Transcriptional Inhibition by an Oxidized Abasic Site in DNA

Feb 4, 2006 - Yingli Wang,§ Terry L. Sheppard,§ Silvia Tornaletti,‡ Lauren S. Maeda,‡ and. Philip C. Hanawalt*,‡. Department of Chemistry, Nor...
0 downloads 0 Views 272KB Size
Download PDF
234

Chem. Res. Toxicol. 2006, 19, 234-241

Transcriptional Inhibition by an Oxidized Abasic Site in DNA Yingli Wang,§ Terry L. Sheppard,§ Silvia Tornaletti,‡ Lauren S. Maeda,‡ and Philip C. Hanawalt*,‡ Department of Chemistry, Northwestern UniVersity, 2145 Sheridan Road, EVanston, Illinois 60208-3113, and Department of Biological Sciences, Stanford UniVersity, 385 Serra Mall, Stanford, California 94305-5020 ReceiVed October 20, 2005

2-Deoxyribonolactone (dL) is an oxidized abasic site in DNA that can be induced by γ-radiolysis, ultraviolet irradiation, and numerous antitumor drugs. Although this lesion is incised by AP endonucleases, suggesting a base-excision repair mechanism for dL removal, subsequent excision and repair synthesis by DNA polymerase β is inhibited due to accumulation of a protein-DNA cross-link. This raises the possibility that additional repair pathways might be required to eliminate dL from the genome. Transcription-coupled repair (TCR) is a pathway of excision repair specific to DNA lesions present in transcribed strands of expressed genes. A current model proposes that transcription arrest at the site of DNA damage is required to initiate TCR. In support of this model, a strong correlation between transcription arrest by a lesion in vitro and TCR of the lesion in vivo has been found in most cases analyzed. To assess whether dL might be subject to TCR, we have studied the behavior of bacteriophage T3 and T7 RNA polymerases (T3RNAP, T7RNAP) and of mammalian RNA polymerase II (RNAPII) when they encounter a dL lesion or its “caged” precursor located either in the transcribed or in the nontranscribed strand of template DNA. DNA plasmids containing a specifically located dL downstream of the T3, T7 promoter or the Adenovirus major late promoter were constructed and used for in vitro transcription with purified proteins. We found that both dL and its caged precursor located in the transcribed strand represented a complete block to transcription by T3- and T7RNAP. Similarly, they caused more than 90% arrest when transcription was carried out with mammalian RNAPII. Furthermore, RNAPII complexes arrested at dL were subject to the transcript cleavage reaction mediated by elongation factor TFIIS, indicating that these complexes were stable. A dL in the nontranscribed strand did not block either polymerase. Introduction Cellular DNA damage, which has mutagenic and cytotoxic effects, poses a remarkable threat to the genomic integrity and proper functioning of cells. The apurinic/apyrimidinic (AP or abasic site)1 lesion is a common form of DNA damage, which can arise from spontaneous base depurination (1, 2) or as a result of removal of damaged bases by DNA glycosylases in the base excision repair (BER) pathway (3-5). Repair of AP sites by the BER pathway involves an AP endonuclease or an AP lyase activity to cleave the DNA on the 5′ side of the lesion, a phosphodiesterase and a DNA polymerase to fill the resulting single nucleotide gap, and a DNA ligase to seal the nick (6). 2-Deoxyribonolactone (dL) is an oxidized form of the AP site that may be induced by γ-radiolysis (7), ultraviolet irradiation (8), and numerous toxic agents (9-13). Generation of dL in DNA begins with hydrogen atom abstraction at the C1′ position of deoxynucleotides to produce a C1′ sugar radical. Once formed, the radical species may undergo one of several oxygenation pathways, which results in the production of the oxidized abasic site (11, 14-19). * To whom correspondence should be addressed. Tel., 650-723-2424; fax, 650-725-1848; e-mail, [email protected]. § Northwestern University. ‡ Stanford University. 1 Abbreviations: AP site, apurinic/apyrimidinic site; dL, 2-deoxyribonolactone; CPD, cyclobutane pyrimidine dimers; BER, base excision repair; TCR, transcription-coupled repair; T3RNAP, T3 RNA polymerase; T7RNAP, T7 RNA polymerase; RNAPII, RNA polymerase II; TFIIS, transcription factor IIS; AdMLP, Adenovirus major late promoter.

Similar to AP sites, dL is mutagenic in Escherichia coli, yielding mainly single-base substitutions (20, 21), and it is recognized, although less efficiently than AP sites, by AP endonucleases, suggesting a BER pathway for dL removal (22). However, subsequent gap filling by human DNA polymerase β is inhibited due to formation of a protein-DNA cross-link with the dL lesion (23-25). dL also forms protein cross-links with E. coli endonuclease III, and the butenolide β-elimination product of dL can covalently bind to E. coli formamidopyrimidine DNA glycosylase and human endonuclease VIII (24). The covalent cross-linking of dL lesions to BER proteins suggests that alternative repair pathways might be required for dL removal from the genome. Transcription-coupled repair (TCR) is an excision repair pathway that specifically removes lesions from transcribed strands of expressed genes. Although the detailed mechanism of TCR has not been clarified, the original and still current model for TCR proposes that the arrest of RNA polymerase at the lesion site is the signal to recruit the TCR machinery to the lesion (26). The arrested RNA polymerase is then released or reverse-translocated from the lesion site, with subsequent repair of the lesion by the nucleotide excision repair proteins (27, 28). In support of this model, a correlation between RNAP arrest at a lesion in vitro and TCR of that lesion in vivo has been documented in most cases analyzed (29, 30). As a first step to investigate whether dL might be subject to TCR, we have analyzed the behavior of bacteriophage T3 and T7 RNA polymerase (T3RNAP, T7RNAP) and of mammalian RNA polymerase II (RNAPII) when they encounter dL or its

10.1021/tx050292n CCC: $33.50 © 2006 American Chemical Society Published on Web 02/04/2006

Transcriptional Inhibition by 2-Deoxyribonolactone

Chem. Res. Toxicol., Vol. 19, No. 2, 2006 235 Table 1. Oligonucleotides Used in This Study

Scheme 1. Synthesis of DNA Oligonucleotides Containing a dL Lesion

a

caged precursor in the transcribed or the nontranscribed strand of template DNA. Because of the lability of the dL lesion to alkaline conditions, which causes this lesion to undergo DNA strand scission more rapidly than an AP site (31-34), dL cannot be incorporated directly into DNA using traditional phosphoramidite chemistry. For this reason, we (34, 35) and others (15, 18, 20, 34-36) have developed methods to introduce dL lesions within oligonucleotides starting from stable photocaged dL precursors, which generate dL upon UV photolysis. Using this approach, we constructed DNA templates containing a dL lesion or its caged precursor in the transcribed or the nontranscribed strand and carried out in vitro transcription using bacteriophage T3RNAP, T7RNAP, or mammalian RNAPII. We found that when a dL lesion was located in the transcribed strand, it constituted an absolute block to T3- and T7RNAP transcription. Similarly, it caused more than 90% arrest by RNAPII. A dL lesion in the nontranscribed strand was completely bypassed by all three polymerases. Addition of transcription elongation factor IIS (TFIIS), which is required to resume transcription elongation by RNAPII beyond natural arrest sites (37), produced transcripts shorter than those corresponding to RNAPII arrested at dL, indicating that the RNAPII complexes arrested at dL were stable. Because RNA polymerase arrest at a lesion is thought to initiate TCR of that lesion, our finding that dL is a strong block to RNAP progression suggests that TCR may offer a plausible DNA repair pathway in vivo for dL lesions in expressed genes.

Experimental Procedures Proteins and Reagents. BamHI and ClaI restriction endonucleases were purchased from New England Biolabs. RNAPII, transcription initiation factors, and elongation factor TFIIS, purified from rat liver or recombinant sources as described previously (38), were obtained from Dr. Daniel Reines. T4 polynucleotide kinase and T4 DNA ligase were from Invitrogen. E. coli strain MV1184 was a gift of Dr. Joachim Messing (Rutgers University, Piscataway, NJ). Phagemid pBK-CMV was obtained from Stratagene. D44 IgG anti-RNA antibodies (39) were purified from rodent ascites fluid as described previously (40). T3 and T7 RNA polymerase, highly purified NTPs, and radiolabeled nucleotides were purchased from Amersham Pharmacia Biotech. Formalin-fixed Staphylococcus aureus was obtained from CalBiochem. Custom DNA oligonucleotides used to construct undamaged templates for RNAPII transcription were obtained from Qiagen. DNA Templates for T3 and T7 Transcription. Oligonucleotides containing a photocaged dL lesion were synthesized and purified as described previously (34) (Scheme 1). Undamaged DNA oligonucleotides were purchased from Integrated DNA Technologies (IDT). Oligonucleotides pL5, pL6, pL5b, and pL6b (15 µM) (Table 1) were incubated at 37 °C for 3 h with 150 U T4 polynucleotide kinase in a 100 µL reaction containing 10 mM Trisacetate, 10 mM magnesium acetate, 50 mM potassium acetate, and 0.4 mM ATP. The resulting 5′-phosphorylated DNA oligonucleotides were purified by reverse-phase HPLC (RP-HPLC) using a Waters series 600 HPLC and an XTerra RP C-18 column (3.5 µm, 4.6 mm × 50 mm). Oligonucleotides pL5 and pL6 were purified

name

sequence (5′ f 3′)a

pL5 pL6 pL7 pL5b pL6b pL7b

CGATATGGATAGACTAGAG GATCCTCTAGTCTATCCATAT ATCGGCGCCGGCGGTGTG CGATATGGAXAGACTAGAG GATCCTCTAGTCXATCCATAT ATCGGCGCCGXCGGTGTG

X indicates the location of a caged or dL lesion.

with an acetonitrile gradient (12-17% and 15-20%, respectively) in 0.1 M triethylammonium acetate buffer, pH 7.3, at a flow rate of 1 mL/min over 40 min, and oligonucleotides pL5b and pL6b were purified with an acetonitrile gradient (17-22% and 20-25%, respectively) in 0.1 M triethylammonium acetate buffer, pH 7.3, at a flow rate of 1 mL/min over 20 min. Peaks were monitored at 254 nm. Oligonucleotide-containing fractions were collected and lyophilized to dryness using a Speedvac concentrator. To generate DNA substrates containing a caged or a dL lesion in the transcribed or the nontranscribed strand for T3 and T7 transcription, a BamHI/ClaI fragment from phagemid pBK-CMV (50 nM) was incubated with a 10-fold excess of 5′-phosphorylated DNA duplexes pL5b/pL6, pL5/pL6b, and pL5/pL6 and 400 U of T4 DNA ligase in a 20 µL reaction containing 50 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 10 mM DTT, 1 mM ATP, and 25 µg/mL BSA at 16 °C for 16 h. Recombinant phagemids were purified by phenol extraction, desalted by NAP-5 column (Amersham), and concentrated on a Speedvac concentrator. The dL lesion in the plasmid was generated by irradiation of recombinant plasmid (30 ng/µL, 100 µL) at 350 nm in 10 mM HEPES buffer (pH 7.5) for 30 min as described (35). Conversion of the caged dL into the decaged dL lesion was assayed by piperidine treatment as described previously (41). T3 and T7 Transcription. DNA templates used in transcription reactions with T3RNAP and T7RNAP consisted of ClaI- or BamHIlinearized plasmids constructed as described above. Each recombinant plasmid (200 ng for T3RNAP and 300 ng for T7RNAP transcription assays) was incubated at 37 °C for 20 min with 2.5 U ClaI or BamHI in a 5 µL reaction mixture containing 40 mM HEPES, pH 7.5, 15 mM MgCl2, 5 mM DTT, and 0.1 mg/mL BSA. The transcription reactions were carried out in a 10 µL mixture containing linearized plasmid, 5 U of T3 RNAP or 10 U of T7 RNAP, 0.4 mM NTPs, [R-32P]UTP (3000 Ci/mmole), 40 mM HEPES, pH 7.5, 15 mM MgCl2, 5 mM DTT, and 0.1 mg/mL BSA. The reactions were incubated at 37 °C for 20 min and quenched with an equal volume of 2× Gel Loading Buffer (2× GLB; 50% (v/v) glycerol, 0.1 M EDTA, 1% (w/v) SDS, 0.1% (w/v) bromophenol blue, and 0.1% (w/v) xylene cyanol). Samples were heatdenatured and electrophoresed through a 20% denaturing polyacrylamide gel (dPAGE, 29:1 acrylamide/bisacrylamide; 8 M urea, 89 mM Tris, 89 mM borate, and 1 mM Na2EDTA) in Tris-borateEDTA (89 mM Tris, 89 mM borate, and 1 mM Na2EDTA). The transcripts were visualized and quantified by PhosphorImager analysis. RNA ladders (49, 58, 67, and 104 nt) were generated by in vitro transcription with T3RNAP using as template a mixture of DNA fragments obtained by digesting phagemid pBK-CMV with restriction endonucleases BamHI, EcoRI, HindIII, and ClaI. DNA Templates for RNAPII Transcription. DNA templates used for transcription reactions with RNAPII consisted of HindIIIlinearized plasmid DNA containing a single caged or a single decaged dL lesion downstream of the Adenovirus major late promoter (AdMLP) (Figure 1B). Because of the lability of dL at 37 °C (34) (with an approximate half-life of 32 h for dL:T and of 38 h for dL:G), the HindIII restriction digest was limited to 15 min at 37 °C, immediately followed by purification of the linearized plasmid using a QIAquick PCR purification kit (Qiagen) and transcription assay. When a sample of the dL-containing supercoiled plasmid DNA was incubated in parallel with the restriction digest and the transcription assay, approximately 10% was converted into nicked form, indicating that most of the dL-containing plasmid used in the transcription assay had not undergone strand scission.

236 Chem. Res. Toxicol., Vol. 19, No. 2, 2006

Wang et al.

Figure 1. DNA substrates used in this study. (A) DNA substrates LT2 and LT3, used for T3 and T7 transcription; (B) DNA substrate used for RNAPII transcription. DNA templates for T3, T7, and RNAPII transcription, each containing a single caged or decaged dL in the transcribed strand downstream of the T3, T7, or AdMLP promoter, were constructed as described under Experimental Procedures. Numbers in parentheses indicate nucleotide positions in the DNA sequences. The transcription start site (+1) is represented by a bent arrow. Full-length runoff RNA (RO) and RNA resulting from transcription arrest at the dL site (L) are marked by lines along with their expected lengths.

Covalently closed circular DNA containing a single caged dL on either the transcribed or the nontranscribed strand was generated by priming 10 µg of plus strand of pUCG-TS or pUCG-NTS (42) with a 5-fold molar excess of pL7b oligonucleotide (Table 1) phosphorylated at the 5′-end in a 300 µL reaction mixture containing 10 mM Tris-HCl (pH 7.9); 50 mM NaCl; 10 mM MgCl2; 1 mM DTT; 600 µM each of dATP, dCTP, dTTP, and dGTP; 1 mM ATP; 30 U T4 DNA polymerase; and 5 U of T4 DNA ligase. Covalently closed circular molecules were purified after electrophoresis at 4 °C in an agarose gel containing 0.3 µg/mL ethidium bromide. Under our conditions, covalently closed circular DNA migrated as supercoiled DNA and could be resolved from single-stranded closed circular and nicked double-stranded plasmids. To generate DNA plasmids containing the dL lesion either in the transcribed or in the nontranscribed strand, the caged dLcontaining plasmids (30 ng/µL, 100 µL) were irradiated at 350 nm in 10 mM HEPES buffer (pH 7.5) for 30 min as described (35). The presence of the lesion was confirmed by piperidine treatment as described (41). RNAPII Transcription Reactions. DNA templates were incubated for 30 min at 28 °C with rat liver protein fractions D (2 µg, containing TFIID and TFIIH) and rat liver RNAPII (0.5 µg) in a 20 µL mixture containing 20 mM HEPES-NaOH, pH 7.9, 20 mM

Tris-HCl, pH 7.9, 2.2% poly(vinyl alcohol), 212 units RNasin, 0.5 mg/mL acetylated BSA, 150 mM KCl, 2 mM DTT, and 3% glycerol. After incubation, 33 µL of a solution containing fraction B (1 µg, containing TFIIF and TFIIE) and recombinant rat TFIIB (3 ng) in the same buffer without KCl were added, and incubation continued for 20 min at 28 °C to form preinitiation complexes. To the solution, 7 mM MgCl2, 20 µM ATP, 20 µM UTP, and 0.8 µM of [R-32P]CTP (800 Ci/mmol) were added, and incubation was continued for 20 min. Elongation proceeds until RNAPII reaches nucleotide 15, at which point the first GTP is required for incorporation. Heparin was added to prevent further initiation, and then 800 µM each of ATP, CTP, UTP, and GTP was added to allow elongation to continue, typically for 15 min. Elongation complexes were immunoprecipitated with D44 anti-RNA antibodies and formalin-fixed S. aureus and then washed three times in reaction buffer containing 20 mM Tris-HCl, pH 7.9, 3 mM HEPES-NaOH, pH 7.9, 60 mM KCl, 0.5 mM EDTA, 2 mM DTT, 0.2 mg/mL acetylated BSA, and 2.2% (w/v) poly(vinyl alcohol). Washed complexes were resuspended in 60 µL of reaction buffer for further treatment. For TFIIS-mediated transcript cleavage, arrested complexes were incubated with TFIIS for 1 h at 28 °C in 60 µL of reaction buffer containing 7 mM MgCl2 followed by incubation for 15 min at 28 °C in the presence of 800 µM NTPs. Reactions

Transcriptional Inhibition by 2-Deoxyribonolactone

Chem. Res. Toxicol., Vol. 19, No. 2, 2006 237

were stopped with SDS and proteinase K, and nucleic acids were precipitated with ethanol. Samples were resuspended in formamide loading dye, heat-denatured, and electrophoresed through a 6% polyacrylamide gel in TBE with 8.3 M urea. Gels were dried and autoradiographed using intensifying screens.

Results Preparation of DNA Templates for Bacteriophage T3- and T7RNAP Transcription. DNA templates containing a single dL lesion in the transcribed or nontranscribed strand downstream of the T3 or T7 promoter were constructed by ligation of photocaged dL-containing DNA oligonucleotides (Table 1) into pBK-CMV, a phagemid that carries T3 and T7 promoters in opposite orientations (Figure 1A). To generate caged dL oligonucleotides pL5b and pL6b (Table 1), a caged dL analogue was incorporated into DNA oligonucleotides by solid-phase DNA synthesis. The dL analogue was incorporated at position 10 of sequence pL5 and at position 13 in pL6. Undamaged oligonucleotides were prepared based on the same sequences of pL5 and pL6, but replacing the dL site with a thymidine (34) (Scheme 1). The 5′-terminus of DNA oligonucleotides pL5, pL6, pL5b, and pL6b was phosphorylated by T4 polynucleotide kinase followed by purification of the 5′phosphorylated DNA oligonucleotides by RP-HPLC. Characterization of the undamaged and lesion-containing oligonucleotides was carried out by matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) as described (35). To construct phagemid LT2 (Figure 1A), which contains a single photocaged dL lesion in the transcribed strand at position +58 downstream of the T3 promoter, and phagemid LT3, which contains a single photocaged dL lesion in the transcribed strand at position +56 downstream of the T7 promoter, DNA duplex pL5b/pL6 or pL5/pL6b was ligated to a BamHI-ClaI DNA fragment from phagemid pBK-CMV. Similarly, DNA duplex pL5/pL6 was ligated to a BamHI-ClaI DNA fragment from phagemid pBK-CMV to generate undamaged plasmid LT1. The photocaged dL-containing plasmids LT2 and LT3 were then UV-irradiated at 350 nm to convert the photocaged dL lesion into dL as described (34). The presence of the dL lesion in the transcription substrates was confirmed by piperidine treatment as described (41). Effect of a Single dL Lesion in the Transcribed or Nontranscribed Strand of Template DNA on Transcription Elongation by Bacteriophage T3- and T7RNAP. ClaI- or BamHI-linearized plasmids containing a caged dL or a dL lesion either in the transcribed or in the nontranscribed strand downstream of the T3 or the T7 promoter were used to carry out transcription reactions under the conditions described in Experimental Procedures. The transcription products were resolved by electrophoresis on a 20% denaturing polyacrylamide gel followed by visualization and quantitation of the RNA using a Phosphorimaging device. T3RNAP transcription of a BamHI/ ClaI DNA fragment from pBK-CMV, the phagemid used as a vector to clone the dL-containing sequences, produced a 49 nt transcript, as expected (Figure 2, lane 2). Transcription of the undamaged ClaI-linearized plasmid LT1 produced a 68 nt fulllength RNA transcript (lane 3). Transcripts synthesized from T3RNAP transcription of ClaI-digested LT3 or dLT3, which contain a caged dL lesion (lane 6) or a dL lesion (lane 7) on their nontranscribed strands, had similar gel mobility as the fulllength transcripts (68 nt), indicating that the presence of either a caged dL or a decaged dL lesion in the nontranscribed strand had no effect on T3RNAP transcription. However, when

Figure 2. T3 transcriptional arrest by a single caged dL lesion and a single decaged dL lesion. Templates were transcribed in vitro such that transcripts were labeled with 32P as described in the text. RNA was then isolated and electrophoresed through a 20% polyacrylamide gel. Lane 1, RNA marker; lane 2, BamHI/ClaI double-digested phagemid pBK-CMV; lane 3, unadducted templates; lane 4, templates containing a single caged dL in the transcribed strand (LT2); lane 5, templates containing a single decaged dL in the transcribed strand (dLT2); lane 6, templates containing a single caged dL in the nontranscribed strand (LT3); lane 7, templates containing a single decaged dL in the nontranscribed strand (dLT3); RO, full-length runoff transcript; L, transcript arrested at dL. The position and length of the RNA ladder is indicated at the left. TS, transcribed strand; NTS, nontranscribed strand.

T3RNAP transcription was carried out using ClaI-digested LT2 or dLT2 plasmids, which contain a caged dL lesion (lane 4) or a dL lesion (lane 5) on their transcribed strands, transcripts shorter than the full-length product were observed. These transcripts migrated at a similar position as the 58 nt RNA marker, indicating that they were extended up to the dL lesion site. These results indicate that both the caged and decaged dL lesion when located in the transcribed strand are complete blocks to T3RNAP transcription. T7RNAP transcription of a BamHI/ClaI DNA fragment from pBK-CMV produced a transcript with similar gel mobility as the 49 nt RNA marker, as expected from its size of 48 nt (Figure 3, lane 3). Transcription of the undamaged LT1 template produced a full-length transcript, as determined by comparison with a 67 nt RNA marker (lane 4). Similar to the T3RNAP transcription experiments described above, when transcription was carried out using plasmids LT3 and dLT3 as substrates, which contained a caged (lanes 6) or decaged dL (lane 7) in the transcribed strand, transcripts shorter than the full-length RNA were generated. Comparison of the migration of these RNAs with that of the RNA marker indicated that they were extended up to the site of the lesion. In contrast, full-length transcripts were obtained in the transcription experiments using LT2 and dLT2 (lanes 4 and 5, respectively), which contained lesions on nontranscribed strands. These results further confirmed that dL lesions affect transcription only when they are located in the transcribed strand of template DNA. Effect of a Single dL Lesion in the Transcribed or Nontranscribed Strand of Template DNA on Transcription Elongation by Mammalian RNAPII. DNA substrates containing a single dL lesion in the transcribed or the nontranscribed strand downstream of the AdMLP (Figure 1B) were constructed as described previously (42). The presence of the lesion in either strand was confirmed by treatment with piperidine (41), which generates a single strand break at the site of the lesion (data not shown). To study the effect of dL on transcription elongation

238 Chem. Res. Toxicol., Vol. 19, No. 2, 2006

Wang et al.

Figure 3. T7 transcriptional arrest by a single caged dL lesion and a single decaged dL lesion. Templates were transcribed in vitro and analyzed as described in the legend to Figure 2. Lane 1, RNA marker; lanes 2, BamHI/ClaI double-digested phagemid pBK-CMV; lane 3, unadducted templates; lane 4, templates containing a single caged dL in the nontranscribed strand (LT2); lane 5, templates containing a single decaged dL in the nontranscribed strand (dLT2); lane 6, templates containing a single caged dL in the transcribed strand (LT3); lane 7, templates containing a single decaged dL in the transcribed strand (dLT3).

by mammalian RNAPII, we utilized an in vitro-reconstituted system containing purified RNAPII and initiation factors (43). In this transcription system, repair of the lesion cannot occur due to lack of repair proteins. RNAPII was stalled at position 15 downstream of the AdMLP (Figure 1B) after synthesis of a short RNA labeled with [R-32P]CTP. This was followed by addition of heparin to prevent further initiation so that the transcription products would represent a single promoterdependent elongation event. All four NTPs were then added to allow elongation to continue. The effect of dL on transcription elongation was monitored as formation of shorter transcripts compared with those observed with the undamaged template. We found that when a dL lesion was located in the transcribed strand, more than 90% of transcripts produced after RNAPII transcription were shorter than the full-length RNA present in the control (Figures 4 and 5, lanes 2, 4, and 5). Comparison of the migration of these RNAs with that of a 10 bp DNA ladder indicated that they corresponded to transcripts of ∼183 nt, indicating that they had been extended up to the site of the lesion. In contrast, when a dL lesion was in the nontranscribed strand, it was completely bypassed by RNAPII (Figures 4 and 5, lane 7). TFIIS-Mediated Transcript Cleavage of RNAPII Complexes Arrested at dL Lesion. Transcription elongation factor IIS is required to transcribe past various impediments encountered by RNAPII during the normal process of transcription (37). TFIIS induces cleavage of a short RNA from the 3′-end of the nascent transcript to position the new 3′-end of the RNA into the catalytic site of the polymerase so that transcription can resume. To determine whether the RNAPII transcription complex arrested at a dL lesion was subject to the TFIIS mediatedtranscript cleavage reaction, immunopurified complexes were incubated with elongation factor TFIIS and magnesium, followed by separation of the resulting transcription products on polyacrylamide gels. We found that TFIIS-induced cleavage of transcripts arrested at a caged (Figure 4, lane 3) or at a decaged dL (Figure 5, lane 3) produced transcripts of discrete lengths, shortened to ∼25 nt. In the presence of nucleoside triphosphates, these transcripts could be re-elongated up to the site of the lesion (Figures 4 and 5, lane 4).

Figure 4. RNAPII transcriptional arrest by a single caged dL lesion. Lanes 1 and 6, unadducted templates (C); lanes 2-5, templates containing a single caged dL in the transcribed strand; lane 7, template containing a single caged dL in the nontranscribed strand; templates were transcribed in vitro such that transcripts were labeled with 32P as described in the text. Elongation was allowed for 15 min (lane 2) or 2 h (lane 5), after addition of NTPs to the reaction mixture. Transcription complexes arrested at a single caged dL were immunopurified and incubated without (lanes 2 and 5) or with (lane 3) 5 ng of elongation factor TFIIS and MgCl2 for 1 h at 28 °C. Lane 4, same as lane 3, except that NTPs were added, followed by incubation for 15 min at 28 °C. RNA was then isolated and electrophoresed through a 5% polyacrylamide gel. Transcripts arrested at a caged dL are indicated by L. RO, full-length runoff transcript; M, 10 bp ladder.

Discussion We have analyzed the effect of a single dL on transcription elongation by bacteriophage T3RNAP and T7 RNAP and by mammalian RNAPII purified from rat liver, using a reconstituted in vitro transcription system with purified proteins. We found that the presence of this lesion in the transcribed strand downstream of the T3 or the T7 promoter completely arrested transcription by T3- or T7RNAP. Similarly, a dL was a very strong block to RNAPII elongation, causing more than 90% arrest. Furthermore, RNAPII complexes arrested at dL were subject to the transcript-cleavage reaction mediated by TFIIS, indicating that these complexes were stable. After addition of NTPs, they could resume elongation to produce transcripts extended up to the lesion site. When dL was in the nontranscribed strand, complete bypass of the lesion was observed. As described in earlier studies, a natural AP site located in the transcribed strand affected T7RNAP transcription. Furthermore, this effect was modulated by the sequence context (44, 45). SP6 and E. coli RNA polymerases only transiently paused at AP sites, with subsequent readthrough (46). Tetrahydrofuran, a stable AP site analogue, did not affect human RNAP II elongation when transcription was initiated from a C-tailed template in the absence of general transcription factors (47), suggesting that differences in the source of RNAP and/or of transcription systems might play a role in the extent of lesion bypass.

Transcriptional Inhibition by 2-Deoxyribonolactone

Figure 5. RNAPII transcriptional arrest by a single decaged dL lesion. Lanes 1 and 6, unadducted templates (C); lanes 2-5, templates containing a single decaged dL in the transcribed strand; lane 7, template containing a single decaged dL in the nontranscribed strand; templates were transcribed in vitro such that transcripts were labeled with 32P as described in the text. Elongation was allowed for 15 min (lane 2) or 2 h (lane 5), after addition of NTPs to the reaction mixture. Transcription complexes arrested at a single decaged dL were immunopurified and incubated without (lanes 2 and 5) or with (lane 3) 5 ng of elongation factor TFIIS and MgCl2 for 1 h at 28 °C. Lane 4, same as lane 3, except that NTPs were added, followed by incubation for 15 min at 28 °C. RNA was then isolated and electrophoresed through a 5% polyacrylamide gel. Transcripts arrested at a decaged dL are indicated by L. RO, full-length runoff transcript; M, 10 bp ladder.

In agreement with our findings on transcriptional inhibition, dL is also a strong block to DNA polymerase progression (48). It was found that M-MuLV reverse transcriptase did not incorporate any dNMP opposite dL, while the Klenow fragment of E. coli DNA polymerase, deficient in exonuclease activity incorporated dAMP > dGMP . dTMP ∼ dCMP opposite the lesion. Similarly, AP sites block in vitro DNA synthesis to varying degrees, (49), depending on the sequence context and DNA polymerase processivity (50, 51). Structurally, dL resembles a natural AP site (52). High-field NMR has shown that oligonucleotides containing an AP site opposite a purine residue maintain a right-handed geometry, in which the base opposite the lesion and the AP site stack inside the helix (52-55). When the AP site was opposite a pyrimidine, however, additional conformational flexibility was observed. Furthermore, the neighboring bases flanking the AP site did influence its conformation with respect to the helix (56). A direct structural comparison between an oligonucleotide containing a dL and another containing tetrahydrofuran in the same sequence context further substantiated the view that these two lesions are structurally similar (52). However, dL is recognized and repaired less efficiently than an AP site by AP endonucleases (57, 58), suggesting that the local DNA conformation at regular and oxidized abasic sites could affect how these lesions are recognized by repair enzymes. dL is recognized, although less efficiently, by repair enzymes that repair regular abasic sites, such as endonuclease IV and

Chem. Res. Toxicol., Vol. 19, No. 2, 2006 239

exonuclease III (22). However, subsequent excision by DNA polymerase β is impaired, with accumulation of stable proteinDNA cross-links (23). dL also cross-links to the lysine residue (Lys120) of E. coli Nth, an enzyme involved in the lyase step of AP repair, and to other BER enzymes (25). Therefore, dL residues may not be readily repaired by short-patch BER but may require alternative modes of repair. TCR is a specialized repair pathway that removes lesions from transcribed strands of expressed genes. Although TCR was first described for lesions repaired by nucleotide excision repair, it was subsequently reported that it also acts on oxidative damage, repaired by base excision repair (59, 60). However, a thymine glycol or an 8-oxoG in the transcribed strand does not significantly block RNAPII transcription (42, 61-63). We have proposed that additional factors might be required to elicit transcription arrest, if these oxidative lesions are to initiate TCR in vivo. However, when we added the mismatch recognition protein complex MSH2-MSH6, which has been shown to associate with 8-oxoG in DNA, we did not observe any change in the extent of RNAPII blockage at 8-oxoG, suggesting that the MSH2-MSH6 complex is likely not involved in the initial steps of TCR of 8-oxoG (42). It is still possible that in the presence of other mismatch repair proteins different results might be obtained. Interestingly, it was reported that oxidative stress-induced lesions block transcription in an MLH1-dependent manner (64). This may suggest that MLH1 might be needed to stabilize MSH2-MSH6 complexes at sites of some lesions to cause blockage of transcription. An alternative possibility is that intermediates in the repair of oxidative damage, such as natural abasic sites or dL, might be sufficient to block RNAPII transcription (60). The ability of dL to cause RNAPII arrest and of RNAPII complexes arrested at dL to undergo transcript cleavage mediated by elongation factor TFIIS indicate that dL may be subject to TCR in vivo. Acknowledgment. We thank Ann K. Ganesan and C. Allen Smith for helpful discussions and critical reading of this manuscript. This work was supported by Grant CA-77712 to S.T. and P.C.H. from the National Cancer Institute. T.L.S. is the recipient of a Burroughs Wellcome Fund New Investigator Award in Toxicology.

References (1) Lindahl, T., and Nyberg, B. (1972) Rate of depurination of native deoxyribonucleic acid. Biochemistry 11, 3610-3618. (2) Lindahl, T. (1993) Instability and decay of the primary structure of DNA. Nature 362, 709-715. (3) Lindahl, T. (2000) Suppression of spontaneous mutagenesis in human cells by DNA base excision-repair. Mutat. Res. 462, 129-135. (4) David, S. S., and Williams, S. D. (1998) Chemistry of glycosylases and endonucleases involved in base-excision repair. Chem. ReV. 98, 1221-1262. (5) Ide, H. (2001) DNA substrates containing defined oxidative base lesions and their application to study substrate specificities of base excision repair enzymes. Prog. Nucleic Acid Res. Mol. Biol. 68, 207222. (6) Lindahl, T., and Wood, R. D. (1999) Quality control by DNA repair. Science 286, 1897-1905. (7) Carter, K. N., and Greenberg, M. M. (2003) Independent generation and study of 5,6-dihydro-2′-deoxyuridin-6-yl, a member of the major family of reactive intermediates formed in DNA from the effects of γ-radiolysis. J. Org. Chem. 68, 4275-4280. (8) Urata, H., and Akagi, M. (1991) Photo-induced formation of the 2-deoxyribonolactone-containing nucleotide for d(ApCpA); effects of neighboring bases and modification of deoxycytidine. Nucleic Acids Res. 19, 1773-1778. (9) Kappen, L. S., and Goldberg, I. H. (1989) Identification of 2-deoxyribonolactone at the site of neocarzinostatin-induced cytosine release in the sequence d(AGC). Biochemistry 28, 1027-1032.

240 Chem. Res. Toxicol., Vol. 19, No. 2, 2006 (10) Perrin, D. M., Mazumder, A., and Sigman, D. S. (1996) Oxidative chemical nucleases. Prog. Nucleic Acid Res. Mol. Biol. 52, 123-151. (11) Chen, T., and Greenberg, M. M. (1998) Model studies indicate that copper phenanthroline induces direct strand breaks via β-elimination of the 2′-deoxyribonolactone intermediate observed in enediyne mediated DNA damage. J. Am. Chem. Soc. 120, 3815-3816. (12) Pitie, M., Bernadou, J., and Meunier, B. (1995) Oxidation at carbon1′ of DNA deoxuriboses by the Mn-TMPyP/KHSO5 system results from a cytochrome P-450-type hydroxylation reaction. J. Am. Chem. Soc. 117, 2935-2936. (13) Neyhart, G. A., Cheng, C. C., and Thorp, H. H. (1995) Kinetics and mechanism of the oxidation of sugars and nucleotides by oxoruthenium(IV): model studries for predcting cleavage patterns in polymeric DNA and RNA. J. Am. Chem. Soc. 117, 1463-1471. (14) Meijler, M. M., Zelenko, O., and Sigman, D. S. (1997) Chemical mechanism of DNA scission by (1,10-phenanthroline)copper. Carbonyl oxygen of 5-methylenefuranone is derived from water. J. Am. Chem. Soc. 119, 1135-1136. (15) Tronche, C., Goodman, B. K., and Greenberg, M. M. (1998) DNA damage induced via independent generation of the radical resulting from formal hydrogen atom abstraction from the C1′-position of a nucleotide. Chem. Biol. 5, 263-271. (16) Tallman, K. A., Tronche, C., Yoo, D. J., and Greenberg, M. M. (1998) Release of superoxide from nucleoside peroxyl radicals, a doubleedged sword? J. Am. Chem. Soc. 120, 4903-4909. (17) Greenberg, M. M. (1998) Investigating nucleic acid damage processes via independent generation of reactive intermediates. Chem. Res. Toxicol. 11, 1235-1248. (18) Chatgilialoglu, C., and Gimisis, T. (1998) Fate of the C-1′ peroxyl radical in the 2′-deoxyuridine system. Chem. Commun. 1249-1250. (19) Emanuel, C. J., Newcomb, M., Ferreri, C., and Chatgilialoglu, C. (1999) Kinetics of 2′-deoxyuridin-1′-yl radical reactions. J. Am. Chem. Soc. 121, 2927-2928. (20) Faure, V., Constant, J.-F., Dumy, P., and Saparbaev, M. (2004) 2′Deoxyribonolactone lesion produces G f A transitions in Escherichia coli. Nucleic Acids Res. 32, 2937-2946. (21) Kroeger, K. M., Jiang, Y. L., Kow, Y. W., Goodman, M. F., and Greenberg, M. M. (2004) Mutagenic effects of 2-deoxyribonolactone in Escherichia coli. An abasic lesion that disobeys the A-rule. Biochemistry 43, 6723-6733. (22) Greenberg, M. M., Weledji, Y. N., Kim, J., and Bales, B. C. (2004) Repair of oxidized abasic sites by exonuclease III, endonuclease IV, and endonuclease III. Biochemistry 43, 15217-15222. (23) DeMott, M. S., Beyret, E., Wong, D., Bales, B. C., Hwang, J.-T., Greenberg, M. M., and Demple, B. (2002) Covalent trapping of human DNA polymerase β by the oxidative DNA lesion 2-deoxyribonolactone. J. Biol. Chem. 277, 7637-7640. (24) Kroeger, K. M., Hashimoto, M., Kow Yoke, W., and Greenberg, M., M. (2003) Cross-linking of 2-deoxyribonolactone and its β-elimination product by base excision repair enzymes. Biochemistry 42, 24492455. (25) Ide, H., and Kotera, M. (2004) Human DNA glycosylases involved in the repair of oxidatively damaged DNA. Biol. Pharm. Bull. 27, 480-485. (26) Mellon, I., Bohr, V. A., Smith, C. A., and Hanawalt, P. C. (1986) Preferential DNA repair of an active gene in human cells. Proc. Natl. Acad. Sci. U.S.A. 83, 8878-8882. (27) Hanawalt, P. C. (1994) Transcription-coupled repair and human disease. Science 266, 1957-1958. (28) Svejstrup, J. Q. (2002) Mechanisms of transcription coupled repair. Nat. ReV. Mol. Cell Biol. 3, 21-29. (29) Tornaletti, S., and Hanawalt, P. C. (1999) Effect of DNA lesions on transcription elongation. Biochimie 81, 139-146. (30) Scicchitano, D. A., Olesnicky, E. C., and Dimitri, A. (2004) Transcription and DNA adducts: what happens when the message gets cut off? DNA Repair 3, 1537-1548. (31) Goyne, T. E., and Sigman, D. S. (1987) Nuclease activity of 1,10phenanthroline-copper ion. Chemistry of deoxyribose oxidation. J. Am. Chem. Soc. 109, 2846-2848. (32) Lindahl, T., and Andersson, A. (1972) Rate of chain breakage at apurinic sites in double-stranded deoxyribonucleic acid. Biochemistry 11, 3618-3623. (33) Roupioz, Y., Lhomme, J., and Kotera, M. (2002) Chemistry of the 2-deoxyribonolactone lesion in oligonucleotides: cleavage kinetics and products analysis. J. Am. Chem. Soc. 124, 9129-9135. (34) Zheng, Y., and Sheppard, T. L. (2004) Half-life and DNA strand scission products of 2-deoxyribonolactone oxidative DNA damage lesions. Chem. Res. Toxicol. 17, 197-207. (35) Lenox, H. J., McCoy, C. P., and Sheppard, T. L. (2001) Site-specific generation of deoxyribonolactone lesions in DNA oligonucleotides. Org. Lett. 3, 2415-2418.

Wang et al. (36) Kotera, M., Bourdat, A. G., Defrancq, E., and Lhomme, J. (1998) A highly efficient synthesis of oligodeoxyribonolactone lesion. J. Am. Chem. Soc. 120, 11810-11811. (37) Wind, M., and Reines, D. (2000) Transcription elongation factor SII. BioEssays 22, 327-336. (38) Gu, W., and Reines, D. (1995) Identification of a decay in transcription potential that results in elongation factor dependence of RNA polymerase II. J. Biol. Chem. 270, 11238-11244. (39) Eilat, D., Hochberg, M., Fischel, R., and Laskov, R. (1982) Antibodies to RNA from autoimmune NZB/NZW mice recognize a similar antigenic determinant and show a large idiotypic diversity. Proc. Natl. Acad. Sci. U.S.A. 79, 3818-3822. (40) Reines, D. (1991) RNA polymerase II elongation complex. Elongation complexes purified using an anti-RNA antibody do not contain initiation factor alpha. J. Biol. Chem. 266, 10510-10517. (41) Xu, Y.-j., DeMott Michael, S., Hwang Jae, T., Greenberg, M. M., and Demple, B. (2003) Action of human apurinic endonuclease (Ape1) on C1′-oxidized deoxyribose damage in DNA. DNA Repair 2, 175185. (42) Tornaletti, S., Maeda, L. S., Kolodner, R. D., and Hanawalt, P. C. (2004) Effect of 8-oxoguanine on transcription elongation by T7 RNA polymerase and mammalian RNA polymerase II. DNA Repair 3, 483494. (43) Donahue, B. A., Yin, S., Taylor, J.-S., Reines, D., and Hanawalt, P. C. (1994) Transcript cleavage by RNA polymerase II arrested by a cyclobutane pyrimidine dimer in the DNA template. Proc. Natl. Acad. Sci. U.S.A. 91, 8502-8506. (44) Chen, Y. H., and Bogenhagen, D. F. (1993) Effects of DNA lesions on transcription elongation by T7 RNA polymerase. J. Biol. Chem. 268, 5849-5855. (45) Hatahet, Z., Purmal, A. A., and Wallace, S. S. (1994) Oxidative DNA lesions as blocks to in vitro transcription by phage T7 RNA polymerase. Ann. N.Y. Acad. Sci. 726, 346-348. (46) Zhou, W., and Doetsch, P. W. (1993) Effects of abasic sites and DNA single-strand breaks on prokaryotic RNA polymerases. Proc. Natl. Acad. Sci. U.S.A. 90, 6601-6605. (47) Kuraoka, I., Endou, M., Yamaguchi, Y., Wada, T., Handa, H., and Tanaka, K. (2003) Effects of endogenous DNA base lesions on transcription elongation by mammalian RNA polymerase II. Implications for transcription-coupled DNA repair and transcriptional mutagenesis. J. Biol. Chem. 278, 7294-7299. (48) Berthet, N., Roupioz, Y., Constant, J. F., Kotera, M., and Ledss, J. L. (2001) Translesional synthesis on DNA templates containing the 2′deoxyribonolactone lesion. Nucleic Acids Res. 29, 2725-2723. (49) Hatahet, Z., and Wallace, S. S. (1997) in DNA Damage and Repair (Nickoloff, J., and Hoekstra, M., Eds.) pp 229-262, Humana Press, Inc., Totowa, NJ. (50) Shibutani, S., Takeshita, M., and Grollman, A. (1997) Translesional synthesis on DNA templates containing a single abasic site. A mechanistic study of the “A” rule. J. Biol. Chem. 272, 13916-13922. (51) Hatahet, Z., Zhou, M., Reha-Krantz, L. J., Ide, H., Morrical, S. W., and Wallace, S. S. (1999) In vitro selection of sequence contexts which enhance bypass of abasic sites and tetrahydrofuran by T4 DNA polymerase holoenzyme. J. Mol. Biol. 286, 1045-1057. (52) Jourdan, M., Garcia, J., Defrancq, E., Kotera, M., and Lhomme, J. (1999) 2′-Deoxyribonolactone lesion in DNA: refined solution structure determined by nuclear magnetic resonance and molecular modeling. Biochemistry 38, 3985-3995. (53) Kalnik, M. W., Chang, C. N., Johnson, F., Grollman, A. P., and Patel, D. J. (1989) NMR studies of abasic sites in DNA duplexes: deoxyadenosine stacks into the helix opposite acyclic lesions. Biochemistry 28, 3373-3383. (54) Cuniasse, P., Fazakerley, G. V., Guschlbauer, W., Kaplan, B. E., and Sowers, L. C. (1990) The abasic site as a challenge to DNA polymerase. A nuclear magnetic resonance study of G, C and T opposite a model abasic site. J. Mol. Biol. 213, 303-314. (55) Hoehn, S. T., Turner, C. J., and Stubbe, J. (2001) Solution structure of an oligonucleotide containing an abasic site: evidence for an unusual deoxiribose conformation. Nucleic Acids Res. 29, 3413-3423. (56) Wang, K. Y., Parker, S. A., Goljer, I., and Bolton, P. H. (1997) Solution structure of a duplex DNA with an abasic site in a dA tract. Biochemistry 36, 11629-11639. (57) Povirk, L. F., and Goldberg, I. H. (1985) Endonuclease-resistant apyrimidinic sites formed by neocarzinostatin at cytosine residues in DNA: evidence for a possible role in mutagenesis. Proc. Natl. Acad. Sci. U.S.A. 82, 3182-3186. (58) Haring, M., Rudiger, H., Demple, B., Boiteux, S., and Epe, B. (1994) Recognition of oxidized abasic sites by repair endonucleases. Nucleic Acids Res. 22, 2010-2015. (59) Le Page, F., Kwoh, E. E., Avrutskaya, A., Gentil, A., Leadon, S. A., Sarasin, A., and Cooper, P. K. (2000) Transcription-coupled repair of 8-oxoguanine: requirement for XPG, TFIIH, and CSB and implications for Cockayne syndrome. Cell 101, 159-171.

Transcriptional Inhibition by 2-Deoxyribonolactone (60) Bregeon, D., Doddridge, Z. A., You, H. J., Weiss, B., and Doetsch, P. W. (2003) Transcriptional mutagenesis induced by uracil and 8-oxoguanine in Escherichia coli. Mol. Cell 12, 959-970. (61) Tornaletti, S., Maeda, L. S., Lloyd, D. R., Reines, D., and Hanawalt, P. C. (2001) Effect of thymine glycol on transcription elongation by T7 RNA polymerase and mammalian RNA polymerase II. J. Biol. Chem. 276, 45367-45371. (62) Kathe, S. D., Shen, G. P., and Wallace, S. S. (2004) Single-stranded breaks in DNA but not oxidative DNA base damages block transcriptional elongation by RNA polymerase II in HeLa cell nuclear extracts

Chem. Res. Toxicol., Vol. 19, No. 2, 2006 241 [erratum appears in (2004) J. Biol. Chem. 279(26), 27830]. J. Biol. Chem. 279, 18511-18520. (63) Larsen, E., Kwon, K., Coin, F., Egly, J. M., and Klungland, A. (2004) Transcription activities at 8-oxoG lesions in DNA. DNA Repair 3, 1457-1468. (64) Yanamadala, S., and Ljungman, M. (2003) Potential role of MLH1 in the induction of p53 and apoptosis by blocking transcription on damaged DNA templates. Mol. Cancer Res. 1, 747-754.

TX050292N