terminated by aspirating the supernatant and then washing the dishes with PBS. The cells were lysed on ice for 5 min with 70 μL of lysis buffer. The cell lysates were centrifuged to remove insoluble materials, and the protein concentration of each sample was measured. Approximately 50 μg of supernatant protein from each sample was used for gel electrophoresis analysis on a 10% SDS-polyacrylamide gel. The fractionated proteins on gel were transferred to PVDF membranes (NEN Life Science Products, Inc., Boston, MA, USA). For immuoblotting, the membranes were blocked with 5% nonfat milk in TBST and incubated overnight with the primary antibody (rabbit antihuman cleavage caspase-9/3 or rabbit antihuman β-actin; all from Cell Signaling Technology, Beverly, MA, USA). Then the membranes were extensively washed with TBST and incubated for 60 min with the secondary antibody (goat antirabbit antibody or goat antimouse antibody, Transduction Laboratories, Lexington, KY, USA). After extensive washing with TBST, the immune complexes were detected by chemiluminescence using the Renaissance Western Blot Chemiluminescence Reagent Plus kit (NEN). Statistics. Data are reported as mean ± SEM of three separate experiments. Data were analyzed by one-way analysis of variances (ANOVA) using the Statistical Analysis System (SAS, SAS Institute Inc., Cary, NC, USA). Multiple comparisons between group means were performed by post hoc analysis using the Tukey’s HSD (honestly significantly difference) procedure. A P-value less than 0.05 were considered significant.

trypan blue exclusion. The viability was routinely greater than 95% after the treatment. Cells were loaded with 2 μM fura-2-AM for 30 min at 25 °C in the same medium. Cells were subsequently washed with Ca2+containing medium twice and were made into a suspension in Ca2+containing medium at a concentration of 1 × 107 cells/mL. Fura-2 fluorescence measurements were performed in a water-jacketed cuvette (25 °C) with continuous stirring; the cuvette had 1 mL of medium and 0.5 million cells. Fluorescence was recorded with a Shimadzu RF5301PC spectrofluorophotometer immediately after 0.1 mL of cell suspension was added to 0.9 mL of Ca2+-containing or Ca2+-free medium by measuring excitation signals at 340 and 380 nm and emission signal at 510 nm at 1 s intervals. During the recording, reagents were added to the cuvette by pausing the recording for 3 s to open and close the cuvette-containing chamber. For calibration of [Ca2+]i, after completion of the experiments, the detergent Triton X-100 (0.1%) and CaCl2 (5 mM) were added to the cuvette to obtain the maximal fura-2 fluorescence. The Ca2+ chelator EGTA (10 mM) was subsequently added to the cuvette to chelate Ca2+ and obtain the minimal fura-2 fluorescence. Control experiments showed that cells bathed in a cuvette with 50 μM 1 had a viability of 95% after 20 min of fluorescence measurements. [Ca2+]i was calculated as described previously.50 Mn2+ quenching of fura-2 fluorescence was performed in Ca2+containing medium containing 50 μM MnCl2. MnCl2 was added to cell suspension in the cuvette 1 min before starting the fluorescence recording. Data were recorded at excitation signal at 360 nm (Ca2+insensitive) and emission signal at 510 nm at 1 s intervals as described previously.19 Direct Quantification of [Ca2+]ER. For imaging [Ca2+]ER, cells were loaded with 2 μM Mag-fura-2-AM for 45 min at 37 °C. After incubation with the dye, the cells were briefly rinsed in a high K+ intracellular buffer solution (125 mM KCl, 25 mM NaCl, 10 mM HEPES, pH 7.2, and 0.1 mM MgCl2) and then exposed for 2 min to the intracellular buffer at 37 °C with 5 mg/mL digitonin. Digitonin-permeabilized cells were perfused continuously with digitonin-free intracellular buffer supplemented with 0.2 mM Mg2+-ATP and free [Ca2+] clamped to 170 nM using Ca2+/EGTA buffer. The Mag-fura-2 fluorescence ratio was calibrated using exposure to 10 μM ionomycin and 15 mM Ca2+ or 10 mM EGTA, assuming a dissociation constant for Ca2+-Mag-fura-2 at room temperature (21 °C) of 53 μM.51 Ratio imaging measurements of Mag-fura-2 fluorescence were made using a Quanticell 900 imaging system. siRNA Transfections. For siRNA experiments, equal numbers of cells from the same culture were seeded, transfected overnight with 20 nM of control siRNA (target sequence: AAGGGAAGACCUCAAUUACCAUU) (targeting Luciferase mRNA) (Eurogentec, Belgium), raised against Orai1 mRNA (siOrai1) (target sequence: CUGUCCUCUAAGAGAUAA), or raised against STIM1 mRNA (siSTIM1) (target sequence: AAGGGAAGACCUCAAUUACCAUU), using Hyperfect transfection reagent (Qiagen Inc., Courtaboeuf, France) according to the manufacturer’s instructions. Medium was changed after 24 h, and cells were incubated for a further 48 h with or without 1 before performing Ca2+ experiments. Previous studies showed the efficiency of the siOrai1 or siSTIM1 used in the present study in down-regulating the expression of the Orai1 or STIM1 protein.52 Cell Viability Assays. The measurement of cell viability was based on the ability of cells to cleave tetrazolium salts by dehydrogenases. The intensity of developed color directly correlated with the number of live cells. Assays were performed according to manufacturer’s instructions specifically designed for this assay (Roche Molecular Biochemical, Indianapolis, IN, USA). Cells were seeded in 96-well plates at a density of 10000 cells/well in culture medium for 24 h in the presence of 1. The cell viability detecting reagent 4-[3-[4-lodophenyl]-2-4(4-nitrophenyl)2H-5-tetrazolio-1,3-benzene disulfonate] (WST-1; 10 μL pure solution) was added to samples after treatment with 1, and cells were incubated for 30 min in a humidified atmosphere. In experiments using BAPTA-AM to chelate cytosolic Ca2+ to inhibit cytosolic caspase, cells were treated with 5 μM BAPTA-AM for 1 h prior to incubation with 1. The cells were washed once with Ca2+-containing medium and incubated with/without 1 for 24 h. The absorbance of samples (A450) was determined using a J

DOI: 10.1021/acs.jnatprod.5b00173 J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products

■

Article

(29) Circu, M. L.; Aw, T. Y. Free Radical Biol. Med. 2010, 48, 749−762. (30) Zafarullah, M.; Li, W. Q.; Sylvester, J.; Ahmad, M. Cell. Mol. Life Sci. 2003, 60, 6−20. (31) Li, Y. C.; Lin, H. J.; Yang, J. H.; Yang, J. S.; Ho, H. C.; Chang, S. J.; Hsai, T. C.; Lu, H. F.; Huang, A. C.; Chung, J. G. Neurochem. Res. 2009, 34, 418−429. (32) Chen, H. M.; Hsu, J. H.; Liou, S. F.; Chen, T. J.; Chen, L. Y.; Chiu, C. C.; Yeh, J. L. BMC Complementary Altern. Med. 2014, 14, 233. (33) Yu, X.; He, G. R.; Sun, L.; Lan, X.; Shi, L. L.; Xuan, Z. H.; Du, G. H. Life Sci. 2012, 91, 5−13. (34) Davis, F. M.; Peters, A. A.; Grice, D. M.; Cabot, P. J.; Parat, M. O.; Roberts-Thomson, S. J.; Monteith, G. R. PLoS One 2012, 7, e36923 (2012) . (35) Liao, J. Y.; Li, L. L.; Wei, Q.; Yue, J. C. Arch. Biochem. Biophys. 2007, 458, 244−252. (36) Chen, Y. T.; Chen, Y. F.; Chiu, W. T.; Wang, Y. K.; Chang, H. C.; Shen, M. R. J. Cell Sci. 2013, 126, 1260−1267. (37) Motiani, R. K.; Abdullaev, I. F.; Trebak, M. J. Biol. Chem. 2010, 285, 19173−19183. (38) Zhang, Y.; Crump, M.; Berge, S. A. Breast Cancer Res. Treat. 2002, 72, 265−278. (39) Azimi, I.; Roberts-Thomson, S. J.; Monteith, G. R. Br. J. Pharmacol. 2014, 171, 945−960. (40) Ghoneum, M.; Matsuura, M.; Braga, M.; Gollapudi, S. Int. J. Oncol. 2008, 33, 533−539. (41) Bootman, M. D.; Berridge, M. J.; Roderick, H. L. Curr. Biol. 2002, 12, R563−R565. (42) Clapham, D. E. Nature 1995, 375, 634−635. (43) Mai, Y.; Higashi, T.; Terada, K.; Hatate, C.; Nepal, P.; Horiguchi, M.; Harada, T.; Miwa, S.; Horinouchi, T. J. Pharmacol. Sci. 2012, 120, 310−314. (44) Greco, S.; Muscella, A.; Elia, M. G.; Romano, S.; Storelli, C.; Marsigliante, S. J. Cell. Physiol. 2004, 201, 84−96. (45) Jiménez, E.; Montiel, M. J. Cell. Physiol. 2005, 204, 678−686. (46) Chung, H.; Choi, H. S.; Seo, E. K.; Kang, D. H.; Oh, E. S. Biochem. Biophys. Res. Commun. 2015, 458, 707−713. (47) Akao, T.; Sato, K.; Hanada, M. Biol. Pharm. Bull. 2009, 32, 2079− 2082. (48) Guo, X. Y.; Yang, L.; Chen, Y.; Wang, Q. F.; Sun, Q. S.; Che, Y. X.; Che, Q. M. J. Asian Nat. Prod. Res. 2011, 13, 861−868. (49) Darekar, R. S.; Khetre, A. B.; Singh, S. M.; Damle, M. C. J. Planar Chromatogr.–Mod. TLC 2009, 22, 453−456. (50) Grynkiewicz, G.; Poenie, M.; Tsien, R. Y. J. Biol. Chem. 1985, 260, 3440−3450. (51) Hofer, A. M.; Schulz, I. Cell Calcium 1996, 20, 235−242. (52) Motiani, R. K.; Abdullaev, I. F.; Trebak, M. J. Biol. Chem. 2010, 285, 19173−19183. (53) Rothe, G.; Valet, G. J. Leukocyte Biol. 1990, 47, 440−448.

AUTHOR INFORMATION

Corresponding Author

*Phone: +886 7 3422121, ext 1508. Fax: +886 7 3468056. Email: [email protected]. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by grants from Kaohsiung Veterans General Hospital (VGHKS103-105) to C.-R. Jan, and Ministry of Science and Technology (MOST103-2314-B-075B-002) to H.-T.C.

■

REFERENCES

(1) Jemal, A.; Siegel, R.; Ward, E.; Hao, Y.; Xu, J.; Thun, M. J. CaCancer J. Clin. 2009, 59, 225−249. (2) Lin, C. H.; Chuang, P. Y.; Chiang, C. J.; Lu, Y. S.; Cheng, A. L.; Kuo, W. H.; Huang, C. S.; Lai, M. S.; You, S. L.; Tang, C. H. Oncologist 2014, 19, 583−591. (3) Wang, B. R.; Chang, Y. L.; Chen, T. J.; Chiu, J. H.; Wu, J. C.; Wu, M. S.; Chou, C. L.; Chou, Y. C. Patient Prefer. Adherence 2014, 8, 671−682. (4) Wang, L.; Lee, I. M.; Zhang, S. M.; Blumberg, J. B.; Buring, J. E.; Sesso, H. D. Am. J. Clin. Nutr. 2009, 89, 905−912. (5) Weng, C. J.; Yen, G. C. Cancer Metastasis Rev. 2012, 31, 323−351. (6) Bonham, M.; Posakony, J.; Coleman, I.; Montgomery, B.; Simon, J.; Nelson, P. S. Clin. Cancer Res. 2005, 11, 3905−3914. (7) Gao, Z.; Huang, K.; Yang, X.; Xu, H. Biochim. Biophys. Acta, Gen. Subj. 1999, 1472, 643−650. (8) Tayarani-Najaran, Z.; Emami, S. A.; Asili, J.; Mirzaei, A.; Mousavi, S. H. Evid. Based Complement. Alternat. Med. 2011, 2011, 160682. (9) Lin, Y. T.; Yang, J. S.; Lin, H. J.; Tan, T. W.; Tang, N. Y.; Chaing, J. H.; Chang, Y. H.; Lu, H. F.; Chung, J. G. In Vivo 2007, 21, 1053−1058. (10) Lee, J. H.; Li, Y. C.; Ip, S. W.; Hsu, S. C.; Chang, N. W.; Tang, N. Y.; Yu, C. S.; Chou, S. T.; Lin, S. S.; Lino, C. C.; Yang, J. S.; Chung, J. G. Anticancer Res. 2008, 28, 1701−1711. (11) Lowe, S. W.; Lin, A. W. Carcinogenesis 2000, 21, 485−495. (12) Woynarowska, B. A.; Woynarowska, J. M. Biochim. Biophys. Acta 2002, 1587, 309−317. (13) Biagioli, M.; Pifferi, S.; Ragghianti, M.; Bucci, S.; Rizzuto, R.; Pinton, P. Cell Calcium 2008, 43, 184−195. (14) Demaurex, N.; Distelhorst, C. Science 2003, 300, 65−67. (15) Savino, J. A., III; Evans, J. F.; Rabinowitz, D.; Auborn, K. J.; Carter, T. H. Mol. Cancer Ther. 2006, 5, 556−563. (16) Lee, W. J.; Roberts-Thomson, S. J.; Monteith, G. R. Biochem. Biophys. Res. Commun. 2005, 337, 779−783. (17) Bold, R. J.; Ishizuka, J.; Yao, C. Z.; Townsend, C. M., Jr.; Thompson, J. C. Anticancer Res. 1998, 18, 4051−4056. (18) Chang, H. T.; Huang, J. K.; Wang, J. L.; Cheng, J. S.; Lee, K. C.; Lo, Y. K.; Liu, C. P.; Chou, K. J.; Chen, W. C.; Su, W.; Law, Y. P.; Jan, C. R. Breast Cancer Res. Treat. 2002, 71, 125−131. (19) Merritt, J. E.; Jacob, R.; Hallam, T. J. J. Biol. Chem. 1989, 264, 1522−1527. (20) Thastrup, O.; Cullen, P. J.; Drøbak, B. K.; Hanley, M. R.; Dawson, A. P. Proc. Natl. Acad. Sci. U. S. A. 1990, 87, 2466−2470. (21) Van Esch, G. J. Food Chem. Toxicol. 1986, 24, 1063−1065. (22) Hu, J.; Qin, K.; Zhang, Y.; Gong, J.; Li, N.; Lv, D.; Xiang, R.; Tan, X. Biochem. Biophys. Res. Commun. 2011, 411, 786−791. (23) Kang, M.; Othmer, H. G. Phys. Biol. 2007, 4, 325−343. (24) Burnstock, G.; Di Virgilio, F. Purinergic Signalling 2013, 9, 491− 540. (25) Dixon, C. J.; Bowler, W. B.; Fleetwood, P.; Ginty, A. F.; Gallagher, J. A.; Carron, J. A. Br. J. Cancer 1997, 75, 34−39. (26) Kumar, B.; Kumar, A.; Ghosh, S.; Pandey, B. N.; Mishra, K. P.; Hazra, B. Biochem. Biophys. Res. Commun. 2012, 417, 903−909. (27) Cao, X. H.; Zhao, S. S.; Liu, D. Y.; Wang, Z.; Niu, L. L.; Hou, L. H.; Wang, C. L. Chem.-Biol. Interact. 2011, 190, 16−27. (28) Tsien, R. Y. Biochemistry 1980, 19, 2396−2404. K

DOI: 10.1021/acs.jnatprod.5b00173 J. Nat. Prod. XXXX, XXX, XXX−XXX