The pH-Sensitive Nanocarrier Mediated ... - ACS Publications

Subscriber access provided by University of South Dakota

Biological and Medical Applications of Materials and Interfaces

The pH-sensitive nanocarrier mediated codelivery of simvastatin and noggin siRNA for synergistic enhancement of osteogenesis Jinsheng Huang, Chaowen Lin, Jintao Fang, Xiaoxia Li, Jin Wang, Shaohui Deng, Sheng Zhang, Wanhan Su, Xiaoreng Feng, Bin Chen, Du Cheng, and Xintao Shuai ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.8b10521 • Publication Date (Web): 01 Aug 2018 Downloaded from http://pubs.acs.org on August 4, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

The pH-Sensitive Nanocarrier Mediated Codelivery of Simvastatin and Noggin siRNA for Synergistic Enhancement of Osteogenesis Jinsheng Huang,†,1 Chaowen Lin,†,2 Jintao Fang,†,3 Xiaoxia Li,1 Jin Wang,4 Shaohui Deng,1 Sheng Zhang,2 Wanhan Su,5 Xiaoreng Feng,2 Bin Chen,*,2 Du Cheng,*,1 and Xintao Shuai*,1,4

1

PCFM Lab of Ministry of Education, School of Materials Science and Engineering,

Sun Yat-sen University, Guangzhou, 510275, China. 2

Department of Orthopaedics and Traumatology, Nanfang Hospital, Southern Medical

University, Guangzhou, 510515, China. 3

Department of Microsurgery & Orthopedic Trauma, The First Affiliated Hospital of

Sun Yat-sen University, Guangzhou, 510080, China. 4

The Third Affiliated Hospital, Sun Yat-sen University, Guangzhou, 510630, China.

5

Department of Spinal Surgery, Longyan First Hospital, Fujian Medical University,

Fujian, 364000, China. †

These authors contributed equally.

1 ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 40

Keywords: Codelivery of simvastatin and siRNA, Osteogenesis, BMP-2, Noggin, pH-sensitive nanocarrier Abstract: The inexpensive hypolipidemic drug simvastatin (SIM), which promotes bone regeneration by enhancing bone morphogenetic protein 2 (BMP-2) expression, has been regarded as an ideal alternative to BMP-2 therapy. However, SIM has low bioavailability and may induce the upregulation of the BMP-2-antagonistic noggin protein, which greatly limits the osteogenic effect. Here, a pH-sensitive copolymer, mPEG-bPEI-PAsp(DIP-BzA) (PBP), was synthesized and self-assembled into a cationic micelle. SIM and siRNA targeting the noggin gene (N-siRNA) were loaded into the PAsp(DIP-BzA) core and the cationic bPEI interlayer of the micelle via hydrophobic and electrostatic interactions, respectively. The SIM-loaded micelle effectively delivered SIM into preosteoblast MC3T3-E1 cells and rapidly released it inside the acidic lysosome, resulting in the elevated expression of BMP-2. Meanwhile, the codelivered N-siRNA effectively suppressed the expression of noggin.

Consequently,

SIM

and

N-siRNA

synergistically

increased

the

BMP-2/noggin ratio and resulted in an obviously higher osteogenetic effect than did simvastatin or N-siRNA alone, both in vitro and in vivo.

1. Introduction Bone substitutes are in tremendous demand owing to the ever-increasing bone defects resulting from trauma, infection, and resection of bone tumors.1 Currently, bone substitutes mainly comprise autograft bone, allograft bone, and metal implants in clinical practice. Autograft bone is considered the ‘gold standard’ in bone regeneration procedures due to its minimal immunological rejection, complete 2 ACS Paragon Plus Environment

Page 3 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


biocompatibility, and excellent osteogenesis-related properties (e.g., osteoconductive, osteogenic, and osteoinductive effects). However, the limited supply and donor site morbidity of autogenous bone are formidable obstacles to its widespread clinical use.1 Allograft bone has several intrinsic shortcomings including immunological rejection and pathogen transfer.2 In addition, the clinical utility of metal bone implants is restricted by their poor osseointegration.3 Hence, inorganic materials (e.g., hydroxyapatite, calcium phosphate, and bioactive glass), polymeric matrixes (e.g., poly(lactic-co-glycolic acid) (PLGA) and poly(ε-caprolactone) (PCL)) and hybrid materials (e.g., silicon/PLGA and CaP/PCL) have been exploited as bone substitute materials.4,

5

Moreover, these materials have also been processed into bioactive

scaffolds loaded with cells and/or cell factors (e.g., bone morphogenetic proteins, vascular endothelial growth factors, fibroblast growth factors, and transforming growth factors) to promote bone regeneration.6,

7

Recently, the combination of

osteoblast/stem cells and osteoinductive factors in scaffolds has attracted considerable attention due to the remarkable enhancement effect on osteoblastic differentiation and osteogenesis.8 Among these factors, bone morphogenetic protein 2 (BMP-2), approved by the FDA for clinical applications (e.g, spinal fusion), has been attracting increasing attention for its effect on the promotion of bone healing.9, 10 Unfortunately, the osteoinductive signaling of BMP-2 is negatively modulated by antagonists (e.g., noggin11, gremlin12, chordin13, and twisted gastrulation14). In particular, the BMP-inductive noggin protein counteracts bone regeneration by preventing the interaction of BMPs with their receptors.11 Thus, suppressing antagonist expression is a strategy for enhancing the osteogenic effect of BMP-2. For example, small interfering RNAs (siRNAs) targeting noggin or chordin have been combined with BMP-2 to promote osteogenesis.15 3 ACS Paragon Plus Environment


However, it remains a concern that high-dose BMP-2 used for bone healing usually leads to complications such as ectopic ossification, seroma and edema.16 Therefore, a challenge of this field is effectively enhancing bone osteogenesis using readily available drugs and feasible approaches to overcome the adverse influence of inhibitory factors (e.g., noggin). Recent studies have reported that regulating BMP signaling through small molecule agonists (e.g., phenamil and statins) is a potent approach to induce osteoblastic differentiation and mineralization.11, 17, 18 Simvastatin (SIM), a kind of statin, has been extensively used to treat hypercholesterolemia in the clinic for years and is considered a promising alternative agent to BMP-2 for enhancing osteogenesis owing to its substantive promotion of BMP-2 expression.18, 19 For example, the incorporation of SIM into tissue scaffolds enhanced the osteoblastic differentiation of bone marrow mesenchymal stem cells and MC3T3-E1 cells.20, 21 Nevertheless, the hydrophobicity and rapid hepatic metabolism of SIM makes it difficult to achieve an effective concentration for enhancing bone regeneration at defect sites.22 In light of the development of nanomedicine, many hydrophobic drugs have been encapsulated into polymeric micelles composed of amphiphilic block copolymers such as PEG-PLGA (polyethylene glycol-b-poly(lactic-co-glycolic acid)), through which the bioavailability of SIM has been improved and the adverse effects have been reduced.23,

24

Compared with free SIM, SIM encapsulated into nanoparticles or

microscale fibers of poly(lactic acid) (PLA) or PLGA exhibited a higher osteogenic effect.20 However, the drug release from the hydrophobic polymeric matrix was too slow at defect sites due to the strong hydrophobic interaction between the polymer and drug.25, 26 As a result, the slow drug release led to limited drug concentration that undermined the therapeutic outcome. Therefore, stimulation-sensitive polymers were 4 ACS Paragon Plus Environment

Page 4 of 40

Page 5 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


designed to achieve rapid drug release in response to the low-pH intracellular microenvironment (pH 5.0 in lysosome) and high concentrations of reducing agents (1 mM

GSH

in

cytoplasm).27

For

instance,

the

copolymer

poly(ethylene

glycol)-poly(L-aspartic acid) grafted with a pH-sensitive moiety 2-(diisopropylamino) ethylamine (DIP) showed rapid drug release in the lysosome and cytoplasm.28 Moreover, a cationic polymeric micelle complexed with siRNA showing rapid drug release properties was constructed to effectively silence the targeted gene.29 The combined delivery of siRNA targeting noggin (N-siRNA) with the small-molecule agonist phenamil mediated by sterosomes was reported to promote osteoblast differentiation, but its slow drug release profile limited the osteoinductive effect.30 Cationic polymeric micelles with a pH-sensitive drug release mechanism provide a powerful platform to codeliver SIM and N-siRNA. So far, the codelivery of SIM and N-siRNA in a pH-sensitive nanocarrier to synergistically enhance osteoinductive effects has not been reported. Herein, a pH-sensitive cationic copolymer mPEG-bPEI-PAsp(DIP-BzA) was synthesized and assembled into a micelle encapsulating SIM and complexed with N-siRNA (SIM-PBP@N-siRNA) (Figure 1). It was expected that, when the micelle entered MC3T3-E1 cells, the acidic microenvironment of the lysosome would disassemble the micelle, triggering rapid release of SIM. Moreover, the codelivered N-siRNA was expected to suppress noggin expression, which would further promote osteogenesis. Biological experiments were carried out both in vitro and in vivo to explore the potential applications of combined therapy using SIM and N-siRNA mediated by the environmentally sensitive micelle.

2. Experimental Section 5 ACS Paragon Plus Environment


Page 6 of 40

2.1. Materials. Simvastatin (SIM), Nile red, α-methoxy-ε-hydroxy-poly(ethylene glycol) (mPEG-OH, Mn: 2 kDa), N,N'-carbonyldiimidazole (CDI), branched polyethylenimine (bPEI, Mn: 1.8 kDa), n-butylamine (nBu-NH2), succinic anhydride (SA),

N,N-diisopropylamino

ethylamine

(DIP),

benzylamine

(BzA),

dicyclohexylcarbodiimide (DCC), and N-hydroxysuccinimide (NHS) were purchased from Sigma Aldrich (St. Louis, USA). Tetrahydrofuran (THF) was dried with an alloy of potassium and sodium. Chloroform (CHCl3) and dichloromethane (DCM, CH2Cl2) were dried with CaH2 and distilled under a N2 atmosphere. N-Carboxyanhydride of β-benzyl-L-aspartate (BLAsp-NCA) was synthesized according to our recent report.31 Mouse preosteoblast MC3T3-E1 subclone 14 cells were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Alpha-minimum essential medium (α-MEM) and fetal bovine serum (FBS) were purchased from Gibco (Life Technologies, USA). The small interfering RNA (siRNA) targeting the noggin gene were double-stranded RNA oligos purchased from GenePharma (Shanghai, China). The siRNA against the noggin gene, N-siRNA, was as follows: 5′AACACUUACACUCGGAAAUGAUGGG

dTdT-3′

5'-CCCAUCAUUUCCGAGUGUAAGUGUUdTdT-3'

(antisense),

(sense).

The

scrambled

siRNA, SCR-siRNA, was as follows: 5’-ACUUCAGUAGGACACUUACCCdTdT-3’ (antisense), 5′-GGGUAAGUGUCCUACUGAAGUdTdT-3′(sense). 2.2. Preparation of Simvastatin-Loaded Cationic Micelles. The detailed synthesis

of

monomethoxy-poly(ethylene

glycol)-b-branched

polyethyleneimine-b-poly(N-(N’,N’-diisopropylaminoethyl)-co-benzylamino)asparta mide), abbreviated mPEG-bPEI-PAsp(DIP-BzA) or PBP, is described in the Supporting Information. The preparation of simvastatin-loaded PBP (SIM-PBP) and blank PBP cationic micelles (B-PBP) is shown in Figure 1. In brief, PBP polymer (25 6 ACS Paragon Plus Environment

Page 7 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


mg) with or without SIM (3.5 mg) was dissolved in 5 mL of CHCl3 and then emulsified in 25 mL of deionized water under sonication (60 Sonic Dismembrator, Fisher Scientific). The solution was rotary-evaporated to 4 mL and then filtered through a 450-nm syringe filter to remove the nonencapsulated SIM. Finally, the micelles in solution were stored at 4 °C for further study. Nile red-loaded micelles, named Nile red-PBP, were prepared following the same procedure described above. 2.3. Preparation of the Simvastatin and siRNA Coloaded Nanocarrier. The cationic SIM-PBP micelle solution was diluted with 10 mM PBS (pH 7.4) to different concentrations. A predetermined amount of N-siRNA (5 µg, 0.3 nmol) in 10 mM PBS (pH 7.4) was mixed with a certain volume of solution containing SIM-PBP micelles using gentle pipetting for 5 min and then kept still at 25 °C for 0.5 h. Consequently, a series of N-siRNA-loaded nanomicelles, SIM-PBP@N-siRNA, were obtained at different N/P ratios. The N/P ratio expresses the moles of nitrogen (N) in the bPEI block relative to the moles of phosphate groups (P) in the N-siRNA. For example, at N/P 10, the masses of the polymer and siRNA were 54 µg and 5 µg, respectively. B-PBP@N-siRNA micelles without SIM were prepared following the same procedure described above. 2.4. Characterization. 1H NMR spectra were obtained at 25 °C with a nuclear magnetic resonance (NMR) spectrometer (Varian Unity 300 MHz, USA) to evaluate the polymer composition. The molecular weight and molecular weight distribution of the polymers were recorded on a gel permeation chromatography (GPC, Waters Breeze, USA) system, and calculated using a PEG standard. The mobile phase was DMF containing 1 g/L LiBr at a flow rate of 1.0 mL/min at 40 °C. FTIR spectra were generated on a Fourier transform infrared spectrometer (Thermo Electron Nicolet/Nexus 670, USA) using KBr pellets. The particle size and zeta potential were 7 ACS Paragon Plus Environment


Page 8 of 40

measured by dynamic light scattering (DLS, NanoBrook 90Plus, Brookhaven Instruments) at 25 °C. The morphologies of the micelles were observed by transmission electron microscopy (TEM, Hitachi H-7650, Japan) at 100 kV. An aqueous solution (3 µL) containing micelles was dried on a copper grid and then stained with uranyl acetate (0.5%, w/t). HPLC analysis was conducted on a Shimadzu high-performance liquid chromatography system (Shimadzu LC-20A, Japan) using a C-18 column (Welch Materials Ultimate® AQ, China). A mixture of acetonitrile and 0.025 mol/L NaH2PO4 aqueous (60/40, v/v) was used as the mobile phase (pH 4.5) at a flow rate of 1.0 mL/min, and the simvastatin was detected at a wavelength of 238 nm. 2.5. Simvastatin Loading Content and Release in Vitro. First, 1 mL aqueous solution of the prepared cationic micelle SIM-PBP was lyophilized. Then, 3 mg of white lyophilized powder was dissolved in 15 mL of a solution composed of acetonitrile and 0.025 mol/L NaH2PO4 aqueous (50/50, v/v). Next, 20 µL of the solution was analyzed by HPLC, and the SIM concentration was obtained from a pre-established standard curve. The retention time of SIM loaded in micelles was the same as that of the standard, 18.9 min, suggesting that the structure of SIM was a lactone ring. The drug-loading content (DLC) and drug-loading efficiency (DLE) were determined using following formulas: DLC=(mass of SIM / mass of micelle) × 100%, DLE=(mass of SIM in micelle / mass of SIM in feed) × 100%. Simvastatin (SIM) release studies were performed in triplicate at different conditions mimicking the normal physiological environment (pH 7.4) and lysosome microenvironment (pH 5.0). In brief, 2.0 mg of micelles in 2.0 mL of PBS was enclosed into a dialysis bag (MWCO: 7 kDa) and dialyzed against 8.0 mL of 10 mM PBS at 37 °C in a shaker. At certain time intervals, 4 mL of PBS outside the dialysis 8 ACS Paragon Plus Environment

Page 9 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


bag was taken out and replaced with 4 mL of fresh PBS to keep a constant volume. The SIM content was determined by HPLC analysis, and the cumulative drug release as a percentage was plotted against time. 2.6. Gel Retardation Assay. The siRNA complexation with PBP micelles was evaluated by agarose gel electrophoresis. PBP micelles were first suspended in PBS (pH 7.4). Then, siRNA was added at the precalculated N/P ratio, and the mixture was kept still for 30 min. The siRNA-complexed PBP micelles (SIM-PBP@N-siRNA and B-PBP@N-siRNA) were loaded into a 1% (w/v) agarose gel containing GoldenView. Then, a gel retardation assay was performed on a gel electrophoresis system (Bio-Rad Laboratories, USA). The mobility of siRNA was visualized under UV light and imaged on a bioimaging system (DNR Bio-Imaging, Israel). 2.7. Cell Culture. Mouse preosteoblast MC3T3-E1 cells were cultured in α-MEM containing 10% FBS and 1% antibiotic-antimycotic in a culture flask (Corning, CA) with 5% CO2 at 37 °C. All reagents and consumables for cell culture were purchased from Gibco (Life Technologies, USA). 2.8. Cell Viability. The cell viability in response to the various micelles was assessed on MC3T3-E1 cells in triplicate using a Cell Counter Kit-8 (KeyGEN, China). Cells were seeded onto a 96-well plate at a density of 5×103 cells/well and cultured for 24 h. Then, free SIM or various micelles (B-PBP@SCR-siRNA and SIM-PBP@SCR-siRNA micelle) were added at different concentrations. After incubation for 48 h in a cell incubator, CCK-8 reagent was added at 10 µL/well. After further incubation for 2 h, the absorption at 450 nm was recorded on a multimode plate reader (Männedorf Infinite F200, Switzerland). 2.9. Flow Cytometry Assay. MC3T3-E1 cells were seeded at a density of 3×105 cells/well in 6-well plate and cultured for 24 h. The old medium was replaced with 9 ACS Paragon Plus Environment


Page 10 of 40

new medium containing Nile red-PBP@SCR-FITC prepared at N/P 10 (200 ng/mL Nile red, 100 nM SCR-FITC). After incubation for 12 h, the cells were washed with PBS (3×1 mL), harvested through trypsinization, centrifuged at 1,500 rpm for 5 min, and resuspended in 500 µL of PBS. The codelivery efficiency of Nile red and SCR-FITC were determined on a Gallios flow cytometer (Beckman Coulter, USA). SCR-FITC and Nile red were excited at 488 nm and 560 nm, respectively, and the emitted fluorescence was collected at 525 and 630 nm, respectively. 2.10. Preparation of Fibrin Hydrogel Loaded with MC3T3-E1 Cells. To prepare the fibrin hydrogel implants, MC3T3-E1 cells were first incubated with different

micelles

(i.e.,

SIM-PBP@N-siRNA,

SIM-PBP@SCR-siRNA,

B-PBP@N-siRNA and B-PBP@SCR-siRNA) for 48 h, harvested by trypsinization, centrifuged and resuspended in a 20 mg/mL human fibrinogen solution (RAAS, China) at 37 °C under aseptic conditions. A thrombin working solution containing 40 mM CaCl2 and 40 U/mL human plasma thrombin (RAAS, China) was prepared according to the protocol of the manufacturer. The fibrin solution was mixed with the thrombin working solution at a ratio of 1:3 in a polypropylene tube for 5 min at 37 °C, resulting in a 5% (w/v) fibrin hydrogel containing 2×104 cells. The fibrin hydrogels containing B-PBP@SCR-siRNA micelles or SIM-PBP@N-siRNA micelles without MC3T3-E1 cells were prepared using the above method. 2.11. Confocal Laser Scanning Microscopy (CLSM). The cellular uptake and drug release behavior of SIM-PBP@N-siRNA in MC3T3-E1 cells were recorded using CLSM (Carl Zeiss LSM 710, Germany). Nile red, a hydrophobic dye, was used as a substitute for simvastatin to track the intracellular distribution and drug release profile of the micelles in vitro. To observe the lysosomal escape of the micelles, the cells were first incubated with Hoechst 33342 (Beyotime, China) for 20 min to label 10 ACS Paragon Plus Environment

Page 11 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


the nuclei, then with LysoTracker Green DND-26 (Invitrogen, USA) for 30 min to label the lysosomes and then with Nile red-PBP@N-siRNA (N/P 10). At different time points, the cells were imaged using CLSM at excitation wavelengths of 560 nm for Nile red, 488 nm for LysoTracker Green and 405 nm for Hoechst 33342 and emission wavelengths of 630 nm for Nile red, 530 nm for LysoTracker Green and 455 nm for Hoechst 33342. To observe the codelivery of hydrophobic drugs and siRNA, Nile red and FITC-labeled SCR-siRNA (SCR-FITC) were coloaded into cationic PBP micelles. Cells

were

first

stained

with

Hoechst

33342,

then

treated

with

Nile

red-PBP@SCR-FITC (200 ng/mL Nile red, 120 nM SCR-FITC) and imaged using CLSM at excitation wavelengths of 560 nm for Nile red, 488 nm for SCR-FITC and 405 nm for Hoechst 33342 and emission wavelengths of 630 nm for Nile red, 530 nm for SCR-FITC and 455 nm for Hoechst 33342. To evaluate cell survival in the fibrin hydrogel, MC3T3-E1 cells were incubated with Nile red-PBP@AF488-SCR for 12 h, washed three times with PBS, collected, and encapsulated in hydrogels. Then, the hydrogels were implanted to mouse calvarial defect sites. At 1 day postimplantation, the hydrogels were taken out, transferred to a 6-well plate, washed with PBS three times, and incubated with Hoechst 33342 for 30 min to stain the nuclei. The cells in the hydrogels were imaged using CLSM, in which 3D images were obtained through tomoscanning along the Z-axis at excitation wavelengths of 560 nm for Nile red, 488 nm for SCR-AF488 and 405 nm for Hoechst 33342 and emission wavelengths of 630 nm for Nile red, 530 nm for SCR-AF488 and 455 nm for Hoechst 33342. 2.12. Quantitative Real-Time PCR and Western Blotting Assay. The mRNA and protein levels of BMP-2 and noggin in MC3T3-E1 cells treated with the various 11 ACS Paragon Plus Environment


Page 12 of 40

micelles were evaluated using quantitative real-time polymerase chain reaction (qRT-PCR) and Western blotting assay. Details of these experiments are described in the Supporting Information. 2.13. Mouse Calvarial Critical Size Defect Model. The surgical protocols were conducted under approval of the Institutional Animal Care and Use Committee of Southern Medical University (SMU). Adult male mice were anesthetized using isoflurane and preoperatively administered buprenorphine. The hair on the surgical site was shaved off. After disinfection, a linear incision on the skull was made, and then the soft tissue was retracted. A full-thickness (3 mm in diameter) defect was performed on the parietal bone using a trephine drill (Changzhou, China) with care to avoid potential damage to the dura mater. The defect site was rinsed extensively with saline in order to remove bone fragments and implanted with the prepared fibrin hydrogel. The incisions were sutured, and all animals were subcutaneously administered buprenorphine at 0.1 mg/kg body weight once a day for three days. The animals drank water containing trimethoprim/sulfamethoxazole (TMP/SMX) for one week in order to prevent postoperative infection. 2.14. Three-Dimensional Microcomputed Tomography (µCT) Scanning. After allowing the defect to heal for 2, 4 and 8 weeks, the animals were sacrificed. The parietal bones were harvested, rinsed with PBS and fixed in 10% neutral buffered formalin for one day at 25 °C. Microcomputed tomography (µCT) analysis was performed at a resolution of 48 µm/pixel on a microcomputed tomography scanner (AlokaLathetaTM LCT-200, Hitachi-Aloka, Japan). DICOM images of each sample were reconstructed using Mimics Research 17.0 (Materialise, USA), and the percentage of newly formed bone surface area was analyzed and compared to the original defect. 12 ACS Paragon Plus Environment

Page 13 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2.15. Histological and Immunohistochemical Assays. The parietal bones were decalcified and paraffin-embedded. Then, 5-µm longitudinal sections of bone samples were subjected to hematoxylin and eosin (H&E) staining, Masson trichrome staining and immunohistochemical staining. The images were captured using bright-field microscopy (E800 microscope, Nikon, Japan). An alkaline phosphatase (ALP) activity assay and alizarin red staining were conducted to test the osteogenic ability of cells treated with SIM-PBP@SCR or SIM-PBP@N-siRNA. Details of these experiments are described in the Supporting Information. 2.16. Statistical Analysis. Data are shown as the means ± standard deviation (SD) and were analyzed using ANOVA with a post hoc Tukey’s test between each group. P < 0.05 was considered statistically significant.

3. Results and Discussion 3.1. Synthesis and Characterization of the pH-Sensitive Copolymer. Two prepolymers,

n-butylamine-terminated

poly(N-(N’,N’-diisopropylaminoethyl)

co-benzylamino) aspartamide (nBu-PAsp(DIP-BzA)) and monomethoxy polyethylene glycol-b-branched polyethyleneimine (mPEG-bPEI), were first synthesized. Then, the triblock copolymer mPEG-bPEI-PAsp(DIP-BzA) (PBP), which may self-assemble into cationic micelles for codelivery of siRNA and simvastatin (SIM), was synthesized by a conjugation reaction between the primary amino group of mPEG-bPEI1.8 k and NHS-activated nBu-PAsp(DIP-BzA) (Supporting Information S1). Successful synthesis of the PBP polymer via multistep reactions was confirmed by 1H NMR, FTIR and GPC analyses (Supporting Information S2-S5 and Table S1). 13 ACS Paragon Plus Environment


Page 14 of 40

In the 1H NMR spectrum of nBu-PAsp(DIP-BzA) (Supporting Information S2C), the peak at 5.05 ppm (g, -COOCH2Ph) ascribed to the benzyl alcohol of PBLA completely disappeared, whereas new peaks at 4.25 ppm (g’, -CONHCH2Ph) for BzA and 0.95 ppm (n, -CONHCH2CH2C(CH3)2) for DIP appeared, which confirmed the aminolysis reaction between PBLA and BzA/DIP.32 The grafting densities of BzA and DIP were calculated by comparing the integrals of the characteristic peaks for the benzyl group (h’, 7.25 ppm, BzA) and isopropyl group (n, 0.9 ppm, DIP) in the 1H NMR spectrum. In the FTIR spectrum of nBu-PAsp(DIP-BzA)-COOH (Supporting Information S3), the characteristic peak at 1740 cm-1 (νC=O, ester) for the benzyl ester of nBu-PBLA-COOH nearly disappeared, indicating the successful deprotection of BLA by aminolysis with BzA/DIP. Furthermore, after the conjugation reaction between nBu-PAsp(DIP-BzA)-COOH and mPEG-bPEI1.8 k, the characteristic peaks for νC-O (1108 cm-1) of PEG, νC-N (1160 cm-1) of PEI and νC=O (1650 cm-1, amide) of aspartamide

were

clearly

shown

in

the

FTIR

spectrum

of

mPEG-bPEI-PAsp(DIP-BzA), which was consistent with the results of the 1H NMR spectrum (Supporting Information S4B) showing chemical shifts at 3.60 ppm (b’, -OCH2CH2O-) for PEG and 2.4~2.8 ppm (d’, -NCH2CH2N-) for PEI. Finally, both nBu-PBLA and nBu-PAsp(DIP-BzA)-COOH showed a unimodal eluogram in the GPC measurement (Supporting Information S5 and Table S1), suggesting successful aminolysis of PBLA without cleavage of the main chain. 3.2. Preparation and Characterization of Micelles. The preparation of pH-sensitive micelles (SIM-PBP@siRNA) encapsulating simvastatin (SIM) and 14 ACS Paragon Plus Environment

Page 15 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


siRNA is outlined in Figure 1. The copolymer mPEG-bPEI-PAsp(DIP-BzA) was assembled into cationic micelles via hydrophobic interaction between the PAsp(DIP-BzA) block and SIM, and then the positively charged PEI interlayer was complexed with the negatively charged siRNA oligos. Owing to the micellization driven by the hydrophobic PAsp(DIP-BzA) block and hydrophilic mPGE-bPEI block, the assembly of low molecular weight PEI (Mn: 1.8 kDa) in the micellar interlay was expected to show comparable capability for siRNA delivery and lower cytotoxicity compared to high molecular weight PEI.33 In addition, the BzA group was introduced to increase micelle stability in physiological conditions (e.g., pH 7.4 in cell culture medium and tissue matrix). In other words, although protonation of DIP inside the acidic lysosome facilitates drug release, the micellar core composed of PAsp(DIP) was apt to disassemble in neutral physiological conditions because only 56% of the DIP groups were deprotonated (hydrophobic state) at pH 7.4.27 To achieve a balance between micelle stability in physiological conditions (pH 7.4) and micelle disassembly in the lysosomes (pH 4-5) of MC3T3-E1 cells, a benzyl group (BzA), as a hydrophobic moiety, was introduced into the hydrophobic PAsp(DIP-BzA) block. The effect of BzA grafting density on the drug loading content and pH-sensitive drug release is shown in the Supporting Information Table S2. As the BzA grafting density increased to 25% from 12.5%, the drug loading content of the micelles increased to 9.5% from 3.2%. When the BzA grafting density further increased to 50%, there was no obvious difference in the drug loading content (9.5% vs 10.8%), whereas the cumulative release of SIM from the micelles dropped to 42.4% from 59% at pH 5.0. Therefore, a 25% of BzA grafting density was used to prepare the polymer mPEG-bPEI-PAsp(DIP30-BzA10). That is, the



Page 16 of 40

degrees of polymerization for PAsp(DIP) and PAsp(BzA) were set as 30 and 10, respectively. Micelles with a uniform size were produced using an ultrasonication method after removing the organic solvent from the monodispersed oil-in-water (O/W) emulsion droplets.34 In addition, the mass ratio of the hydrophilic segment mPEG-bPEI to the hydrophobic segment PAsp(DIP-BzA) was also optimized by adjusting

the

BzA

grafting

density

in

the

triblock

copolymer

mPEG-bPEI-PAsp(DIP-BzA) to control the size and uniformity of the micelles (Supporting Information Table S2).35 As shown in Figure 2A, the siRNA-free SIM-PBP micelles had an average hydrodynamic diameter of 55.00 ± 4.91 nm and a zeta potential of 19.20 ± 1.32 mV, as detected by DLS measurements. Complexation with siRNA decreased the size and zeta potential of the micelles, but the micelle size stayed constant (ca. 35.01 ± 3.82 nm) above an N/P ratio of 10. The complexation of cationic micelles with siRNA at various N/P ratios was also evaluated via agarose gel electrophoresis assays (Figure 2B), in which the siRNA migration was retarded due to a neutralization of its negative charge by the micelle positive charge. At low N/P ratios (< 6), incomplete complexation of siRNA led to various complexation states, causing different migration distances, which was reflected by the tailing bands of siRNA in the agarose gel under electrophoresis. In contrast, the siRNA band was not observable above N/P 6 due to complete complexation of the siRNA with the cationic micelles.29 The electrophoresis pattern of SIM-loaded PBP micelles (SIM-PBP micelle) was similar to that of blank PBP micelles (B-PBP micelle), suggesting that the encapsulation of SIM had no obvious effect on the siRNA complexation. Although a high zeta potential is favorable for cellular uptake of nanoparticles, it may lead to cationic cytotoxicity. Therefore, consideration of multiple factors including 16 ACS Paragon Plus Environment

Page 17 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


size, zeta potential, and cytotoxicity was required to achieve optimized drug delivery. As shown in Supporting Information S6, although the cell viability in response to B-PBP@SCR micelles decreased to 93.5% at a high concentration of 350 µg/mL PBP which might be engendered by cationic PEI in the triblock copolymer,33 the cell viability was above 96.5% at a relatively high concentration of 270 µg/mL PBP at N/P 10. The data (Figure 2 and Supporting Information S6) showed that the siRNA-loaded micelle at N/P 10 had desirable features including a relatively small size, weakly positive charge and low cytotoxicity. Hence, SIM-PBP@N-siRNA at N/P 10 was chosen for further studies. At pH 7.4, both SIM-PBP and SIM-PBP@N-siRNA (N/P 10) exhibited a spherical morphology and uniform size in TEM observations (Figure 3 A, B). In contrast, the SIM-PBP@siRNA micelles disassembled and random polymeric aggregates were formed at pH 5.0 (Figure 3C), which was due to the hydrophobic-to-hydrophilic transition of PAsp(DIP).28 Disassembly of the micelles was supposed to trigger rapid SIM release. The SIM release from PBP micelles in vitro was evaluated at pH 7.4 (i.e., mimicking the neutral physiological conditions in cell culture medium and tissue matrix) and pH 5.0 (i.e., mimicking the microenvironment of the lysosome). As shown in Figure 3D, SIM was slowly released at pH 7.4 over the whole experimental time up to 36 h, and complexation with siRNA further retarded the SIM release rate. For example, only 8.1% and 26.2% of SIM was released from SIM-PBP@siRNA and SIM-PBP at 36 h, respectively. In contrast, disassembly of the pH-sensitive micelle PBP at pH 5.0 triggered a prominent burst release, followed by a sustained slow release. At 36 h, the cumulative released amount of SIM reached 81.6% and 86.5% for SIM-PBP@siRNA and SIM-PBP, respectively. 17 ACS Paragon Plus Environment


Page 18 of 40

3.3. Cell Uptake. Nile red (red fluorescence, a model drug), a hydrophobic dye, and scrambled siRNA (SCR-siRNA) labeled with FITC dye (green fluorescence) were used to evaluate cell uptake using CLSM and a flow cytometry assay. As shown in Figure 4A, yellow stains (the overlap of red and green fluorescence) were obviously displayed in the MC3T3 E1 cells incubated with Nile red-PBP@SCR-FITC for 1 h. The percentage of cells with both Nile red and SCR-FITC fluorescence was much higher than that with Nile red or SCR-FITC fluorescence alone (86.5% vs 2.8% and 10.1%, Supporting Information S7). Furthermore, the lysosomal escape of the drug was evaluated by labeling the lysosomes with fluorescent Lysotracker. As shown in Figure 4B, the Nile red and lysosomal fluorescence were separated at an incubation time of 90 min. This rapid lysosomal escape of Nile red was likely due to the proton sponge effect of PEI and disassembly of the micellar core induced by the low pH in lysosomes,28, 33 which was in line with the release profile of SIM in vitro. These results demonstrated that the hydrophobic drug and siRNA were not only codelivered into the same cells but also efficiently released into the cytoplasm, which was important since SIM and siRNA inside the same cells may synergistically enhance osteogenesis by simultaneously regulating BMP-2 and noggin proteins. Several studies have revealed that SIM enhancement of BMP-2 expression may occur via the Ras/Smad/Erk/BMP-2 and Ras/PI3K/Akt/BMP-2 intracellular signaling pathways.36 Moreover, the activation of Ras was linked to the inhibition of HMG-CoA reductase anchored to the membrane of the endoplasmic reticulum.19, 37 Therefore, the intracellular release of SIM from PBP micelles could promote osteogenesis, although the receptor for BMP-2 is located on the cell surface. 3.4. Synergistic Effect of Simvastatin and N-siRNA on BMP-2 Expression. The free SIM had no obvious effect on cell viability due to its poor solubility (Supporting 18 ACS Paragon Plus Environment

Page 19 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Information S8A). However, the cell viability in response to SIM delivered with PBP micelles slightly increased below 5 µM but significantly decreased above 5 µM (Supporting Information S8B). PBP micelles could effectively deliver SIM into the cells, resulting in a high intracellular SIM concentration. SIM is known to stimulate osteoblastic differentiation via the BMPs signaling pathway18,

36

and promote

proliferation by inducing bone growth factors such as transforming growth factor-β and fibroblast growth factor.38 However, it has been reported that high SIM concentrations caused obvious cytotoxicity.36 Therefore, an appropriate concentration of SIM-PBP micelles (e.g., 1 µM SIM) should be adopted for both biosafety and enhanced bone regeneration. An siRNA targeting noggin (N-siRNA) was designed to silence noggin gene expression, and a scrambled siRNA (SCR-siRNA) was employed as a negative control. First, the BMP-2 and noggin mRNA expression levels of MC3T3-E1 cells were assessed by quantitative real-time PCR (qRT-PCR) when cells were incubated with SIM-free micelles or SIM-loaded micelles. The relative BMP-2 and noggin mRNA levels of cells incubated with B-PBP (blank micelle) showed no obvious difference compared with those of normal cells, indicating that the BMP-2 and noggin gene expression of cells were not influenced by PBP micelle (Supporting Information S9A). In contrast, the relative BMP-2 mRNA level of cells incubated with SIM-PBP@SCR-siRNA increased along with increasing SIM concentrations and reached a maximum at 1 µM SIM (Supporting Information S9B). An enhanced effect of SIM on the BMP-2 mRNA level was also reported in other work.19 The noggin mRNA level increased with increasing SIM concentrations and reached approximately 450% at 10 µM SIM compared with that at 0 µM SIM (Supporting Information S9B). 19 ACS Paragon Plus Environment


Page 20 of 40

Apparently, the enhanced osteogenesis of SIM would be suppressed due to elevated noggin expression. Thus, the ratio of the BMP-2 expression level to the noggin expression level (BMP-2/noggin ratio) can reflect the osteogenic activity more accurately than the BMP-2 expression level can. The BMP-2 mRNA level and BMP-2/noggin ratio of cells receiving SIM-PBP@SCR-siRNA at 1 µM SIM were 4.5 and 2.3 times of that at 0 µM SIM, respectively (Figure 5A and Supporting Information S9B). The increase in the noggin mRNA level eventually led to a decrease in the BMP-2/noggin ratio. Therefore, it is worthwhile to silence noggin gene expression for SIM-enhanced osteogenesis. The cells receiving a combined treatment of N-siRNA and SIM showed much lower noggin mRNA levels but higher BMP-2 mRNA levels, leading to higher BMP-2/noggin ratios (Figure 5B and Supporting Information S9C). The BMP-2/noggin ratio increased along with the increase in the N-siRNA concentration and achieved the maximum at a dose of 120 nM N-siRNA. In addition, there was no significance of the BMP-2/noggin ratio between the cells receiving different concentrations of SCR-siRNA (Figure 5B and Supporting Information S9D), implying that the reduction in noggin mRNA levels was attributed to the use of N-siRNA. Moreover, the synergistic regulation of SIM and N-siRNA was investigated at various concentrations of SIM. In comparison with cells treated with SIM-PBP@SCR-siRNA (1 µM SIM, 120 nM SCR-siRNA), the cells receiving a combined treatment of SIM (1 µM) and N-siRNA (120 nM) showed a 76% decrease in the noggin mRNA level and a 3.8-fold increase in the BMP-2/noggin ratio. Nevertheless, the BMP-2/noggin ratio of cells treated with 10 µM SIM dropped to half of that of cells treated with 1 µM SIM (Figure 5C and Supporting Information S9E, F). These results suggested that the codelivered SIM


Page 21 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and N-siRNA synergistically enhanced osteogenesis via raising the BMP-2/noggin ratio at appropriate SIM concentrations. The results of Western blotting, the determination of the alkaline phosphatase (ALP) activity, and alizarin red S (AR-S) staining were consistent with those of the qRT-PCR, demonstrating once again that SIM-inductive osteogenesis was dose-dependent and improvable via N-siRNA codelivery. As shown in Figure 5D, cells receiving SIM-PBP@N-siRNA at 1 µM SIM and 120 nM N-siRNA showed the lowest expression levels of antiosteogenic noggin protein and the highest expression levels of the pro-osteogenic BMP-2 protein. Noteworthily, increasing the SIM concentration to 10 µM adversely resulted in a decrease in the BMP-2 protein level and an increase in the noggin protein level. The activity of alkaline phosphatase (ALP) and deposition of calcium phosphate salts (CPS), which represent osteoblastic functional activity and mineralization, respectively,39 provided direct evidence of the osteogenic effect of SIM and N-siRNA. The ALP and CPS stains were weak in MC3T3-E1 cells treated with B-PBP@SCR-siRNA, whereas they were greatly intensified in cells treated with SIM-PBP@N-siRNA (Supporting Information S10A). At 120 nM N-siRNA, the activity of ALP and the content of CPS in cells incubated with 1 µM SIM were 1.5 times and 1.8 times, respectively, that of cells incubated with 10 µM SIM (Supporting Information S10B, C). Therefore, cells pretransfected with SIM-PBP@N-siRNA micelles at 1 µM SIM and 120 nM N-siRNA were applied for studies in vivo. 3.5. Synergetic Effect on Osteogenesis in Vivo. A mouse calvarial defect model with a 3-mm critical size in diameter was employed to assess bone repair in vivo. MC3T3-E1 cells posttransfected with various micelles were loaded into fibrin hydrogels to repair the defects. Fibrin hydrogels have been extensively applied in the 21 ACS Paragon Plus Environment


Page 22 of 40

clinic for years due to their commercial availability, biocompatibility, and natural implantability. In particular, they has been used as a functional matrix for osteoblast cell infiltration, attachment and proliferation due to their high cell seeding efficiency and uniform cell distribution.40, 41 In addition, the outer layer of PEG of the micelle may have prevented interaction between siRNA-loaded PBP micelles and the fibrin hydrogel, as it has been reported that the cellular uptake of cationic liposomes complexed with siRNA was not affected by fibrin hydrogel.42 As shown in the 3D images, the MC3T3-E1 cells survived well in the fibrin hydrogel at 1 day postimplantation to the calvarial defect site, and almost all cells were Nile red- and SCR-FITC-fluorescence positive (Figure 6). To study the osteogenesis effect of a combined treatment of SIM and N-siRNA, animals with calvarial defects were randomly divided into 6 groups: blank-micelle (hydrogel loaded with B-PBP@SCR-siRNA without cells), SIM/N-siRNA-micelle (hydrogel loaded with SIM-PBP@N-siRNA without cells), blank-cell (hydrogel loaded with B-PBP@SCR-siRNA transfected cells), SIM-cell (hydrogel loaded with SIM-PBP@SCR-siRNA transfected cells), N-siRNA-cell (hydrogel loaded with B-PBP@N-siRNA transfected cells), and SIM/N-siRNA-cell (hydrogel loaded with SIM-PBP@N-siRNA transfected cells). The potential synergistic osteogenesis of SIM and N-siRNA was evaluated in vivo at 2, 4 and 8 weeks postimplantation. The new bone area was calculated by referring to the original defect size (3 mm in diameter) based on µCT images. The animals of the blank-micelle group and the SIM/N-siRNA-micelle group showed no obvious bone healing effects (Supporting Information S11), indicating that blank micelles and drug-loaded micelles insufficiently promoted osteogenesis. The blank-cell treatment was also inefficient at promoting bone repair (Figure 7A). In contrast, the animals of the SIM/N-siRNA-cell 22 ACS Paragon Plus Environment

Page 23 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


group achieved the most remarkable bone regeneration at all examined time points and showed a new bone percentage of 59% at 8 weeks postimplantation. The animals of the N-siRNA-cell group and the SIM-cell group showed moderate new bone percentages of 41% and 42%, respectively, at 8 weeks postimplantation. In addition, prior formation of new bone from the edge of the calvarial defect was observed in this study and other cases,43, 44 primarily due to the better microenvironment (thriving angiogenesis and more periosteum) along the edge. H&E and Masson trichrome staining were performed to further verify the formation of new bone and osteoid matrix. As shown in Figure 8 and Supporting Information S11, the animals receiving treatment with blank-micelle or blank-cell only exhibited fibrous-like tissue with minimal bone formation. In contrast, the animals receiving treatment with SIM/N-siRNA-cell showed the best formation of new bone and osteoid matrix. The relative gaps of defects were quantified by measuring the distance between the front edges of new bone. Compared to animals receiving treatment with blank-cell, the animals receiving treatment with SIM/N-siRNA-cell showed a 28% decrease in the relative gap of defect at 8 weeks postimplantation. However, the animals receiving treatments of SIM-cell and N-siRNA-cell showed an 18% decrease and a 17% decrease in the relative gap of defect, respectively (Figure 8 and Supporting Information S12). Although the 3-mm calvarial defect in the mice was not fully bridged at 8 weeks postimplantation, our synergistically osteo-inductive strategy via codelivery of SIM and N-siRNA in one nanocarrier is a potential alternative to BMP-2 therapy because multiple supra-physiological doses of BMP-2 usually lead to side effects such as ectopic bone growth and edema.



Page 24 of 40

The expression levels of noggin protein and BMP-2 protein at 2, 4 and 8 weeks postimplantation were evaluated by immunohistochemical staining. As shown in Figure 9A, the sections from animals receiving treatment with SIM-cell or N-siRNA-cell showed more BMP-2 protein (brown stains) than did those receiving treatment with blank-cell. Among all treatments, the highest amount of BMP-2 protein was observed in sections from animals receiving treatment with SIM/N-siRNA-cell. Moreover, the sections from animals receiving treatment with N-siRNA-cell or SIM/N-siRNA-cell displayed less noggin protein (brown stains) than did those receiving treatment of SIM-cell (Figure 9B). At 4 weeks and 8 weeks postimplantation, the noggin protein level of the blank-cell group was similar to that of the SIM/N-siRNA-cell and N-siRNA-cell groups. In addition, treatment with blank-micelle and SIM/N-siRNA-micelle insufficiently influenced the contents of BMP-2 and noggin protein (Supporting Information S13). The results of immunohistochemical staining showed that SIM and N-siRNA codelivered by SIM-PBP@N-siRNA could synergistically enhance osteogenesis by simultaneously upregulating BMP-2 expression and downregulating noggin expression in MC3T3-E1 cells.

4. Conclusion A triblock copolymer mPEG-bPEI-PAsp(DIP-BzA) was synthesized and assembled into micelles with a pH-sensitive PAsp(DIP-BzA) core encapsulating the hydrophobic drug simvastatin and a cationic bPEI interlayer encapsulating siRNA. Codelivery of simvastatin and siRNA into preosteoblast MC3T3-E1 cells and intracellular rapid simvastatin release in response to the acidic lysosome microenvironment were achieved. The nanomicelles carrying simvastatin and siRNA targeting the noggin 24 ACS Paragon Plus Environment

Page 25 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


gene (N-siRNA) could effectively upregulate BMP-2 expression upon simvastatin treatment and remarkably suppress noggin expression via N-siRNA treatment in the MC3T3-E1 cells, which resulted in significantly elevated ALP activity and mineralization. Both in vitro and in vivo experiments demonstrated that the codelivery of simvastatin and N-siRNA mediated by pH-sensitive micelles was much more effective at promoting osteogenesis compared with simvastatin or N-siRNA treatment alone. This combined therapy offers a potential alternative to BMP-2 delivery for bone regeneration.

Associated content

Supporting Information

The Supporting Information is available free of charge on the ACS Publications website.

Detailed methods of polymer synthesis and series of biological experiments in vitro and in vivo. 1H NMR spectra, FTIR spectra and GPC curves of polymers. The results of cell viability, flow cytometry, relative BMP-2 and noggin mRNA expression levels, the qualitative and quantitative analysis of alkaline phosphatase (ALP) activity and the content of calcium phosphate salts (CPS).

Author information Corresponding Author * Dr. Bin Chen, E-mail: [email protected].

Tel.: +86-20-62787200 25

ACS Paragon Plus Environment


Page 26 of 40

* Prof. Du Cheng, E-mail:[email protected]. Tel.: +86-20-84112172

* Prof. Xintao Shuai, Email: [email protected]. Tel.: +86-20-84110365

Notes The authors declare no competing financial interests.

Acknowledgment This work was supported by National Basic Research Program of China (2015CB755500), the National Natural Science Foundation of China (U1401242, 51373203, U1501243, 31530023, and 81271562), National Key R&D Program of China (2016YFE0117100), Natural Science Foundation of the Guangdong Province (2014A030312018, 2016A030313554 and 2015A030313283), the Guangdong Innovative

and

Entrepreneurial

Research

Team

Program

(2013S086),

the

Guangdong-Hongkong Joint Innovation Project (2016A050503026), Project on the Integration of Industry, Education and Research of Guangdong Province (2013B090500094), the Major Project on the Integration of Industry, Education and Research of Guangzhou City (201704030123), and the Fundamental Research Funds for the Central Universities (16lgjc59 and 20162900031650004).

References (1) De Long, W. G., Jr.; Einhorn, T. A.; Koval, K.; McKee, M.; Smith, W.; Sanders, R.; Watson, T. Bone Grafts and Bone Graft Substitutes in Orthopaedic Trauma Surgery. A Critical Analysis. J. Bone Joint Surg. Am. 2007, 89, 649-658. (2) Calori, G. M.; Mazza, E.; Colombo, M.; Ripamonti, C. The Use of Bone-Graft Substitutes in Large Bone Defects: Any Specific Needs? Injury 2011, 42 Suppl 2, S56-63. 26 ACS Paragon Plus Environment

Page 27 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(3) Berner, A.; Reichert, J. C.; Muller, M. B.; Zellner, J.; Pfeifer, C.; Dienstknecht, T.; Nerlich, M.; Sommerville, S.; Dickinson, I. C.; Schutz, M. A.; Fuchtmeier, B. Treatment of Long Bone Defects and Non-unions: From Research to Clinical Practice. Cell Tissue Res. 2012, 347, 501-519. (4) Yuan, X.; Smith, R. J., Jr.; Guan, H.; Ionita, C. N.; Khobragade, P.; Dziak, R.; Liu, Z.; Pang, M.; Wang, C.; Guan, G.; Andreadis, S.; Yang, S. Hybrid Biomaterial with Conjugated Growth Factors and Mesenchymal Stem Cells for Ectopic Bone Formation. Tissue Eng. Part A 2016, 22, 928-939. (5) Ciapetti, G.; Ambrosio, L.; Savarino, L.; Granchi, D.; Cenni, E.; Baldini, N.; Pagani, S.; Guizzardi, S.; Causa, F.; Giunti, A. Osteoblast Growth and Function in Porous Poly Epsilon-Caprolactone Matrices for Bone Repair: a Preliminary Study. Biomaterials 2003, 24, 3815-3824. (6) Tu, J.; Wang, H.; Li, H.; Dai, K.; Wang, J.; Zhang, X. The in Vivo Bone Formation by Mesenchymal Stem Cells in Zein Scaffolds. Biomaterials 2009, 30, 4369-4376. (7) Kim, S.; Kim, S. S.; Lee, S. H.; Eun Ahn, S.; Gwak, S. J.; Song, J. H.; Kim, B. S.; Chung, H. M. In Vivo Bone Formation from Human Embryonic Stem Cell-Derived Osteogenic Cells in Poly(d,l-Lactic-co-Glycolic Acid)/Hydroxyapatite Composite Scaffolds. Biomaterials 2008, 29, 1043-1053. (8) Haidar, Z. S.; Hamdy, R. C.; Tabrizian, M. Delivery of Recombinant Bone Morphogenetic Proteins for Bone Regeneration and Repair. Part B: Delivery Systems for BMPs in Orthopaedic and Craniofacial Tissue Engineering. Biotechnol. Lett. 2009, 31, 1825-1835. (9) Brown, K. V.; Li, B.; Guda, T.; Perrien, D. S.; Guelcher, S. A.; Wenke, J. C. Improving Bone Formation in a Rat Femur Segmental Defect by Controlling Bone Morphogenetic Protein-2 Release. Tissue Eng. Part A 2011, 17, 1735-1746. (10) Ebara, S.; Nakayama, K. Mechanism for the Action of Bone Morphogenetic Proteins and Regulation of Their Activity. Spine 2002, 27, S10-15. (11) Fan, J.; Im, C. S.; Guo, M.; Cui, Z.-K.; Fartash, A.; Kim, S.; Patel, N.; Bezouglaia, O.; Wu, B. M.; Wang, C. Y.; Aghaloo, T. L.; Lee, M. Enhanced Osteogenesis of Adipose-Derived Stem Cells by Regulating Bone Morphogenetic Protein Signaling Antagonists and Agonists. Stem Cells Transl.Med. 2016, 5, 539-551. (12) Brazil, D. P.; Church, R. H.; Surae, S.; Godson, C.; Martin, F. BMP Signalling: Agony and Antagony in the Family. Trends Cell Biol. 2015, 25, 249-264. 27 ACS Paragon Plus Environment


Page 28 of 40

(13) Schneider, H.; Sedaghati, B.; Naumann, A.; Hacker, M. C.; Schulz-Siegmund, M. Gene Silencing of Chordin Improves BMP-2 Effects on Osteogenic Differentiation of Human Adipose Tissue-Derived Stromal Cells. Tissue Eng. Part A 2014, 20, 335-345. (14). Chang, C. B.; Holtzman, D. A.; Chau, S.; Chickering, T.; Woolf, E. A.; Holmgren, L. M.; Bodorova, J.; Gearing, D. P.; Holmes, W. E.; Brivanlou, A. H. Twisted Gastrulation can Function as a BMP Antagonist. Nature 2001, 410, 483-487. (15). Takayama, K.; Suzuki, A.; Manaka, T.; Taguchi, S.; Hashimoto, Y.; Imai, Y.; Wakitani, S.; Takaoka, K. RNA Interference for Noggin Enhances the Biological Activity of Bone Morphogenetic Proteins in Vivo and in Vitro. J. Bone Miner. Metab. 2009, 27, 402-411. (16). Garrett, M. P.; Kakarla, U. K.; Porter, R. W.; Sonntag, V. K. Formation of Painful Seroma and Edema after the Use of Recombinant Human Bone Morphogenetic Protein-2 in Posterolateral Lumbar Spine Fusions. Neurosurgery 2010, 66, 1044-1049. (17) Park, K. W.; Waki, H.; Kim, W. K.; Davies, B. S. J.; Young, S. G.; Parhami, F.; Tontonoz, P. The Small Molecule Phenamil Induces Osteoblast Differentiation and Mineralization. Mol. Cell. Biol. 2009, 29, 3905-3914. (18) Mundy, G.; Garrett, R.; Harris, S.; Chan, J.; Chen, D.; Rossini, G.; Boyce, B.; Zhao, M.; Gutierrez, G. Stimulation of Bone Formation in Vitro and in Rodents by Statins. Science 1999, 286, 1964-1949. (19) Maeda, T.; Matsunuma, A.; Kawane, T.; Horiuchi, N. Simvastatin Promotes Osteoblast Differentiation and Mineralization in MC3T3-E1 Cells. Biochem. Bioph. Res. Co. 2001, 280, 874-877. (20) Wadagaki, R.; Mizuno, D.; Yamawaki-Ogata, A.; Satake, M.; Kaneko, H.; Hagiwara, S.; Yamamoto, N.; Narita, Y.; Hibi, H.; Ueda, M. Osteogenic Induction of Bone Marrow-Derived Stromal Cells on Simvastatin-Releasing, Biodegradable, Nano- to Microscale Fiber Scaffolds. Ann. Biomed. Eng. 2011, 39, 1872-1881. (21) Zhang, Y.; Zhang, J.; Jiang, T.; Wang, S. Inclusion of the Poorly Water-Soluble Drug Simvastatin in Mesocellular Foam Nanoparticles: Drug Loading and Release Properties. Int. J. Pharm. 2011, 410, 118-124. (22) Mauro, V. F. Clinical Pharmacokinetics and Practical Applications of Simvastatin. Clin. Pharmacokinet. 1993, 24, 195-202.


Page 29 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(23) Tiwari, R.; Pathak, K. Nanostructured Lipid Carrier Versus Solid Lipid Nanoparticles of Simvastatin: Comparative Analysis of Characteristics, Pharmacokinetics and Tissue Uptake. Int. J. Pharm. 2011, 415, 232-243. (24) Garrett, I. R.; Gutierrez, G. E.; Rossini, G.; Nyman, J.; McCluskey, B.; Flores, A.; Mundy, G. R. Locally Delivered Lovastatin Nanoparticles Enhance Fracture Healing in Rats. J. Orthop. Res. 2007, 25, 1351-1357. (25) Liu, X.; Li, X.; Zhou, L.; Li, S.; Sun, J.; Wang, Z.; Gao, Y.; Jiang, Y.; Lu, H.; Wang, Q.; Dai, J. Effects of Simvastatin-Loaded Polymeric Micelles on Human Osteoblast-Like MG-63 Cells. Colloid. Surface. B. 2013, 102, 420-427. (26) Shuai, X.; Ai, H.; Nasongkla, N.; Kim, S.; Gao, J. Micellar Carriers Based on Block Copolymers of Poly(Epsilon-Caprolactone) and Poly(Ethylene Glycol) for Doxorubicin Delivery. J. Control. Release 2004, 98, 415-426. (27) Dai, J.; Lin, S.; Cheng, D.; Zou, S.; Shuai, X. Interlayer-Crosslinked Micelle with Partially Hydrated Core Showing Reduction and pH Dual Sensitivity for Pinpointed Intracellular Drug Release. Angew. Chem. Int. Ed. 2011, 50, 9404-9408. (28) Wang, W.; Cheng, D.; Gong, F.; Miao, X.; Shuai, X. Design of Multifunctional Micelle for Tumor-Targeted Intracellular Drug Release and Fluorescent Imaging. Adv. Mater. 2012, 24, 115-120. (29) Chen, W.; Yuan, Y.; Cheng, D.; Chen, J.; Wang, L.; Shuai, X. Co-delivery of Doxorubicin and siRNA with Reduction and pH Dually Sensitive Nanocarrier for Synergistic Cancer Therapy. Small 2014, 10, 2678-2687. (30) Cui, Z. K.; Sun, J. A.; Baljon, J. J.; Fan, J.; Kim, S.; Wu, B. M.; Aghaloo, T.; Lee, M. Simultaneous Delivery of Hydrophobic Small Molecules and siRNA Using Sterosomes to Direct Mesenchymal Stem Cell Differentiation for Bone Repair. Acta Biomater. 2017, 58, 214-224. (31) Wang, L.; Yuan, Y.; Lin, S.; Huang, J.; Dai, J.; Jiang, Q.; Cheng, D.; Shuai, X. Photothermo-Chemotherapy of Cancer Employing Drug Leakage-Free Gold Nanoshells. Biomaterials 2016, 78, 40-49. (32) Nakanishi, M.; Park, J. S.; Jang, W. D.; Oba, M.; Kataoka, K. Study of the Quantitative Aminolysis Reaction of Poly(beta-Benzyl L-Aspartate) (PBLA) as a Platform Polymer for Functionality Materials. React. Funct. Polym. 2007, 67, 1361-1372. (33) Neu, M.; Fischer, D.; Kissel, T. Recent Advances in Rational Gene Transfer Vector Design Based on Poly(Ethylene Imine) and Its Derivatives. J. Gene Med. 2005, 7, 992-1009. 29 ACS Paragon Plus Environment


Page 30 of 40

(34) Nabar, G. M.; Mahajan, K. D.; Calhoun, M. A.; Duong, A. D.; Souva, M. S.; Xu, J.; Czeisler, C.; Puduvalli, V. K.; Otero, J. J.; Wyslouzil, B. E.; Winter, J. O. Micelle-Templated, Poly(Lactic-co-Glycolic Acid) Nanoparticles for Hydrophobic Drug Delivery. Int. J. Nanomed. 2018, 13, 351-366. (35) Bae, Y.; Kataoka, K. Intelligent Polymeric Micelles from Functional Poly(Ethylene Glycol)-Poly(Amino Acid) Block Copolymers. Adv. Drug Del. Rev. 2009, 61, 768-784. (36) Chen, P. Y.; Sun, J. S.; Tsuang, Y. H.; Chen, M. H.; Weng, P. W.; Lin, F. H. Simvastatin Promotes Osteoblast Viability and Differentiation via Ras/Smad/Erk/BMP-2 Signaling Pathway. Nutr. Res. 2010, 30, 191-199. (37) Song, B.-L.; Javitt, N. B.; DeBose-Boyd, R. A. Insig-Mediated Degradation of HMG CoA Reductase Stimulated by Lanosterol, an Intermediate in the Synthesis of Cholesterol. Cell Metab. 2005, 1, 179-189. (38) Shah, S. R.; Werlang, C. A.; Kasper, F. K.; Mikos, A. G. Novel Applications of Statins for Bone Regeneration. Natl. Sci. Rev. 2015, 2, 85-99. (39) Cui, Z. K.; Fan, J.; Kim, S.; Bezouglaia, O.; Fartash, A.; Wu, B. M.; Aghaloo, T.; Lee, M. Delivery of siRNA via Cationic Sterosomes to Enhance Osteogenic Differentiation of Mesenchymal Stem Cells. J. Control. Release 2015, 217, 42-52. (40) Ahmed, T. A. E.; Griffith, M.; Hincke, M. Characterization and Inhibition of Fibrin Hydrogel-Degrading Enzymes During Development of Tissue Engineering Scaffolds. Tissue Eng. 2007, 13, 1469-1477. (41) Saul, J. M.; Linnes, M. P.; Ratner, B. D.; Giachelli, C. M.; Pun, S. H. Delivery of Non-viral Gene Carriers from Sphere-Templated Fibrin Scaffolds for Sustained Transgene Expression. Biomaterials 2007, 28, 4705-4716. (42) Kowalczewski, C. J.; Saul, J. M. Surface-Mediated Delivery of siRNA from Fibrin Hydrogels for Knockdown of the BMP-2 Binding Antagonist Noggin. Acta Biomater. 2015, 25, 109-120. (43) Sawyer, A. A.; Song, S. J.; Susanto, E.; Chuan, P.; Lam, C. X.; Woodruff, M. A.; Hutmacher, D. W.; Cool, S. M. The Stimulation of Healing within a Rat Calvarial Defect by mPCL-TCP/Collagen Scaffolds Loaded with rhBMP-2. Biomaterials 2009, 30, 2479-2488. (44) Kretlow, J. D.; Spicer, P. P.; Jansen, J. A.; Vacanti, C. A.; Kasper, F. K.; Mikos, A. G. Uncultured Marrow Mononuclear Cells Delivered within Fibrin Glue Hydrogels to Porous Scaffolds Enhance Bone Regeneration within Critical-Sized Rat Cranial Defects. Tissue Eng. Part A 2010, 16, 3555-3568. 30 ACS Paragon Plus Environment

Page 31 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figures

SIM

N-siRNA

Assembly

Complex

PBP Polymer

Cutaway view Uptake Pre-osteoblast MC3T3-E1cell Cell membrane

Endocytosis BMP-2

Fibrin hydrogel

Osteogenesis

SIM

Lysosome

N-siRNA

Noggin

Cranial defect

Figure 1. Illustration of the preparation, intracellular fate of the pH-sensitive micelle carrying simvastatin (SIM) and siRNA targeting noggin gene (N-siRNA) in MC3T3-E1 cells, and the synergetic effect on osteogenesis in mouse calvarial defect site. PBP polymer indicates the triblock copolymer mPEG-bPEI-PAsp(DIP-BzA).



(A) 20

Particle size

60

15 50 10 40 5 30

0 -5

20 0

3

6

10

13 16 19 N/P ratio

8

10

(B) N/P 0

Zeta potential (mV)

Zeta potential Particle size (nm)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 40

4

6

B-PBP@siRNA

30 36 45 4

0

6

8

10

SIM-PBP@siRNA

Figure 2. (A) Particle size and zeta potential of SIM-loaded micelles (SIM-PBP@siRNA) at various N/P ratios and pH 7.4. Data are shown as the mean ± SD (n=3). (B) Electrophoretic mobility of scrambled siRNA (SCR) in agarose gel after complexation with SIM-free and SIM-loaded micelles at various N/P ratios.


Page 33 of 40

(A)

(B)

100 nm

100 nm

(C)

(D) 100 Simvastatin release (%)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


80 pH 5.0 @siRNA pH 5.0 pH 7.4 @siRNA pH 7.4

60 40 20 0

2 µm

0

5

10

15 20 25 30 35 40 Time (h)

Figure 3. Transmission electron microscope (TEM) images of SIM-loaded micelles (SIM-PBP) (A), SIM and N-siRNA loaded micelles (SIM-PBP@N-siRNA, N/P 10) at pH 7.4 (B) and pH 5.0 (C). In vitro SIM release from SIM-PBP and SIM-PBP@N-siRNA micelles at pH 7.4 and 5.0 (D). Data are shown as the mean ± SD (n=3). Samples were stained with 0.5% uranyl acetate for TEM measurement.



(A) SCR-FITC

Nile red

Bright

Merge

LysoTracker

Nile red

Bright

Merge

60 min

Nuclei

(B)

20 min

Nuclei

90 min

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 34 of 40

Figure 4. Confocal laser scanning microscope (CLSM) images of MC3T3-E1 cells incubated with different micelles. (A) The codelivery of Nile red dye and FITC-labeled SCR-siRNA mediated by Nile red-PBP@SCR-FITC of N/P 10. (B) The intracellular distribution of Nile red-PBP@SCR at different time points after transfection, in which the lysosomes were stained green with LysoTracker® Green DND. Nile red dye was used as a substitute for simvastatin and emitted red fluorescence. The nuclei were stained blue with Hoechst 33342. The scale bars represent 40 µm.


Page 35 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5. The ratio of the BMP-2 mRNA to the noggin mRNA quantified by RT-PCR and the levels of BMP-2 and noggin protein by Western blot in MC3T3-E1 cells incubated with different doses of SIM and siRNA. The ratio of BMP-2 mRNA to noggin mRNA of cells incubated with B-PBP or SIM-PBP@SCR at various SIM concentrations (A), SIM-PBP@siRNA at 1 µM SIM and various siRNA concentrations (B), SIM-PBP@N-siRNA at various SIM concentrations and 120 nM siRNA (C). The BMP-2 and noggin protein of MC3T3-E1 cells incubated with micelles carrying SIM and SCR-siRNA or N-siRNA (D).

In (D) SCR-siRNA and

N-siRNA were applied at a dose of 120 nM, while SIM was applied at a dose of 1 µM or 10 µM. The N/P ratio for all micelles was 10. Incubation time was 48 h. Data are shown as the mean ± SD (n=3). *P < 0.05, **P < 0.01, ***P < 0.001. ns: no significant difference. 35 ACS Paragon Plus Environment


Page 36 of 40

Figure 6. 3D images of Nile red-PBP@SCR-AF488 transfected MC3T3-E1 cells in fibrin hydrogel taken out from a mouse calvarial defect site at 1 day postimplantation. Blue fluorescence indicates Hoechst 33342 staining nuclei, green fluorescence represents SCR-AF488, and red fluorescence represents Nile red dye. SCR-AF488 was scramble siRNA labeled with AF488 dye. Before being encapsulated into fibrin gel, MC3T3-E1 cells were incubated with Nile red-PBP@SCR-AF488 of N/P 10 at a dose of 200 ng/mL Nile red and 120 nM SCR-AF488. The scale bars represent 200 µm. SCR-AF488: AF488 dye labeled SCR-siRNA.


Page 37 of 40

(A)

(B) N-siRNA -cell

SIM -cell

Blank-cell N-siRNA-cell SIM-cell SIM/N-siRNA-cell

SIM/N-siRNA -cell 60

4 weeks

Percentage healed (%)

2 weeks

Blank -cell

8 weeks

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


**

50 40

** *

*

*

**

*

*

*

30

20 10

2 weeks

4 weeks

8 weeks

Figure 7. Microcomputed tomography images (A) and quantitative analysis (B) of parietal bone growth in mouse calvarial defect at 2, 4 and 8 weeks postimplantation of fibrin hydrogel loaded with micelle-transfected MC3T3-E1 cells. The scale bars represent 1.0 mm. Data are shown as the mean ± SD (n=10). *P < 0.05, **P < 0.01. Abbreviations: Blank-cell, hydrogel loaded with B-PBP@SCR-siRNA transfected cells; SIM-cell, hydrogel loaded with SIM-PBP@SCR-siRNA transfected cells; N-siRNA-cell,

hydrogel

loaded

with

B-PBP@N-siRNA

transfected

cells;

SIM/N-siRNA-cell, hydrogel loaded with SIM-PBP@N-siRNA transfected cells. Scrambled siRNA (SCR-siRNA) and noggin siRNA (N-siRNA):120 nM; Simvastatin (SIM): 1 µM.



(A)

2 weeks

8 weeks

SIM/N-siRNA N-siRNA -cell -cell

SIM -cell

Blank -cell

4 weeks

HB HB

HB

(B)

HB HB

2 weeks

HB

8 weeks

Blank -cell

4 weeks

SIM -cell SIM/N-siRNA N-siRNA -cell -cell

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 38 of 40

HB

HB HB

HB

HB

HB

Figure 8. Hematoxylin & eosin staining (A) and Masson trichrome staining (B) for histological analysis of bone regeneration in calvarial defect at 2, 4 and 8 weeks postimplantation of fibrin hydrogel loaded with micelle-transfected MC3T3-E1 cells. Yellow vertical lines indicate the edges of host bone (HB). The green dashed rectangles in (A) and red dashed rectangles in (B) mark the new bone areas. The nuclei and cytoplasma were stained blue and red in hematoxylin & eosin staining, respectively. The osteoid matrix and muscle fibers were stained blue and red in Masson trichrome staining, respectively. The scale bars represent 500 µm. Abbreviations: Blank-cell, hydrogel loaded with B-PBP@SCR-siRNA transfected cells; SIM-cell, hydrogel loaded with SIM-PBP@SCR-siRNA transfected cells; 38 ACS Paragon Plus Environment

Page 39 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


N-siRNA-cell,

hydrogel

loaded

with

B-PBP@N-siRNA

transfected

cells;

SIM/N-siRNA-cell, hydrogel loaded with SIM-PBP@N-siRNA transfected cells. Scrambled siRNA (SCR-siRNA) and noggin siRNA (N-siRNA):120 nM; Simvastatin (SIM): 1 µM.

(A)

(B)

Blank-cell

Blank-cell

SIM-cell

SIM-cell

N-siRNA-cell

N-siRNA-cell

SIM/N-siRNA-cell

SIM/N-siRNA-cell

Figure 9. In vivo immunohistochemical staining of BMP-2 (A) and noggin protein (B) in calvarial defect at 2, 4 and 8 weeks postimplantation of fibrin hydrogel loaded with micelle-transfected MC3T3-E1 cells. The nuclei were stained blue, and the BMP-2 and noggin proteins were stained brown. The scale bars represent 50 µm. Abbreviations: Blank-cell, hydrogel loaded with B-PBP@SCR-siRNA transfected cells; SIM-cell, hydrogel loaded with SIM-PBP@SCR-siRNA transfected cells; N-siRNA-cell,

hydrogel

loaded

with

B-PBP@N-siRNA

transfected

cells;

SIM/N-siRNA-cell, hydrogel loaded with SIM-PBP@N-siRNA transfected cells. Scrambled siRNA (SCR-siRNA) and noggin siRNA (N-siRNA):120 nM; simvastatin (SIM): 1 µM.



Page 40 of 40

TOC figure


The pH-Sensitive Nanocarrier Mediated ... - ACS Publications

Recommend Documents