Thyroid-State Influence on Protein-Expression Profile of Rat Skeletal

Thyroid-State Influence on Protein-Expression Profile of Rat Skeletal Muscle Elena Silvestri,† Lavinia Burrone,† Pieter de Lange,‡ Assunta Lombardi,§ Paola Farina,‡ Angela Chambery,‡ Augusto Parente,‡ Antonia Lanni,‡ Fernando Goglia,† and Maria Moreno*,† Dipartimento di Scienze Biologiche ed Ambientali, Universita` degli Studi del Sannio, Via Port’Arsa 11, 82100 Benevento, Italy, Dipartimento di Scienze della Vita, Seconda Universita` di Napoli, Via Vivaldi 43, 81100 Caserta, Italy, and Dipartimento delle Scienze Biologiche, Sezione Fisiologia, Universita` degli Studi di Napoli “Federico II”, Via Mezzocannone 8, 80134 Napoli, Italy Received March 8, 2007

We analyzed the whole-cell protein content of gastrocnemius muscles from rats in different thyroid states. Twenty differentially expressed proteins were unambiguously identified. They were involved in substrates and energy metabolism, stress response, cell structure, and gene expression. This study represents the first systematic identification of thyroid state-induced changes in the skeletal muscle protein-expression profile and reveals new cellular pathways as targets for thyroid hormone action. Keywords: Triiodothyronine • rat gastrocnemius muscle • two-dimensional gel electrophoresis

Introduction Skeletal muscles utilize a large amount of energy to maintain their basal metabolism as well as generate mechanical forces, and they thereby play an important role in whole-body metabolism, accounting for a large part of the difference in metabolic rate between individuals.1 Energy consumption in skeletal muscles is enhanced by exercise and adaptative thermogenesis to maintain energy homeostasis and body weight.2 It is well known that muscle physiology is greatly influenced by the individual’s thyroid state.3-5 Indeed, triiodothyronine (T3) affects the normal development of vertebrate skeletal muscle, and an intact thyroid gland is required for both development of muscle mass and differentiation of the biochemical and contractile characteristics of the tissue.6 Thyroid hormones modulate energy-consuming reactions (contraction and relaxation) as well as reactions within energy-producing pathways with thyroid deficiency leading to muscular weakness and excessive fatigability. Many studies dealing with control of muscle physiology by thyroid hormones have been devoted to transcriptional effects and enzymes activities, while fewer studies have been focused on identification of the effects that thyroid hormones exert on the whole muscle-cell proteinexpression profile. Indeed, a discrepancy could exist between the transcriptional profile, the actual protein expression levels, and the relative activities within the cells. Actually, overall transcription-dependent T3 signaling can be modulated at many levels, defined by the thyroid hormone receptor isoforms present in the tissue, the DNA response element in the regulated gene, the availability of receptor-binding partners, interactions with coactivators and corepressors, ligand avail* To whom correspondence should be addressed. Phone: +39 0824 305124. Fax: +39 0824 23013. E-mail: [email protected]. † Universita` degli Studi del Sannio. ‡ Seconda Universita` di Napoli. § Universita` degli Studi di Napoli. 10.1021/pr0701299 CCC: $37.00

 2007 American Chemical Society

ability, mRNA and protein stability, protein translocation, and metabolic interference.7-11 Furthermore, several T3-mediated post-transcriptional changes support T3 activity.12 Thus, the network of factors and cellular events involved in T3 signaling is very complex, while the mechanisms underlying the tissuespecific actions of T3 appear even more complicated and remain incompletely understood. The metabolic specialization of individual skeletal muscle fibers has been shown to be modulated by thyroid hormones which, coordinating expressions of contractile and metabolic proteins,13 adjust patterns of energy metabolism to match specific energy requirements. The expression patterns of proteins in various muscle types (fast- and slow-twitch muscles) have been studied using biochemical and immunohistochemical techniques. Recently, advances in proteomic techniques have made it possible to analyze the expressions and modifications of several hundreds of proteins at one time.14-16 To understand the molecular basis underlying the physiological features shown by skeletal muscles taken from rats in different thyroid states, we performed a high-resolution differential proteomic analysis [by combining two-dimensional gel electrophoresis (2D-E) and subsequent matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry (MALDITOF-MS)] to study rat gastrocnemius, a mixed-type muscle containing regions of slow- and fast-twitch fibers. This is the first time that proteomic technology has been employed to study the modulation that T3 exerts in vivo over skeletal muscle proteins, and it provides the first systematic identification of T3-induced changes in the rat gastrocnemius protein-expression profile.

Methods Materials. 3,5,3′-Triiodo-L-thyronine (T3), propylthiouracil (PTU), and iopanoic acid (IOP) were purchased from SigmaAldrich Corp. (St. Louis, MO). All solvents used were of highJournal of Proteome Research 2007, 6, 3187-3196

3187

Published on Web 07/03/2007

research articles performance liquid-chromatography (HPLC) grade (SigmaAldrich Corp. and Carlo Erba, Italy). Immobilized pH-gradient (IPG) and ampholites were purchased from Bio Rad Laboratories (Hercules, CA). Acrylamide, other reagents for the polyacrylamide gel preparation, CHAPS, urea, thiourea, dithioerythriol, EDTA, iodoacetamide, colloidal Coomassie blue, and trypsin were from Sigma-Aldrich. ZipTip C18 microcolumns were from Millipore (Milan, Italy). Animals. Male Wistar rats were kept one per cage in a temperature-controlled room at 28 °C under a 12-h light, 12-h dark cycle. A commercial mash and water were available ad libitum. Three groups of rats (each consisting of six animals) were used throughout: namely, euthyroid rats (referred to as Eu), hypothyroid rats (referred to as Hypo), and T3-treated hypothyroid rats (referred to as Hypo+T3 or hyperthyroid rats). Hypothyroidism and hyperthyroidism were induced as previously reported.17,18 In brief, hypothyroidism was induced by the ip administration of PTU (1 mg/100 g BW) for 4 weeks together with a weekly ip injection of IOP (6 mg/100 g BW).17,18 This treatment provided us with hypothyroid rats with low thyroidhormone levels and an inhibition of all three of the deiodinase enzymes.17,18 T3 was chronically administered by giving seven daily ip injections of 15 µg of T3 /100 g of BW to hypothyroid rats, while the control euthyroid and hypothyroid rats received saline injections [dose and duration of T3 treatment were chosen to obtain animals that were mildly hyperthyroid but not hypermetabolic17,18]. This animal model allows one to exclude the effects of other active iodothyronines putatively derived from the peripheral metabolism of thyroid hormone after T3 injection.19 At the end of the treatment rats were anaesthetized and then killed by decapitation. Gastrocnemius muscles were excised, weighed, immediately frozen in liquid nitrogen, and then stored at -80 °C for later processing. Hypothyroidism and hyperthyroidism in Hypo and Hypo+T3 animals, respectively, were verified by measurement of total serum levels of T3 (TT3) and thyroxine (T4) (TT4). To this end, trunk blood was collected and serum isolated to allow analysis of hormone levels using specific RIAs (ICN Pharmaceuticals, Diagnostic Division, New York, NY). All experiments were performed in accordance with general guidelines regarding animal experiments and approved by our institutional committee for animal care. RT-PCR Analysis of mRNA. To quantify mRNA by RT-PCR, total RNA was prepared from frozen tissue samples using TRIzol according to the manufacturer’s protocol (Invitrogen Life Technologies, Milan, Italy). Then, 1 µg of total RNA was reversetranscribed using 100 pmol of random hexamers (Invitrogen), 2.0 units of Superscript reverse-transcriptase, 0.5 units of RNAse inhibitor, and 1 mM deoxynucleotide triphosphates (dNTPs) in reverse-transcriptase buffer (all from HT Biotechnology, Cambridge, U.K.). The total volume was adjusted to 20 µL with sterile distilled water. The RT reaction was carried out for 1 h at 40 °C. One-quarter of the RT reaction mixture was used directly for the PCR reaction in a total volume of 25 µL, containing 0.25 units of SuperTaq polymerase, 0.25 mM dNTPs, SuperTaq PCR buffer (all from HT Biotechnology), 5% (v/v) dimethylsulfoxide (DMSO, Sigma-Aldrich Corp.), and 0.38 pmol of the relevant oligonucleotide primers (Primm, Italy). As an internal control the same cDNAs were amplified using 40S ribosomal protein S12 (RPS12) oligonucleotide primers. The primers used had the following sequences: RPS12 sense 5′GCTGCTGGAGGTGTAATGGA-3′; RPS12 antisense 5′-CTACAACGCAACTGCAACCA-3; myosin heavy chain type Ib (MH3188

Journal of Proteome Research • Vol. 6, No. 8, 2007

Silvestri et al.

CIb) sense 5′- ACAGAGGAAGACAGGAAGAACCTAC-3′; MHCIb antisense 5′- GGGCTTCACAGGCATCCTTAG-3′; myosin heavy chain type IIb (MHCIIb) sense 5′- CTGAGGAACAATCCAACGTC3′; MHCIIb antisense 5′- TTGTGTGATTTCTTCTGTCACCT-3′. Parallel amplifications (20, 25, and 30 cycles) of a given cDNA were used to determine the optimum number of cycles. For each gene under study a readily detectable signal within the linear range was observed after 30 cycles. For the actual analysis samples were heated for 5 min at 95 °C; then 30 cycles were carried out, each consisting of 1 min at 95 °C, 1 min at 60 °C, and 1 min at 72 °C. This was followed by a final 10-min extension at 72 °C. Separation of the PCR products was performed on a 2% agarose gel containing ethidium bromide. The products were readily visualized and quantified by means of a BioRad Molecular Imager FX using the supplied software (QuantityOne, Bio Rad). Expression signals were normalized with respect to the RPS12 signal. Western Blot Analysis. For Western blotting analysis gastrocnemius muscle was homogenized in lysis buffer containing 20 mM Tris-Cl pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 2.5 mM Na2H2P2O7, 1 mM b-CH3H7O6PNa2, 1 mM Na3VO4, 1 mM PMSF, 1 mg/mL leupeptin, and 1% Triton X-100 (all from Sigma-Aldrich Corp., St Louis, MO) using an ultraturrax and then centrifuged at 10 000g for 10 min at 4 °C (Beckman Optima TLX, Beckman Coulter S.p.A., Milan, Italy). For determination of muscle-fiber content, supernatants were used without further processing. The protein concentrations of the lysates were determined using Bio Rad’s DC method (Bio Rad Laboratories, Hercules, CA). MHCIb and MHCIIb proteins were determined by separating muscle lysates on an 8% SDS polyacrylamide gel and then using as primary monoclonal antibodies an antibody from Chemicon International (Temecula, CA, MAB1628, specific for slow myosin heavy chain, and strongly reacting with rat slow myosin heavy chain) and an antibody from Sigma Aldrich (St. Louis, MI, M4276, localizing an epitope on the myosin heavy chain, and staining in particular the fast (type II) in skeletal muscle), respectively. Proteins were finally detected by a chemiluminescence proteindetection method based on the protocol supplied with a commercially available kit (NEN, Boston, MA) and using the appropriate secondary antibody. Protein Extraction, Sample Preparation, and Two-Dimensional Gel Electrophoresis (2D-E). 2D-E was performed essentially as previously reported.20 In brief, frozen muscle tissue (40 mg) was homogenized in 1 mL of 8.3 M urea, 2 M thiourea, 2% CHAPS, 1% DTT, and 2% IPG buffer, pH 3-10, using a polytron. Crude extracts were vigorously shaken for 30 min at 4 °C followed by a 30 min centrifugation at 10 000g. Determination of protein concentration was performed using Bio Rad’s DC method (Bio Rad Laboratories, Hercules, CA). Total protein extracts were prepared for each animal, and each individual was assessed separately. Samples of 650 µg of protein were applied to immobilized pH 3-10 nonlinear-gradient strips (17 cm; BioRad). For each sample triplicate runs were performed as independent experiments. Samples of 1 mg of protein were utilized for preparative gels. Focusing started at 200 V, with the voltage being gradually increased to 3500 V and then kept constant for a further 66500 Vh (PROTEAN IEF System; BioRad). Prior to SDS-PAGE the IPG strips were incubated for 15 min with a solution of Tris-Cl buffer (pH 8.8), urea (6 M), glycerol (30%, v/v), SDS (2%, w/v), and DTT (1%, w/v). Strips were then equilibrated for further 15 min in the same buffer containing iodoacetamide (5%, w/v) instead of DTT. The second-dimen-

research articles

Thyroid State and Proteome of Rat Skeletal Muscle

sional separation was performed in 12% SDS-polyacrylamide gels. After protein fixation the gels were stained with colloidal Coomassie blue (Sigma-Aldrich). Protein Visualization and Image Analysis. Electronic images of the gels were acquired by a calibrated densitometer (GS800; BioRad) and analyzed using PDQuest software (BioRad). Molecular masses were determined by running standard protein markers, covering the range 10-200 kDa. The pI values used were those given by the supplier of the IPG strips. Scanned gel images were processed for removal of background and automatic detection of spots. Statistical Analysis. For all spot-intensity calculations normalized values were used to calculate relative intensity (RI) for each spot: RI ) vi/vt, where vi is the volume of the individual spot and vt the sum of the volumes of all matched spots. For each match-set analysis maps corresponding to protein extracts from animals in the same thyroid status were organized into “Replicate Groups” named Euthyroid (Eu), Hypothyroid (Hypo), and T3-treated Hypothyroid (Hypo+T3. This allowed us to carry out the statistical analysis of the densitometric data (expressed as normalized spot densities) automatically performed by the software using a Student’s t test. Spots for which the P value was less than 0.05 were considered to display significant changes between thyroid states. Concerning TT4 and TT3 serum levels, RT-PCR, and western blot analysis, results are expressed as means ( SD. The statistical significance of differences between groups was determined using a one-way ANOVA followed by a Student-Newman-Keuls test (P < 0.05). In-Gel Digestion. In-gel digestion with trypsin was performed as described by others21 with minor modifications. In brief, spots showing significant changes in expression level were manually excised from the 2-DE gels and destained by washing twice with 100 µL aliquots of water and performing a further washing step with 50% acetonitrile. The gel pieces were then dried in a SpeedVac Vacuum (Savant Instruments, Holbrook, NY) and rehydrated with 10 µL of 50 mM ammonium bicarbonate followed by addition of 5 µL of a 70 ng/mL TPCK porcine trypsin solution. Digestion was performed by incubation at 37 °C for 3 h. Further amounts of buffer solution without trypsin were added when necessary to keep the gel pieces wet during digestion. Peptides were extracted in two steps by sequential addition of 1% trifluoroacetic acid (TFA) followed by 2% TFA/50% acetonitrile for 5 min in a sonication bath. The combined supernatants were concentrated in the SpeedVac Vacuum for mass spectrometry analysis. When necessary, the tryptic peptide mixture was extracted and purified using a Millipore ZIPTIP C18 column (Milan, Italy). MALDI-TOF-MS Analysis. After in situ tryptic digestion proteins were identified by the peptide mass fingerprint (PMF) method, based on matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) as follows. Tryptic peptides were mixed with an equal volume of saturated R-cyano-4,4-hydroxycinnamic acid matrix solution [10 mg/mL in ethanol:water (1:1; v:v), containing 0.1% TFA] and spotted onto a MALDI-TOF target plate. The droplet was then dried at room temperature. Once the liquid had completely evaporated the sample was loaded into the mass spectrometer and analyzed. Peptide spectra were collected on a MALDI LR mass spectrometer (Waters Corp., Milford, MA) in the positive-ion reflectron mode. The instrument was externally calibrated using a tryptic alcohol dehydrogenase digest (Waters, Milford, MA) as standard. The protonated monoisotopic mass of adrenocorticotrophic hormone (ACTH) peptide (m/z 2465.199) was

Table 1. Serum Levels of Total T3 (TT3) and Total T4 (TT4) in Eu, Hypo, and Hypo+T3 Animalsa experimental groups

TT4 (nmol/L) TT3 (nmol/L)

Eu

Hypo

Hypo+T3

60.0 ( 2.0 0.85 ( 0.04

7.0 ( 0.15 ( 0.03a

6.0 ( 0.5a 1.2 ( 0.11a,b

0.9a

a In order to ascertain the effectiveness of the experimental treatments, we assessed the thyroid state of each animal by measuring the serum levels of total T3 (TT3) and total T4 (TT4). To this end, trunk blood was collected and serum isolated to allow analysis of hormone levels using specific RIAs (ICN Pharmaceuticals, Diagnostic Division, New York, NY). Results are expressed as means ( SD (n ) 6). P < 0.05 vs Eu. b P < 0.05 vs Hypo).

used as an internal lock mass to further improve the peptidemass accuracy to 50 ppm. All spectra were processed and analyzed using the MassLynx 4.0 software (Waters, Milford, MA). The obtained spectra were used to identify proteins in the SWISSPROT protein sequence database by means of the Protein Lynx Global Server 2.0 software. The following searching parameters were used: mass tolerance, 50 ppm; allowed number of missed cleavage sites, up to 1; cysteine residue, modified as carbamidomethyl-cys; minimum number of matched-peptides, 3; and the isotope masses were used.

Results Thyroid State and Gastrocnemius Muscle Fiber Type Composition in Eu, Hypo, and Hypo+T3 Rats. First, in order to ascertain the effectiveness of the experimental treatments we assessed the thyroid state of each animal by measuring the serum levels of total T3 (TT3) and total T4 (TT4). As expected, the T3 and T4 levels were significantly lower in Hypo rats than in the Eu controls, while T3 administration to Hypo rats increased TT3 levels to above those seen in both Eu and Hypo rats (Table 1). Then, to evaluate thyroid state-induced structural shifts in the gastrocnemius muscles of Eu, Hypo, and Hypo+T3 rats we measured the expression levels of MHCIb and MHCIIb. Since MHCs have a high molecular mass (220 kDa) and cannot be analyzed by 2D-E because of poor focusing in the first dimension, we performed RT-PCR and Western blot (Figure 1A and B, respectively). At the mRNA level (Figure 1A) MCHIb was significantly increased in Hypo vs Eu gastrocnemius (+120% in Hypo vs Eu) and administration of T3 significantly reduced its expression (-31% in Hypo+T3 vs Hypo), although it was still higher than in Eu (+39% in Hypo+T3 vs Eu). The mRNA level for MCHIIb, on the other hand, was significantly reduced in both Hypo and Hypo+T3 gastrocnemius muscles vs Eu ones (-40% in each case). MCHIb protein expression (Figure 1B) was strongly up-regulated in Hypo vs Eu gastrocnemius (about a 20-fold increase), and the level was significantly reduced in Hypo+T3 animals (about a 4-fold decrease vs Hypo), although it was still higher than in Eu animals (about a 5-fold increase vs Eu) with a trend similar to that shown by the mRNA expression. MCHIIb protein (Figure 1B), on the other hand, did not differ significantly among the three groups, although it tended to show a slight decrease in Hypo and a slight increase in Hypo+T3 (vs Eu). Protein-Expression Profiling by 2D-E Analysis in Rat Gastrocnemius Muscles from Eu, Hypo, and Hypo+T3 Rats. For each rat (n ) 6, Eu; n ) 6, Hypo; n ) 6, Hypo +T3), the gastrocnemius was dissected and proteins were extracted and separated on a 2D-E gel. Overall, the 2D-E gel protein-spot Journal of Proteome Research • Vol. 6, No. 8, 2007 3189

research articles

Figure 1. (A) RT-PCR-based measurements of MHCIb and MHCIIb mRNA levels in gastrocnemius of Eu, Hypo, and Hypo+T3 rats. RPS12 mRNA levels were measured as the internal standard. Each lane contains PCR product derived from the appropriate cDNA, for which 1 µg total RNA was used. Each treatment was performed in triplicate. On the right side, quantification of the data [expressed relative to the value obtained for control (Eu) gastrocnemius, set as 1.0, and presented separately for each treatment (as indicated)]. Error bars represent SD of the mean (n ) 3). Bars labeled with dissimilar letters (in brackets for MHCIIb) are significantly different, P < 0.05. (B) Western blotting analysis of MHCIb and MHCIIb protein levels in gastrocnemius of Eu, Hypo, and Hypo+T3 rats. Each lane contained 30 µg of protein of total tissue lysate from a single rat. Each treatment was performed in triplicate (not shown). On the right side, quantification of the data [expressed relative to the value obtained for control (Eu) gastrocnemius, set as 1.0]. Error bars represent SD of the mean (n ) 3), and bars labeled with dissimilar letters (in brackets for MHCIIb) are significantly different, P < 0.05.

patterns were qualitatively and quantitatively similar across all the gels (Figure 2A). With the detection limits set the software counted 220 spots per gel on average of which 86-96% were matched among the various maps. Subsequent analysis was conducted considering only spots present under all experimental conditions. Statistical analysis of the densitometry data allowed identification of differentially expressed protein spots among Eu, Hypo, and Hypo+T3 maps, organized in replicate groups. As shown in Figure 2B statistical analysis detected 33 differentially expressed spots among the three experimental groups (P < 0.05). Identification of Differentially Expressed Proteins in Rat Gastrocnemius Muscle. Next, the differentially expressed spots were manually excised from the relative Coomassie bluestained preparative gels and submitted to digestion, the subsequent protein identification being performed using MALDITOF-MS. This led to identification of 20 differentially expressed proteins corresponding to 14 different gene products (Table 2) in accordance with ref 22. The molecular weight (Mr) and isoelectric point (pI) of each protein corresponded roughly to its position on the 2D-E gel. Furthermore, several proteins were identified at multiple spot positions, putatively reflecting the occurrence of post-translational modifications [for each of these proteins, however, the pattern of change among the groups (Eu, Hypo, Hypo+T3) was fairly similar for the various spot positions (Table 2)]. 3190


Silvestri et al.

Functional Grouping of Differentially Expressed Proteins. On the basis of the identities of the various proteins we grouped them into five functional categories: (i) substrate metabolism, (ii) energy metabolism, (iii) stress response, (iv) cell structure, and (v) gene expression and translation initiation. (i) Substrate Metabolism. T3 participates with other hormones, such as insulin and catecholamines, in the regulation of skeletal muscle metabolism. Some of the identified proteins play key roles in glucose utilization. In particular, spot 6, corresponding to beta-enolase (ENOB), was not different in gastrocnemius muscle between Hypo and Eu rats but was significantly up-regulated following T3 administration vs both Eu and Hypo rats (70% and 150% increase, respectively) (Figure 3). Spots 14 and 15, corresponding to pyruvate kinase (KPYM), were significantly down-regulated in Hypo rats vs Eu ones (40% and 70% decrease, respectively) but significantly up-regulated following T3 treatment (230% increase vs Hypo rats and 35% increase, on average, vs Eu ones) (Figure 3). Likewise, spot 33 [corresponding to triosephosphate isomerase (TPIS)] was significantly down-regulated in Hypo rats vs Eu ones (40% decrease) and significantly up-regulated in hypo+T3 rats (100% and 20% increase vs Hypo and Eu rats, respectively) (Figure 3). Spots 29 and 30 corresponded to cytoplasmic malate dehydrogenase (MDHC), and while these were not changed in Hypo rats vs Eu ones, both were increased following T3 administration (60-100% and 70-80% increase vs Hypo and Eu rats, respectively) (Figure 3). The expression level of spot 32, identified as phosphatidylethanolamine-binding protein (PEBP), was significantly increased in both Hypo and Hypo+T3 rats vs euthyroid controls (Table 2). (ii) Energy Metabolism. It is well established that T3 exerts a modulatory effect on skeletal muscle energy metabolism by affecting both the cytoplasmic and the mitochondrial energy transduction apparatuses, thereby markedly affecting cell respiration. In this study we found that hypothyroidism induced a significant reduction in the expression level of creatine kinase M-type (KCRM, spots 7, 8, and 18) vs both euthyroid and T3-treated animals, with T3 treatment able to restore the euthyroid level (Figure 3). On the other hand, both hypothyroidism and T3 treatment increased the levels of the ATP synthase beta subunit (ATP B, spot 17) (200% and 120% increase vs Eu rats, respectively) with a slight but significant reduction (-20%) in Hypo+T3 gastrocnemius vs Hypo (Figure 3). (iii) Stress Response. In response to stress, cells produce a series of heat shock proteins (HSPs). One of the most expressed HSPs is the 70 kDa HSP (HSP70). Spot 1, corresponding to HSP70, was significantly up-regulated in hypothyroid gastrocnemius muscles vs both Eu and Hypo+T3 rats (70% and 100% increase, respectively), with the Hypo+T3 level not being different from the euthyroid one (Figure 3). Spots 12 and 20 were identified as HSP20 (a non-heat-inducible HSP), whose biological function appears to be regulated by several cellular signaling pathways. We found that the HSP20 expression levels strictly followed those of HSP70, being significantly upregulated in hypothyroid gastrocnemius muscles vs both Eu and Hypo+T3 rats (on average, 200% and 75% increases, respectively) (Figure 3). In contrast, the expression level of spot 10, identified as HSP27, was significantly increased in Hypo+T3 rats vs both Eu and Hypo controls (230% and 100% increase, respectively) (Figure 3). (iv) Cell Structure. In striated muscle force is generated by an interaction between the molecular motor myosin and

research articles


Figure 2. (A) Representative 2D-E images obtained from gastrocnemius muscle of Eu, Hypo, and Hypo+T3 rats. 2D-E was performed using a nonlinear pH range of 3-10 in the first dimension (17 cm strips) and SDS-PAGE (12%) in the second. Protein loading was 650 µg, and the gels were stained using colloidal Coomassie blue. Calibration of Mr and pI was performed using PDQuest software. (B) Differentially expressed proteins in gastrocnemius muscle of Eu, Hypo, and Hypo+T3 rats. The protein spots with a density that was significantly different among the experimental groups (P < 0.05) are marked and numbered.

filamentous actin, the major proteins in the thick and thin filaments, respectively. Spot 19 was identified as myosin regulatory light chain 2 (MLRV). The expression level of this protein, typical of slow-twitch fibers, was strongly increased in Hypo rats vs Eu ones (450% increase). T3 administration tended to reduce its expression (30% decrease vs Hypo rats) even although it was still significantly elevated vs Eu (300% increase) (Figure 3). This is in accordance with the prevalent expression of MHCI in Hypo gastrocnemius muscles and its reduced expression in Hypo+T3 ones. Spots 4 and 24, identified as skeletal R-actin, showed progressively increased protein levels through the transition Eu < Hypo < Hypo+T3, the maximal reached level being in Hypo+T3 gastrocnemius (40% increase vs Eu) (Figure 3). (v) Gene Expression and Translation Initiation. Several studies23,24 have reported that T3 has the potential to modulate

gene expression by acting both at the transcriptional level (by affecting the expression of transcription factors and cofactors) and post-transcriptionally (by acting on mechanisms including mRNA maturation and protein translation). Spots 5 and 27 were identified as chromodomain-helicase-DNA-binding protein 1 (CHD 1) and eukaryotic translation initiation factor 3 subunit 10 (IF3A), respectively. The CHD 1 expression level was significantly up-regulated in both Hypo and Hypo+T3 gastrocnemius muscles vs Eu (120% and 150% increase, respectively). The IF3A protein level increased progressively through the transition Eu < Hypo < Hypo+T3, the maximal level being reached in Hypo+T3 (88% increase vs Eu) (Figure 3).

Discussion Thyroid hormones are among the most potent modulators of skeletal muscle gene expression, their actions resulting in Journal of Proteome Research • Vol. 6, No. 8, 2007 3191

research articles

Silvestri et al.

Table 2. Differentially Expressed Proteins in Gastrocnemius Muscles of Eu, Hypo, and Hypo+T3 Ratsa ratio spot no.

protein name

protein function

Substrate Metabolism conversion of 2-phospho-d-glycerate P21550 in phosphoenolpyruvate pyruvate kinase muscle isozyme synthesis of phosphoenolpyruvate P11980 pyruvate kinase muscle isozyme P11980 malate dehydrogenase synthesis of oxaloacetate from malate P 14152 malate dehydrogenase P14152 phosphatidylethanolamineATP binding, membrane biogenesis P31044 binding protein triosephosphate isomerase conversion of D-glyceraldehyde P48500 3-phosphate in dihydroxyacetone phosphate Energy Metabolism creatine kinase M-type transfer of phosphate between ATP P00564 and various phosphogens creatine kinase M-type P00564 creatine kinase M-type P00564 ATP synthase beta chain production of ATP from ADP in the P10719 presence of a proton gradient Stress Response heat shock protein 70 stress-induced molecular chaperon Q07439 heat shock protein 27 small HSP with various functions P42930 heat shock protein 20 small HSP with various functions P97541 heat shock protein in 20 P97541 Cell Structure actin alpha muscle contractile apparatus P68136 constituent actin alpha P68136 myosin regulatory light chain 2 phosphorylable chain, typical of P08733 slow-twitch fibers Gene Expression chromodomain-helicase-DNA- sequence-selective DNAP40201 binding protein 1 binding protein eukaryotic translation initiation binds to the 40S ribosome and P23116 factor 3 subunit 10 promotes the binding of methiconyl-tRNAi and mRNA

6 skeletal muscle beta enolase 14 15 29 30 32 33

7 8 18 17

1 10 12 20 4 24 19

5 27

sequence %Pr coverage

Hypo Hypo+T3 Hypo+T3 vs vs vs Eu Hypo Eu

7.2/46894

89.2

37.4

0.7

2.5*

1.7*

7.0/57687 7.0/57687 6.5/36380 6.5/36380 5.7/20670

99.0 100 99.9 100 99.3

52.3 40.4 33.9 34.8 75.4

0.6* 0.3* 1.1 1.1 1.7*

3.3* 3.3* 1.6* 2.0* 0.9

1.7* 1.0* 1.8* 1.7* 1.5*

6.9/26790

100

60.0

0.6*

2.0*

1.2*

accession theoretical no. pI/Mr

7.0/43019

82.2

52.2

0.5*

2.0*

1.1

7.0/43019 7.0/43019 5.3/56354

70.5 58.6 96.1

60.4 45.1 53.7

0.5* 0.6* 3.0*

3.3* 2.0* 0.8*

1.5 1.1 2.2*

5.6/70185 6.5/22893 6.4/17505 6.4/17505

58.2 50.2 99.3 58.7

37.4 43.2 35.1 26.5

1.7* 1.5 3.5* 2.5*

0.5* 2.0* 0.5* 0.5

0.8 3.3* 1.8* 1.7

5.3/42051

99.4

41.4

1.3

1.25

1.40*

5.3/42051 4.9/18749

38.0 48.7

47.7 76.4

1.2 5.5*

1.3 0.7*

1.42* 4.0*

7.4/196411

57.5

10.2

2.2*

1.25

2.5*

6.7/161950

90.0

22.4

1.5

1.25

1.9*

a Identified proteins were grouped into broad functional categories. Total gastrocnemius muscle proteins were extracted, separated by 2D-E, and identified by MALDI-TOF-MS following in-gel digestion with trypsin. The search in the SWISSPROT protein sequence database was performed using Protein Lynx Global Server 2.0 software. At least three matching peptides were required for an identity assignment. “spot no.” refers to spot numbers indicated in Figure 2B. “accession no.” refers to Swiss-Prot accession number. The theoretical Mr and pI are given. %Pr represents the identification probability, and the sequence coverage is given. The differential expression (* indicates P < 0.05 in the Student’s t test) is given as a ratio (e.g., Hypo/Eu). Values were calculated by comparing mean relative intensity (RI) values between spots within the same experiment (representative analysis set, n ) 6).

modified contractile/mechanical and metabolic characteristics.25,26 Almost 400 skeletal muscle genes are known to respond to these hormones in humans,23 and most of them are involved in lipid, carbohydrate, and energy metabolism. In addition, T3 affects muscle fiber characteristics (e.g., modulation of MHC gene expression and isoform profile) in adult skeletal muscles.27-29 By applying a proteomic approach we mapped the in vivo modulation of the gastrocnemius proteome, which is most likely due to overall influences over both gene transcription and the stability and translation of mRNAs and proteins. In the Eu, Hypo, and Hypo+T3 gastrocnemius maps we identified differentially expressed proteins and grouped them into functional categories. The largest fraction of affected proteins (50%) was involved in substrate and energy metabolism. Another important group of modulated proteins was represented by stress-induced proteins (HSPs) (21.4%), while the remaining fraction is implicated in structural features and gene expression (transcription, translation) (each of these two groups representing 14.3% of the identified proteins). A general conclusion that 3192


can be drawn from our findings is that although several proteinexpression levels were clearly affected in one direction by hypothyroidism (up or down vs euthyroidism) and in the opposite direction by T3 administration, others did not follow the same pattern [i.e., changes in the same direction in hypothyroidism and hyperthyroidism (Hypo+T3) or a change in only one state vs euthyroidism]. Indeed, the different influence of low and elevated T3 levels on the amount of a given protein could be explained by (a) thyroid state-associated changes in which T3 has a permissive or cooperative role (in which certain hormones and/or other factors affected by T3 administration may have played a role), (b) T3-dependent changes in which T3 plays the dominant role, and (c) thyroid state-specific modulation of the kinetics of protein synthesis and/or degradation. (i) Substrate Metabolism. Previous studies have suggested that the individual’s thyroid state influences the way insulin affects the rate of glucose metabolism in muscle.30 Three of the differentially expressed proteins we identified were glycolytic enzymes: namely, beta-enolase (ENOB, spot 6), pyruvate


research articles

Figure 3. Examples of differential expression in gastrocnemius muscle proteins (grouped into broad functional categories). Representative subsections of 2D-E images are shown. In each panel bar charts show means ( SD (n ) 6) for relative intensities (RI) of the protein spots obtained for Eu, Hypo, and Hypo+T3 rats. Bars labeled with dissimilar letters are significantly different (P < 0.05).

kinase (KPYM, spots 14 and 15), and triosephosphate isomerase (TPIS, spot 33). In the adult the beta enolase transcripts and subunits accumulate preferentially in fast-twitch fibers, where total enolase activity is high.31-34 In the gastrocnemius muscles of adult rats beta enolase protein levels were increased only following T3 treatment (hyperthyroidism), while pyruvate kinase and triosephosphate isomerase levels were decreased in hypothyroidism and elevated in hyperthyroidism. This is in accordance with (a) a major T3 dependence on pyruvate kinase and triosephosphate isomerase and a general decreased metabolic dependence on glycolysis in hypothyroidism and (b) an increased reliance on glycolysis in hyperthyroidism.30 Because of this an increase in NADH access to the mitochondrial respiratory chain would be expected in hyperthyroidism, and indeed, we found hyperthyroidism to be associated with an increased expression of cytoplasmic malate dehydrogenase (MDHC, spots 29 and 30). Our findings support the idea that the MDHC is not involved in the cellular response to hypothyroidism, possibly reflecting the malate/aspartate shuttle not being down-regulated when muscle energy demands are reduced. This should not be surprising since no significant change occurs in the capacity of the malate/aspartate shuttle in the hypothyroid myocardium, although hyperthyroidism

results in a net stimulation.35 Our data are the first to indicate that this may also be true for skeletal muscle. Phosphatidylethanolamine-binding protein (PEBP, spot 32), a highly conserved 21- to 23-kDa basic protein with preferential affinity in vitro for phosphatidylethanolamine, has been proposed to play a role in membrane biogenesis.36 The PEBP expression level was significantly increased in both hypo- and hyperthyroidism (vs the euthyroid controls). Indeed, both hypothyroid and hyperthyroid muscles undergo structural and metabolic shifts (in comparison with the euthyroid condition) which demand cell remodeling. An increased level of PEBP could reflect such an event in both thyroid states and represent an effect in which not only the absence/presence of T3 but also of other factors may have played a role. (ii) Energy Metabolism. ATP is mostly synthesized in the mitochondria, and its major use in muscle cells is for myofibrillar contraction and ion pumping. The expression level of the ATP synthase beta subunit (ATP B, spot 17) was increased in both hypothyroid and hyperthyroid muscle (vs euthyroid controls), likely suggesting involvement of factors other than solely the absence/presence of T3 in such an effect as in the case of PEBP. The slight decrease in hyperthyroid animals vs hypothyroid ones is in accordance with a negative modulatory Journal of Proteome Research • Vol. 6, No. 8, 2007 3193

research articles effect exerted by T3 on the expression of the ATP synthase beta subunit gene, an effect in which the Sp1 transcription factor37 might act as an intermediary and might underlie the known modulation of oxidative phosphorylation by thyroid hormone.38 Phosphocreatine is known to be the most abundant energy carrier in normal muscle cells (39) with the creatine-kinase/ phosphocreatine circuit being a highly organized energy buffer connecting intracellular sites of energy demand with sites of ATP production.39 The cytosolic creatine kinase (KCRM, spots 7, 8, and 18) level was decreased in hypothyroidism vs both euthyroidism and hyperthyroidism, suggesting a decreased dependence of energy metabolism on the creatine kinase shuttle in hypothyroid muscle. Indeed, the creatine kinase M-type content is much higher in fast-twitch muscle and proportional to the amount of fast MHCs because it controls myosin-ATPase activity and contractile speed by fast rephosphorylation of ADP in the vicinity of the enzyme.40,41 Very recently, moreover, it has been reported that KCRM, TPIS, and KPYM together with other metabolically active proteins are included in the macromolecular complex of the ATP-sensitive K+ (KATP) channel,42 an important cellular metabolic sensor.43,44 Our data, showing a coordinated augmentation by hyperthyroidism of the KCRM, TPIS, and KPYM protein levels, strongly support previously obtained functional data45 and involvement of a T3-dependent modulation of the KATP channel in the response of the skeletal muscle cell to changes in contractile characteristics and the amount of available ATP. (iii) Stress Response. A pivotal role in facilitating cellular processes during muscular adaptation and interaction with several signaling pathways is played by HSP70 (spot 1).46 The expression level of HSP70 was significantly increased in hypothyroid muscle vs both euthyroid and hyperthyroid animals, paralleling the changes in MHC I and supporting a role for HSP70 in the process by which muscle is remodeled to suit the imposed contractile demands.47 We obtained a similar expression pattern (likely T3 dependent) for HSP20 (spots 12 and 20) which, despite not being a heat-inducible HSP, is biologically regulated by several cellular signaling pathways.48 In addition, we identified spot 10 as HSP27, which has been demonstrated to play an important role in smooth muscle cells (actin polymerization, remodeling, and even cross-bridge cycling)49-54 and, moreover, can act as a chaperone in the regulation of contractile-protein activation55 and also combat insulin resistance.56 Compared to its level in euthyroidism, HSP27 expression was significantly increased only in hyperthyroidism, in strict association with the structure-metabolic transition toward glucose utilization. (iv) Cell Structure. T3 modulates expression of the myosin heavy chain (MHC) gene in adult skeletal muscles,27-29 thereby affecting the mechanical as well as metabolic properties of the muscle cell. Indeed, while hypothyroidism was associated with a predominant expression of MHC Ib over MHC IIb, T3 administration reversed the ratio between the two fiber-type isoforms. Each MHC is associated with a regulatory light chain (MLC) of 18-19 kDa (MLC-2) and an essential MLC with an apparent mass of ∼28 kDa (MLC-1).57,58 When compared to the situation in euthyroidism, the expression level of the myosin regulatory light chain 2 (MLRV, spot 19), typical of slow-twitch fibers, was strongly increased in hypothyroidism with hyperthyroidism significantly reducing it (but not restoring it to the euthyroid level). This is in accordance with the predominant expression of MHC Ib in hypothyroidism and its reduced expression in hyperthyroidism. 3194


Silvestri et al.

(v) Gene Expression and Translation Initiation. T3 regulates gene expression by binding to high-affinity thyroid hormone receptors that proceed to activate or repress transcription in response to it.59,60 Recent evidence revealed the ability of the hormone to affect the availability of both nonspecific transcription factors and gene products controlling such post-transcriptional mechanisms as mRNA maturation and protein translation.23,24 Here, we report that both hypothyroidism and hyperthyroidism induced chromodomain-helicase-DNA-binding protein 1 (CHD 1, spot 5) as well as the eukaryotic translation initiation factor 3 subunit 10 (IF3A, spot 27). These proteins play important roles in two different steps in gene expression: (1) initiation of transcription (CHD perhaps being important in gene regulation) and (2) initiation of translation (IF3 being the major protein responsible for correct mRNA positioning and the subsequent initiation of AUG identification by ribosomes).61,62 The stimulatory effects exerted by hyperthyroidism on CHD 1 and IF3A are in line with the data of Clement et al.,23 who in human skeletal muscle reported a T3induced up-regulation of several transcription factors, cofactors, and translation-initiation factors. The similar stimulatory effect exerted by hypothyroidism together with the abovementioned effect on PEBP could underlie the cell-remodeling associated with this thyroid state in which the absence of T3 (and also the presence or absence of other factors) could play a role. Indeed, CHD 1 expression levels are indicative of ongoing transcription, and several factors appear to be induced by both hypo- and hyperthyroidism. Over the past decade or so several different approaches have established the ability of thyroid hormone to modulate certain skeletal muscle genes controlling metabolic homeostasis and energy expenditure as well as the activity of a number of enzymes involved in substrate cycles and a broad range of lipid and carbohydrate metabolic pathways.4,23,25,26,63-68 Within this general scheme the reported changes in the protein-expression profile of skeletal muscle from animals in different thyroid states highlight the influence of thyroid hormone on muscle fiber metabolism and phenotype as it concerns (a) energy usage (ATP disposal, by means of ATP synthase and creatine kinase) and (b) coordination of the expressions of proteins, both contractile (myosin heavy and light chain isoforms) and metabolic (glycolytic enzymes). The mixed-fibered gastrocnemius muscle cell remodels toward slow-type fibers phenotype characterized by a decreased metabolic dependence of energy metabolism on glycolysis and creatine kinase shuttle during hypothyroidism, while it appears to reprogram toward a fasttype fiber-phenotype with an increased reliance on glycolysis and creatine kinase upon T3 complementation. Interestingly, both hypothyroid and hyperthyroid gastrocnemius cells undergo similar modifications in terms of activation of transcription and translation likely associated with membrane biogenesis and cell remodeling.

Conclusion In this study we characterized the in vivo response of the rat gastrocnemius proteome profile to change in the individual’s thyroid state and identified new molecular signatures underlying the pleiotropic effect of thyroid hormone on skeletal muscle physiology. The study provides a starting point for future investigations focused on the protein profile of those subcellular compartments (such as mitochondria) that play a major role in mediating the actions of thyroid hormone. Such future investigations together with previously published data16


and the proteome map and the identified skeletal muscle proteins reported here should allow an “at a glance” evaluation of tissue specificity and also start to contribute to build what we might call a “partial geographic map” of the proteins affected by the thyroid state.

Acknowledgment. This work was supported by grant MIUR-COFIN 2006 Prot 2006051517 References (1) Zurlo, F.; Larson, K.; Bogardus, C.; Ravussin, E. Skeletal muscle metabolism is a major determinant of resting energy expenditure. J. Clin. Invest. 1990, 86 (5), 1423-1427. (2) Lowell, B. B.; Spiegelman, B. M. Towards a molecular understanding of adaptive thermogenesis. Nature 2000, 404 (6778), 652-660. (3) Simonides, W. S.; Thelen, M. H.; van der Linden, C. G.; Muller, A.; van Hardeveld, C. Mechanism of thyroid-hormone regulated expression of the SERCA genes in skeletal muscle: implications for thermogenesis. Biosci. Rep. 2001, 21 (2), 139-154. (4) de Lange, P.; Lanni, A.; Beneduce, L.; Moreno, M.; Lombardi, A.; Silvestri, E.; Goglia, F. Uncoupling protein-3 is a molecular determinant for the regulation of resting metabolic rate by thyroid hormone. Endocrinology 2001, 142 (8), 3414-3420. (5) Vadaszova, A.; Zacharova, G.; Machacova, K.; Jirmanova, I.; Soukup, T. Influence of thyroid status on the differentiation of slow and fast muscle phenotypes. Physiol. Res. 2004, 53 (Suppl 1), S57-S61. (6) Finkelstein, D. I.; Andrianakis, P.; Luff, A. R.; Walker, D. Effects of thyroidectomy on development of skeletal muscle in fetal sheep. Am. J. Physiol. 1991, 261 (5 Pt 2), R1300-R1306. (7) Goglia, F.; Moreno, M.; Lanni, A. Action of thyroid hormones at the cellular level: the mitochondrial target. FEBS Lett. 1999, 452 (3), 115-120. (8) Gaspari, M.; Larsson, N. G.; Gustafsson, G. M. The transcription machinery in mammalian mitochondria. Biochim. Biophys. Acta 2004, 1659 (2-3), 148-152. (9) Scarpulla, R. C. Nuclear control of respiratory gene expression in mammalian cells. J. Cell. Biochem. 2006, 97 (4), 673-683. (10) Wrutniak-Cabello, C.; Casas, F.; Cabello, G. Thyroid hormone action in mitochondria J. Mol. Endocrinol. 2001, 26 (1), 67-77. (11) Koenig, R. J. Thyroid hormone receptor coactivators and corepressors. Thyroid 1998, 8 (8), 703-713. (12) Davis, P. J.; Davis, F. B. Nongenomic actions of thyroid hormone on the heart. Thyroid 2002, 12, 459-446. (13) Nemeth, P. M.; Norris, B. J.; Solanki, L.; Kelly, A. M. Metabolic specialization in fast and slow muscle fibers of the developing rat. J. Neurosci. 1989, 9 (7), 2336-2343. (14) Fountoulakis, M. Proteomics: current technologies and applications in neurological disorders and toxicology. Amino Acids 2001, 21 (4), 363-381. (15) Righetti, P. G.; Castagna, A.; Antonucci, F.; Piubelli, C.; Cecconi, D.; Campostrini, N.; Rustichelli, C.; Antonioli, P.; Zanusso, G.; Monaco, S.; Lomas, L.; Boschetti, E. Proteome analysis in the clinical chemistry laboratory: myth or reality? Clin. Chim. Acta 2005, 357 (2), 123-139. (16) Silvestri, E.; Moreno, M.; Schiavo, L.; de Lange, P.; Lombardi, A.; Chambery, A.; Parente, A.; Lanni, A.; Goglia, F. A proteomics approach to identify protein expression changes in rat liver following administration of 3,5,3′-triiodo-L-thyronine. J. Proteome Res. 2006, 5 (9), 2317-2327. (17) Moreno, M.; Lanni, A.; Lombardi, A.; Goglia, F. How the thyroid controls metabolism in the rat: different roles for triiodothyronine and diiodothyronines. J. Physiol. 1997, 505 (Pt 2), 529-538. (18) Lanni, A.; Moreno, M.; Lombardi, A.; Goglia, F. Calorigenic effect of diiodothyronines in the rat. J. Physiol. (London) 1996, 494, 831-837. (19) Goglia, F. Biological effects of 3,5-diiodothyronine (T(2)). Biochemistry (Mosc) 2005, 70 (2), 164-172. (20) Bouley, J.; Chambon, C.; Picard, B. Mapping of bovine skeletal muscle proteins using two-dimensional gel electrophoresis and mass spectrometry. Proteomics 2004, 4 (6), 1811-1824. (21) Fountoulakis, M.; Langen, H. Identification of proteins by matrixassisted laser desorption ionization-mass spectrometry following in-gel digestion in low-salt, nonvolatile buffer and simplified peptide recovery. Anal. Biochem. 1997, 250 (2), 153-156.

research articles (22) Gelfi, C.; Vigano, A.; De Palma, S.; Ripamonti, M.; Begum, S.; Cerretelli, P.; Wait, R. 2-D protein maps of rat gastrocnemius and soleus muscles: a tool for muscle plasticity assessment. Proteomics 2006, 6 (1), 321-340. (23) Clement, K.; Viguerie, N.; Diehn, M.; Alizadeh, A.; Barbe, P.; Thalamas, C.; Storey, J. D.; Brown, P. O.; Barsh, G. S.; Langin, D. In vivo regulation of human skeletal muscle gene expression by thyroid hormone. Genome Res. 2002, 12 (2), 281-291. (24) Feng, X.; Jiang, Y.; Meltzer, P.; Yen, P. M. Thyroid hormone regulation of hepatic genes in vivo detected by complementary DNA microarray. Mol. Endocrinol. 2000, 14 (7), 947-955. (25) Hausman, G. J.; Watson, R. Regulation of fetal muscle development by thyroxine Acta Anat (Basel). 1994, 149 (1), 21-30. (26) Haddad, F.; Arnold, C.; Zeng, M.; Baldwin, K. Interaction of thyroid state and denervation on skeletal myosin heavy chain expression. Muscle Nerve 1997, 20 (12), 1487-1496. (27) Izumo, S.; Nadal-Ginard, B.; Mahdavi, V. All members of the MHC multigene family respond to thyroid hormone in a highly tissuespecific manner. Science 1986, 231 (4738), 597-600. (28) Kirschbaum, B. J.; Kucher, H. B.; Termin, A.; Kelly, A. M.; Pette, D. Antagonistic effects of chronic low frequency stimulation and thyroid hormone on myosin expression in rat fast-twitch muscle. J. Biol. Chem. 1990, 265 (23), 13974-13980. (29) Caiozzo, V. J.; Herrick, R. E.; Baldwin, K. M. Influence of hyperthyroidism on maximal shortening velocity and myosin isoform distribution in skeletal muscles. Am. J. Physiol. 1991, 261 (2 Pt 1), C285-C295. (30) Dimitriadis, G. D.; Leighton, B.; Parry-Billings, M.; West, D.; Newsholme, E. A. Effects of hypothyroidism on the sensitivity of glycolysis and glycogen synthesis to insulin in the soleus muscle of the rat. Biochem. J. 1989, 257 (2), 369-373. (31) Rider, C. C.; Taylor, C. B. Enolase isoenzymes in rat tissues. Electrophoretic, chromatographic, immunological and kinetic properties. Biochim. Biophys. Acta 1974, 365 (1), 285-300. (32) Ibi, T.; Sahashi, K.; Kato, K.; Takahashi, A.; Sobue, I. Immunohistochemical demonstration of beta-enolase in human skeletal muscle. Muscle Nerve 1983, 6 (9), 661-663. (33) Kato, K.; Shimizu, A.; Semba, R.; Satoh, T. Tissue distribution, developmental profiles and effect of denervation of enolase isozymes in rat muscles. Biochim. Biophys. Acta 1985, 841 (1), 50-58. (34) Merkulova, T.; Dehaupas, M.; Nevers, M. C.; Creminon, C.; Alameddine, H.; Keller, A. Differential modulation of alpha, beta and gamma enolase isoforms in regenerating mouse skeletal muscle. Eur. J. Biochem. 2000, 267 (12), 3735-3743. (35) Ralphe, J. C.; Bedell, K.; Segar, J. L.; Scholz, T. D. Correlation between myocardial malate/aspartate shuttle activity and EAAT1 protein expression in hyper- and hypothyroidism. Am. J. Physiol. Heart Circ. Physiol. 2005, 288 (5), H2521-H256. (36) Frayne, J.; Ingram, C.; Love, S.; Hall, L. Localisation of phosphatidylethanolamine-binding protein in the brain and other tissues of the rat. Cell Tissue Res. 1999, 298 (3), 415-423. (37) Zaid, A.; Li, R.; Luciakova, K.; Barath, P.; Nery, S.; Nelson, B. D. On the role of the general transcription factor Sp1 in the activation and repression of diverse mammalian oxidative phosphorylation genes. J. Bioenerg. Biomembr. 1999, 31 (2), 129-135. (38) Silva, J. E. Thermogenic mechanisms and their hormonal regulation. Physiol. Rev. 2006, 86 (2) 435-64. (39) Wallimann, T.; Wyss, M.; Brdiczka, D.; Nicolay, K.; Eppenberger, H. M. Intracellular compartmentation, structure and function of creatine kinase isoenzymes in tissues with high and fluctuating energy demands: the ‘phosphocreatine circuit’ for cellular energy homeostasis. Biochem. J. 1992, 281 (Pt 1), 21-40. (40) Watchko, J. F.; Daood, M. J.; LaBella, J. J. Creatine kinase activity in rat skeletal muscle relates to myosin phenotype during development. Pediatr. Res. 1996, 40 (1), 53-58. (41) Ventura-Clapier, R.; Kuznetsov, A.; Veksler, V.; Boehm, E.; Anflous, K. Functional coupling of creatine kinases in muscles: species and tissue specificity. Mol. Cell. Biochem. 1998, 184 (1-2), 231247. (42) Dhar-Chowdhury, P.; Harrell, M. D.; Han, S. Y.; Jankowska, D.; Parachuru, L.; Morrissey, A.; Srivastava, S.; Liu, W.; Malester, B.; Yoshida, H.; Coetzee, W. A. The glycolytic enzymes, glyceraldehyde-3-phosphate dehydrogenase, triose-phosphate isomerase, and pyruvate kinase are components of the K(ATP) channel macromolecular complex and regulate its function. J. Biol. Chem. 2005, 280 (46), 38464-38470. (43) Minami, K.; Miki, T.; Kadowaki, T.; Seino, S. Roles of ATP-sensitive K+ channels as metabolic sensors: studies of Kir6.x null mice. Diabetes. 2004, 53 (Suppl 3), S176-S180.

Journal of Proteome Research • Vol. 6, No. 8, 2007 3195

research articles (44) Gong, B.; Legault, D.; Miki, T.; Seino, S.; Renaud, J. M. KATP channels depress force by reducing action potential amplitude in mouse EDL and soleus muscle. Am. J. Physiol. Cell Physiol. 2003, 285 (6), C1464-C1474. (45) Light, P.; Shimoni, Y.; Harbison, S.; Giles, W.; French, R. J. Hypothyroidism decreases the ATP sensitivity of KATP channels from rat heart. J. Membr. Biol. 1998, 162 (3), 217-223. (46) Liu, Y.; Gampert, L.; Nething, K.; Steinacker, J. M. Response and function of skeletal muscle heat shock protein 70. Front Biosci. 2006, 11, 2802-2827. (47) Ogata, T.; Oishi, Y.; Roy, R. R.; Ohmori, H. Endogenous expression and developmental changes of HSP72 in rat skeletal muscles. J. Appl. Phys. 2003, 95 (3), 1279-1286. (48) Fan, G. C.; Chu, G.; Kranias, E. G. Hsp20 and its cardioprotection. Trends Cardiovasc. Med. 2005, 15 (4), 138-141. (49) Negre-Aminou, P.; van Leeuwen, R. E.; van Thiel, G. C.; van den Ijssel, P.; de Jong, W. W.; Quinlan, R. A.; Cohen, L. H. Differential effect of simvastatin on activation of Rac(1) vs. activation of the heat shock protein 27-mediated pathway upon oxidative stress, in human smooth muscle cells. Biochem. Pharmacol. 2002, 64 (10), 1483-1491. (50) Miron, T.; Vancompernolle, K.; Vandekerckhove, J.; Wilchek, M.; Geiger, B. A. 25-kD inhibitor of actin polymerization is a low molecular mass heat shock protein. J. Cell Biol. 1991, 114 (2), 255-261. (51) Lavoie, J. N.; Hickey, E.; Weber, L. A.; Landry, J. Modulation of actin microfilament dynamics and fluid phase pinocytosis by phosphorylation of heat shock protein 27. J. Biol. Chem. 1993, 268 (32), 24210-24214. (52) Bitar KN HSP27 phosphorylation and interaction with actinmyosin in smooth muscle contraction. Am. J. Physiol. Gastrointest. Liver Physiol. 2002, 282 (5), G894-903. (53) Ibitayo, A. I.; Sladick, J.; Tuteja, S.; Louis-Jacques, O.; Yamada, H.; Groblewski, G.; Welsh, M.;Bitar, K. N. HSP27 in signal transduction and association with contractile proteins in smooth muscle cells. Am. J. Physiol. 1999, 277 (2 Pt 1), G445-G454. (54) Gerthoffer, W. T.; Gunst, S. J. Invited review: focal adhesion and small heat shock proteins in the regulation of actin remodeling and contractility in smooth muscle. J. Appl. Phys. 2001, 91 (2), 963-972. (55) Somara, S.; Bitar, K. N. Tropomyosin interacts with phosphorylated HSP27 in agonist-induced contraction of smooth muscle. Am. J. Physiol. Cell Physiol. 2004, 286 (6), C1290-301. (56) McCarty, M. F. Induction of heat shock proteins may combat insulin resistance. Med. Hypotheses 2006, 66 (3), 527-534. (57) Lowey, S.; Risby, D. Light chains from fast and slow muscle myosins. Nature 1971, 234 (5324), 81-85.

3196


Silvestri et al. (58) Rayment, I.; Holden, H. M.; Whittaker, M.; Yohn, C. B.; Lorenz, M.; Holmes, K. C.; Milligan, R. A. Structure of the actin-myosin complex and its implications for muscle contraction. Science 1993, 261 (5117), 58-65. (59) Yen, P. M.; Ando, S.; Feng, X.; Liu, Y.; Maruvada, P.; Xia, X. Thyroid hormone action at the cellular, genomic and target gene levels. Mol. Cell. Endocrinol. 2006, 246 (1-2), 121-127. (60) Flamant, F.; Gauthier, K.; Samarut, J. Thyroid Hormones Signaling Is Getting More Complex: STORMs Are Coming. Mol. Endocrinol. 2006, Jun 8 [Epub ahead of print]. (61) Hershey, J. W. Translational control in mammalian cells. Annu. Rev. Biochem. 1991, 60, 717-755. (62) Johnson, K. R.; Merrick, W. C.; Zoll, W. L.; Zhu, Y. Identification of cDNA clones for the large subunit of eukaryotic translation initiation factor 3. Comparison of homologues from human, Nicotiana tabacum, Caenorhabditis elegans, and Saccharomyces cerevisiae. J. Biol. Chem. 1997, 272 (11), 7106-7113. (63) Moreno, H.; Serrano, A. L.; Santalucia, T.; Guma, A.; Canto, C.; Brand, N. J.; Palacin, M.; Schiaffino, S.; Zorzano, A. Differential regulation of the muscle-specific GLUT4 enhancer in regenerating and adult skeletal muscle. J. Biol. Chem. 2003, 278 (42), 4055740564. (64) Santalucia, T.; Moreno, H.; Palacin, M.; Yacoub, M. H.; Brand, N. J.; Zorzano, A. A novel functional co-operation between MyoD, MEF2 and TRalpha1 is sufficient for the induction of GLUT4 gene transcription. J. Mol. Biol. 2001, 314 (2), 195-204. (65) Queiroz, M. S.; Shao, Y.; Ismail-Beigi, F. Effect of thyroid hormone on uncoupling protein-3 mRNA expression in rat heart and skeletal muscle. Thyroid 2004, 14 (3), 177-185. (66) Moreno, M.; Lombardi, A.; de Lange, P.; Silvestri, E.; Ragni, M.; Lanni, A.; Goglia, F. Fasting, lipid metabolism, and triiodothyronine in rat gastrocnemius muscle: interrelated roles of uncoupling protein 3, mitochondrial thioesterase, and coenzyme Q. FASEB J. 2003, 17 (9), 1112-1114. (67) Silvestri, E.; Moreno, M.; Lombardi, A.; Ragni, M.; de Lange, P.; Alexson, S. E.; Lanni, A.; Goglia, F. Thyroid-hormone effects on putative biochemical pathways involved in UCP3 activation in rat skeletal muscle mitochondria FEBS Lett. 2005, 579 (7), 16391645. (68) dos Santos, R. A.; Giannocco, G.; Nunes, M. T. Thyroid hormone stimulates myoglobin expression in soleus and extensorum digitalis longus muscles of rats: concomitant alterations in the activities of Krebs cycle oxidative enzymes. Thyroid 2001, 11 (6), 545-550.

PR0701299

Thyroid-State Influence on Protein-Expression Profile of Rat Skeletal

Recommend Documents