Transcriptomic Identification and Expression of Starch and Sucrose

(16) Starch biosynthesis is probably best studied in Arabidopsis leaves, potato tubers, and maize endosperm.(12, 17, 18) .... Because there is a limit...
0 downloads 9 Views 4MB Size
Download PDF
Article pubs.acs.org/JAFC

Transcriptomic Identification and Expression of Starch and Sucrose Metabolism Genes in the Seeds of Chinese Chestnut (Castanea mollissima) Lin Zhang,† Qing Lin,† Yanzhi Feng,§ Xiaoming Fan,† Feng Zou,† De-Yi Yuan,† Xiaochun Zeng,#,⊥ and Heping Cao*,# †

Key Laboratory of Cultivation and Protection for Non-Wood Forest Trees, Ministry of Education, Central South University of Forestry and Technology, 498 South Shaoshan Road, Changsha, Hunan Province 410004, People’s Republic of China § China Paulownia Research Center, 3 Weiwu Road, Zhengzhou, Henan Province 450003, People’s Republic of China # Southern Regional Research Center, Agricultural Research Service, U.S. Department of Agriculture, 1100 Robert E. Lee Boulevard, New Orleans, Louisiana 70124, United States ABSTRACT: The Chinese chestnut (Castanea mollissima) seed provides a rich source of carbohydrates as food and feed. However, little is known about starch biosynthesis in the seeds. The objectives of this study were to determine seed composition profiles and identify genes involved in starch and sucrose metabolism. Metabolite analysis showed that starch was the major component and rapidly accumulated during seed endosperm development. Amylopectin was approximately 3-fold of amylose content in chestnut starch. Illumina platform-based transcriptome sequencing generated 56671 unigenes in two cDNA libraries from seed endosperms collected at 45 and 75 days after flowering (DAF). A total of 1537 unigenes showed expression differences ≥2-fold in the two stages of seeds including 570 up-regulated and 967 down-regulated unigenes. One hundred and fifty-two unigenes were identified as involved in starch and sucrose metabolism, including 1 for glycogenin glucosyltransferase, 4 for adenylate transporter (brittle1-type), 3 for ADP-glucose pyrophosphorylase (AGP, not brittle2- or shrunken2-type), 3 for starch synthase (SS), 2 for starch branching enzyme, 5 for starch debranching enzyme, 11 for sucrose synthase, and 3 for sucrosephosphate synthase. Among them, 58 unigenes showed a ≥2-fold expression difference between the 45 and 75 DAF seeds including 11 up- and 47 down-regulated unigenes. The expression of 21 unigenes putatively coding for major enzymes in starch and sucrose metabolism was validated by qPCR using RNA from five seed stages. Expression profiles and correlation analysis indicated that the mRNA levels of AGP (large and small subunits), granule-bound SS2, and soluble SS1 and SS4 were wellcorrelated with starch accumulation in the seeds. This study suggests that the starch biosynthesis pathway in Chinese chestnut is similar to that of potato tuber/Arabidopsis leaf and differs from that of maize endosperm. The information provides valuable metabolite and genetic resources for future research in starch and sucrose metabolism in Chinese chestnut tree. KEYWORDS: Chinese chestnut (Castanea mollissima), next generation sequencing, quantitative real-time PCR, starch synthesis, sucrose metabolism, transcriptome, unigene

■

Ventura.5 Chestnut starch has been studied to understand the modifications on structure and digestibility induced by cooking and, specifically, by the Maillard reaction.6 Significant amounts of polyphenols such as gallic acid and ellagic acid are present in the nuts, which have positive effects on human health.1 Polyphenolic compounds from chestnut skin tissue exhibit strong α-amylase inhibitory activity that may be derived from oligomeric proanthocyanidins with gallic acid and ellagic acid.7 Chestnut extract has been shown to play a significant role in the gastric tolerance improvement of Lactobacillus acidophilus, probably due to hydrophobic peptides or oligopeptides that may impart a marked resistance to simulated gastric juice.8 Cultivars of various chestnut species share several common sensory attributes, but differ in intensity ratings of six descriptors. Of these attributes, sweetness has

INTRODUCTION Chinese chestnut (Castanea mollissima Mill.) is a member of the Fagaceae family native to China, Taiwan, and Korea. The tree is widely cultivated in eastern Asia. Over 300 cultivars have been selected for nut production. The nuts are rich in nutrients and used as an important starch food in rural diets. Chestnut wood also provides economical value for construction. Chestnuts are good for human health as an alternative gluten-free flour source and also a rich source of other beneficial compounds.1 Starch is the major metabolite in chestnuts.2,3 Native chestnut starch has a type B pasting profile similar to that of corn starch but with a lower gelatinization and peak viscosity temperatures; these properties make native chestnut starch a potential technological alternative to corn starch, especially in applications where lower processing temperatures are needed.4 Chestnut cultivars show high heterogeneity in sugar profiles in Portuguese chestnut (Castanea sativa Mill.), a closely related species. Sucrose is the main sugar in cultivars Aveleira, Judia, and Longal, but glucose is more prevalent in cultivar Boa © 2014 American Chemical Society

Received: Revised: Accepted: Published: 929

October 30, 2014 December 10, 2014 December 22, 2014 December 22, 2014 DOI: 10.1021/jf505247d J. Agric. Food Chem. 2015, 63, 929−942

Journal of Agricultural and Food Chemistry

Article

was required for sample collection because the trees were publicly owned, and the field studies did not involve protected species. Seed Composition Analysis. The seed endosperms were dried in an 80 °C oven. Each dried sample was ground into fine powder with a homogenizer followed by filtration through a 0.5 mm filter before being used for seed composition analyses. Soluble sugar content was determined by the colorimetric Anthrone method.27,28 Starch (amylose and amylopectin) content was determined by dualwavelength spectroscopy with wavelength scans of the amylose− iodine and amylopectin−iodine complexes at 450−800 nm in a spectrophotometer (DU 800 Beckman Coulter).3 Protein content was determined according to the Kjeldahl method based on nitrogen released after strong acid digestion.29 Oil was extracted from powders by using the Soxhlet extraction method according to the standard protocol of “Determination of crude fat in foods” (State Standard of the People’s Republic of China, GB/T 14772-2008).29 RNA Isolation. For cDNA library construction and transcriptome sequencing, total RNA was isolated from frozen endosperms of developmental seeds collected at 45 DAF (corresponding to the beginning of starch synthesis peak phase) and 75 DAF (corresponding to the end of starch synthesis peak phase) using a PureLink RNA Mini Kit (Life Technologies, USA). For qPCR analyses, all five stages of seed endosperms were used for RNA extraction using a Microto-Midi Total RNA Purification System according to the manufacturer’s protocols (Life Technologies). The quality and quantity of the purified RNA samples were characterized initially by agarose gel electrophoresis and NanoDrop ND1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) and further assessed by RNA Integrity Number (RIN) and rRNA ratio using an Agilent 2100 Bioanalyzer (Santa Clara, CA, USA) as described.30 These RNA isolation kits resulted in high-quality RNA preparations with RIN larger than eight (data not shown). cDNA Library Construction. Poly-A containing mRNA was purified from 2 μg of total RNA using oligo (dT) magnetic beads and fragmented into 200−500 bp pieces with divalent cations at 94 °C for 5 min using a similar procedure for tung tree seed transcriptome cDNA library construction.31 The mRNA fragments were reverse transcribed into first-strand cDNA using SuperScript II reverse transcriptase and random primers (Life Technologies). After doublestranded cDNA synthesis, fragments were end-repaired and A-tailed. The final cDNA library was created by purifying and enriching the double-stranded cDNA by PCR. Unigene Assembly and Analysis. The cDNA sequencing was performed using a paired-end flow cell with an Illumina Solexa HiSeq 2000 Sequencing System (Biomarker Technologies Co.). Clean DNA sequencing reads were de novo assembled using Trinity with default K-mers = 25.32 The contigs without ambiguous bases were obtained by conjoining the K-mers in an unambiguous path. The clean reads were mapped back to contigs using Trinity to construct unigenes with the paired-end information. This program detected contigs from the same transcript as well as the distances between these contigs. Finally, the contigs were connected with Trinity, and sequences that could not be extended on either end were defined as unigenes for each library. Finally, the two sets of unigenes were integrated into one set of unigenes using the BLAST-Like Alignment Tool (http://genome.ucsc. edu/cgi-bin/hgBlat). The Kyoto Encyclopedia of Genes and Genomes (KEGG) protein databases were used to annotate unigenes using InterProScan software.33 KEGG annotation was used initially to identify unigenes in starch and sucrose metabolism and glycosyltransferase pathways. Because there is a limitation of using bacterially derived KEGG maps for unigene annotation, a keyword search was performed to identify additional unigenes related to starch and sucrose metabolism. Digital Analysis of Differentially Expressed Genes in Two Seed Developmental Stages. To compare differences in gene expression, tag frequencies of both libraries were analyzed by IDEG6 software (http://telethon.bio.unipd.it/bioinfo/IDEG6/) according to the method described by Audic and Claverie.34 The false discovery rate (FDR) was used to determine the threshold P value for multiple testing. Calculation of unigene expression used the reads per kilobase

been associated with consumer acceptance and can be promoted in the marketplace.9 Plant starches are synthesized by several enzymatic reactions.10−12 ADP-glucose (ADPG) pyrophosphorylase (AGP) (also called glucose-1-phosphate adenyltransferase [EC 2.7.7.27]) activities generate a major source of the glucosyl donor ADPG for starch biosynthesis.13−15 Starch synthase (SS) including soluble SS (SSS) [EC 2.4.1.21] and granule-bound SS (GBSS) [EC 2.4.1.242] add glucosyl units at the nonreducing end of linear chains through new α(1→4) linkages. Starch branching enzyme (SBE) (also called 1,4-αglucan branching enzyme [EC 2.4.1.18]) introduces branch linkages in the starch by cleaving interior α(1→4) bonds and forming a new glycoside bond between the C1 reducing end of the released glucan and a C6 within an adjoining linear chain. Starch debranching enzyme (SDBE) including isoamylase [EC 3.2.1.68] and pullulanase [EC 3.2.1.41] hydrolyzes branch linkages and is needed for creation of normal branching patterns in amylopectin. Multiple isoforms exist for each enzyme, although their specific roles in starch biosynthesis generally are not known.16 Starch biosynthesis is probably best studied in Arabidopsis leaves, potato tubers, and maize endosperm.12,17,18 Maize (Zea mays) contains at least five different genes coding for SS,19 three genes coding for SBE,20 and two genes coding for SDBE.21 In addition, ADPG is transported from the cytosol into amyloplasts by the adenylate transporter/adenylate translocator (ANT) coded for by the brittle1 gene in maize endosperm.15,22 Starch biosynthesis has not been studied in chestnut. One study identified a homologue of Arabidopsis DSP4 (SEX4) involved in starch degradation in chestnut that was induced in response to cold and accumulated in stem amyloplasts during winter.23 New technologies such as transcriptome and microarray have been used to uncover the genes involved in chestnut blight infection. A number of genes have been identified and characterized by comparative transcriptomes of American chestnut (Castanea dentata) and Chinese chestnut (Castanea mollissima) in response to the chestnut blight infection.24 This technology has provided insightful information for chestnut resistance to blight disease.25 cDNA microarray has also been used to monitor transcriptional responses of the chestnut blight fungus Cryphonectria parasitica to infection by virulence-attenuating hypoviruses.26 However, there is no molecular level study of starch biosynthesis and sucrose metabolism in chestnut tree. This study evaluated metabolite profiles and identified genes coding for enzymes in starch and sucrose metabolism by transcriptome and quantitative real-time polymerase chain reaction (qPCR).

■

MATERIALS AND METHODS

Plant Materials. Chinese chestnut (Castanea mollissima Mill.) cultivar ‘Yanshanzaofeng’ was used in this study. The plants were planted in Qianxi county, Tangshan city, Hebei province, China. Chestnut fruits were collected from three 8-year-old trees at five developmental stages (30, 45, 60, 75, and 90 days after flowering, DAF). To ensure the same developmental stages of the seeds from different trees, we conducted controlled pollination on the three trees. Three chestnut fruits were removed from each of the south, east, west, and north directions of each tree, resulting in a total of 12 fruits per developmental stage per tree. Seeds were taken out of the fruits, and the seed coat and skin were removed. The endosperm was wrapped with silver paper and stored in liquid nitrogen immediately until being used for RNA extraction and metabolite analyses. No specific permit 930

DOI: 10.1021/jf505247d J. Agric. Food Chem. 2015, 63, 929−942

931

C1Ug19275 C1Ug22044 C1Ug31955 C1Ug36303 C1Ug38445 C1Ug39763 C1Ug41090 C1Ug41228 C1Ug41886 C1Ug42679 C1Ug43056 C1Ug44159 C1Ug46084 C2Ug23382 C2Ug24779 C2Ug24961 C2Ug26944 C2Ug29276 C2Ug29836 C2Ug30790 C2Ug31317 C2Ug31919

A B C D E F G H I J K L M N O P Q R S T U REF

sucrose synthase [EC 2.4.1.13] pectinesterase [EC 3.1.1.11] sucrose synthase [EC 2.4.1.13] trehalose-phosphatase [EC 3.1.3.12] ADP-glucose pyrophosphorylase, large subunit [EC 2.7.7.27] α,α-trehalose-phosphate synthase [EC 2.4.1.15 UDP-glucuronate 4-epimerase [EC 5.1.3.6] soluble starch synthase [EC 2.4.1.21] sucrose synthase [EC 2.4.1.13] β-fructofuranosidase [EC 3.2.1.26] β-1,4-D-xylan synthase [EC 2.4.2.24] α-amylase [EC 3.2.1.1] α-glucosidase [EC 3.2.1.20] sucrose synthase [EC 2.4.1.13] pectinesterase [EC 3.1.1.11] pectinesterase [EC 3.1.1.11] soluble starch synthase [EC 2.4.1.21] sucrose synthase [EC 2.4.1.13] ADP-glucose pyrophosphorylase, small subunit [EC 2.7.7.27] soluble starch synthase [EC 2.4.1.21] α-amylase [EC 3.2.1.1] elongation factor 1-α2 (EF1-α2)

annotation AFW99069.1 XP_007013011.1 AGV22113.1 XP_008238210.1 XP_002313036.1 EXB54073.1 XP_004138968.1 XP_008230773.1 AGV22112.1 XP_007024490.1 XP_007051035.1 AHL44839.1 XP_006468478.1 XP_007035651.1 XP_006828586.1 XP_008235120.1 XP_008234756.1 AGV22111.1 XP_002524583.1 XP_008230284.1 P17859.1 FK868440

reference no. GACACCCTTGGACAGTATGAGAGT GGCGACCCTAATCGTGAAATG TTCGTCATAGCCAGCACATAC GAGGAAGAGGTTCAATAGGGTAA CCTCAATCGCCACATTTCAC ATTGGCGTGATAAAGTAGTGTT ACTGGCTCCGCTGGCTTCA CTTGGAGATGTTGCTGGTGCTT ACTGGTGGGCAGGTTGTTTAT ATGGTTGCTGGTCAGGTTC GTGGGGAATGTCTACTGTTTGTGAA ACACTCGTTATTGTGATGGC GGGGTTACAAGAATGTGGCTGAC TTGTTGTGGTTGGCGGTTAC TGTAATCACAGCCCAAGGTC AGCACATTGTATTATGCCGAGTA GCTCCATTAGTGCTTCCATTG ATGAATCGAGCACGTAATGG TTACTTGTATGACGGTTACTGGG ACAGTGGACATAATGCTTCCTTTC CTCCTTCTCAATCTGCTGCTA TGACGCCCTTGACCAGAT

forward primer (5′−3′) CACAATGTTGAACCTAGGATCGAA CGGAGCCATCAATGAAGGTAA CGTTGATGCCTGAAACTACTC GAATCCGATGAGGTCAGAGTT AACCACTTCATTCCTGCTTCC TGATGTATGGGAACTGCTGAC GGCTTGTCTGGCACGCTTC CTTCCGAACTCCTGTATCTTGG AGGAGTCGGGTGACAATGA AAGGTATGGGTCAGAGAGATT TTGGGTTGCGAAGGTTTGGA CCCGATTTCAGTCTTTAGC GGGAAGTTGATGGGATGAAGG TACGAGCACGGTTCATTTGG TTTGTGGGTAAGGTTGAAGGT AGCCAGCAAGAAGTTAGCCAC GCTTGCGTGCCAGTCATT CAAGTGGCAAATGTAGGAAGG GGGTTGGGTGTAGATAGGAGAT TGAGATGCCTGAAACTAACCC CAACGGCTTTAATTCCTTTCT GGGACAGTTCCAATACCACCA

reverse primer (5′−3′) 105 151 118 133 114 148 126 117 122 131 143 137 139 147 101 138 78 140 133 144 141 102

amplicon (bp)

A−U represent the sample ID of unigene analyzed by qPCR and correspond to those listed in Figure 3 and Table 5. REF represents the reference gene used for qPCR assays. bC and U represent the initials of “chestnut” and “unigene” followed by the ID of the unigene identified in the Chinese chestnut transcriptomes.

a

unigene IDb

IDa

Table 1. Unigenes and Sequences of 22 Primer Pairs for qPCR Analysis

Journal of Agricultural and Food Chemistry Article

DOI: 10.1021/jf505247d J. Agric. Food Chem. 2015, 63, 929−942

Journal of Agricultural and Food Chemistry

Article

per million mapped reads (RPKM) method.35 FDR 1 (or RPKM ratio more/less than 2-fold) were used as the threshold to determine significant differences in gene expression. Quantitative Real-Time PCR Analysis of Gene Expression in Five Seed Developmental Stages. The expression patterns of 21 unigenes mostly in the starch and sucrose metabolism pathway in developing Chinese chestnut seeds were studied by qPCR using the SYBR Green method essentially as described in Cao and Shockey.36 Elongation factor 1-α2 (EF1-α2) (C2Ug31919) was used as the reference gene (primer sequences were identical between Chinese chestnut unigene C2Ug31919 and Portuguese chestnut GenBank accession no. FK868440). PCR primers were designed with “Primer Express” software as used previously.30 The names and primer sequences of the 22 unigenes are listed in Table 1. The qPCR assay was carried out with three replicates in each reaction using the Bio-Rad CFX system (Bio-Rad). PCR was performed in a 20 μL volume containing 2 μL of diluted cDNA, 250 nM of each primer and 1× SYBR Premix Ex TaqII (TaKaRa). The results were analyzed using the comparative Cq method, which uses an arithmetic formula, 2−ΔΔCq, to obtain results for relative quantification.37 The significant difference of 2−ΔΔCq among the different stages of seeds was analyzed using Duncan’s multiple-range test with IBM SPSS Statistics 20.0. The correlation between gene expression levels and starch content was analyzed using the method of Pearson correlation coefficient with IBM SPSS Statistics 20.0.

■

RESULTS Metabolite Profiles during Fruit Development in Chinese Chestnut Tree. During the developmental stages from 30 to 90 days after flowering, water contents in the fruits collected at 30, 45, 60, 75, and 90 DAF were 82.67 ± 3.23, 75.38 ± 1.12, 66.88 ± 2.30, 60.34 ± 2.21, and 52.89 ± 1.81%, respectively. Whereas water content in the nuts was gradually decreased, the dry mass of the chestnut fruits was rapidly increased from 0.5 to >4 g per fruit, an increase of 7.6-fold (Figure 1A). The increase of dry mass in the fruit was primarily due to starch accumulation in the endosperm (Figure 1B). The amylose portion of starch was increased 32.8-fold by weight (Figure 1B) and 5-fold by ratio (Figure 1C), whereas the amylopectin portion of starch was increased 22.9-fold by weight (Figure 1B) and 3-fold by ratio (Figure 1C). Amylopectin was the major component of starch with approximately 2−3 times the amylose content in the endosperm (Figure 1B). Other metabolites in the endosperm were also increased by weight (6.3-fold for soluble sugars, 4.3-fold for proteins, and 3.6-fold for lipids) (Figure 1B), but their ratios in the endosperm were decreased accordingly until 75 DAF followed by a slight increase at 90 DAF at the expense of amylose in the seeds (Figure 1C). Identification of Starch and Sucrose Metabolism Genes in Chestnut Seed Transcriptome. RNA was extracted from chestnut seed endosperms collected at 45 and 75 DAF to achieve a broad survey of genes associated with seed development. These RNAs were reverse transcribed into cDNAs and sequenced by an Illumina paired-end sequencing platform. De novo assembly of Chinese chestnut seed transcriptomes generated a total of 56671 nonredundant unigenes (complete transcriptome analysis to be published elsewhere). Pathway-based analysis using KEGG annotation identified 6323 unigenes involved in 302 pathways (data not shown). The default starch and sucrose metabolism pathway contained 141 unigenes including 136 annotated unigenes (Table 2), 2 unannotated unigenes, and 3 unigenes with

Figure 1. Developmental profiles of dry mass, soluble sugars, amylose, amylopectin, protein, and lipid contents in Chinese chestnut endosperm: (A) dry mass accumulation in developmental nuts; (B) major metabolite accumulation in developmental nuts; (C) composition profiles in developmental nuts (% of dried endosperm).

undetectable RPKM value in the seed transcriptomes (data not shown). Examination of the unigene list in the KEGG annotated starch and sucrose metabolism pathway revealed that a significant number of known enzymes and transporters were not included in the pathway. Therefore, we manually searched additional unigenes with keywords in the glucosyltransferase family and the whole unigene databases. Glucosyltransferase family contained one unigene (C1Ug17153) coding for glycogenin glucosyltransferase (GLG) [EC.2.4.1.186] and four unigenes (C2Ug23993, C1Ug17740, C1Ug26954 and C1Ug98040) coding for GBSS in the seed transcriptomes (Table 2). Manual search was also used to identify if chestnut transcriptomes contained orthologues of maize Brittle1-type ADPG transporter and Brittle2/Shrunken2-type cytosolic AGP.15,22,38,39 Keyword search of the annotated chestnut unigene database with “brittle” resulted in 4 unigenes related to “brittle1” of grape (C1Ug30622, C1Ug33748 and C1Ug29007) and castor bean (C1Ug39668) (Table 2) but none with “brittle2.” Keyword search with “shrunken” did not yield any unigene. Additional keyword search of the annotated unigene database with “isoamylase” and “pullulanase” resulted in the identification of two unigenes for isoamylase-type (C1Ug44378 and C1Ug45762) and three unigenes for pullulanase-type (C1Ug30670, C2Ug20485 and C1Ug22898) of starch debranching enzyme in Chinese chestnuts (Table 2). Manual 932

DOI: 10.1021/jf505247d J. Agric. Food Chem. 2015, 63, 929−942

Journal of Agricultural and Food Chemistry

Article

Table 2. Identification and Expression of 152 Starch and Sucrose Metabolism Unigenes in the Chinese Chestnut Endosperm Transcriptomes

933

DOI: 10.1021/jf505247d J. Agric. Food Chem. 2015, 63, 929−942

Journal of Agricultural and Food Chemistry

Article

Table 2. continued

934

DOI: 10.1021/jf505247d J. Agric. Food Chem. 2015, 63, 929−942

Journal of Agricultural and Food Chemistry

Article

Table 2. continued

Unigene ID highlighted with yellow and green colors represent unigenes identified from “glycosyltransferases” categories according to the KEGG protein database, and manually searched, respectively. bThe numbers under the “C1 (no.)” and “C2 (no.)” columns represent the number of total reads in each unigene identified in the chestnut transcriptomes. cHighlighted RPKM values under the “C1 (RPKM)” and “C2 (RPKM)”columns represent those almost exclusively expressed in the nuts collected 45 and 75 DAF, respectively. dHighlighted RPKM values under the “C2/C1 (expression)” column represent those 58 unigenes that showed ≥2-fold of expression difference between the 45 and 75 DAF seed stages.

a

search using keyword “maltose” identified one unigene (C1Ug35422) in the unigene database putatively coding for maltose exporter (Mex1), a transporter important for starch degradation.40 Finally, one α-amylase/subtilisin inhibitor-like unigene (C2Ug26008), an orthologue of grape wine, was found in the 75 DAF transcriptome (Table 2). Taken together, 152 annotated unigenes with detectable RPKM values involved in starch and sucrose metabolism were identified from the Chinese chestnut transcriptomes (Table 2). Digital Analysis of Differentially Expressed Genes in Two Seed Developmental Stages. The RPKM (reads per kb per million mapped reads) method was used to identify unigenes with significant differences in expression levels between the two libraries. A total of 1537 unigenes showed ≥2-fold change (complete transcriptome analysis to be published elsewhere). Among the 152 unigenes coding for starch and sucrose metabolism, 58 unigenes showed ≥2-fold of expression difference between the 45 and 75 DAF seeds including 11 up- and 47 down-regulated unigenes (Table 2). In addition, transcripts for 18 unigenes were almost exclusively detected in 45 DAF seeds whereas 15 unigene transcripts were exclusively detected in 75 DAF seeds as judged by apparent RPKM value in their respective nut stages (Table 2). Digital Analysis of Major Expressed Genes in Two Seed Developmental Stages. Among the 152 unigenes discovered in starch and sucrose metabolism pathway, 13 unigenes from the 45 DAF cDNA library and 14 unigenes from the 75 DAF cDNA library had RPKM value over 100 (Table 3). Among them, 11 of the unigenes with PRKM values over 100 were presented in both 45 and 75 DAF cDNA libraries (C2Ug23993, C1Ug30240, C1Ug33458, C1Ug35570, C1Ug38445, C1Ug39284, C1Ug40932, C1Ug41886, C2Ug23382, C2Ug29836 and C2Ug30776) (Table 3). C2Ug23993 had the highest RPKM value at 994 and 2343 in the 45 and 75 DFA cDNA libraries, respectively. C2Ug23993

putatively coded for a GBSS, the most abundant transcript identified in the endosperms. Classification of Starch and Sucrose Metabolism Genes in Chestnut Seed Transcriptome. The 152 starch and sucrose metabolism unigenes identified from the chestnut transcriptomes coded for 37 protein families (Table 4). The gene families coding for pectinesterase, α-1,4-galacturonosyltransferase, β-glucosidase, and SuS had the most unigenes with 17, 13, 12, and 11 unigenes identified from the transcriptomes, respectively (Table 4). These unigenes coded for well-known components in the starch and sucrose metabolism pathway, including 1 unigene for GLG, 1 unigene for Mex1, 4 unigenes for Brittle1-type ANT, 3 unigenes for AGP, 8 unigenes for SS (4 for SSS and 4 for GBSS), 2 unigenes for SBE, 5 unigenes for SDBE (2 for isoamylase and 3 for pullulanase), 11 unigenes for sucrose synthase (SuS), 3 unigenes for sucrose-phosphate synthase (SuPS), 3 unigenes for α-amylase (α-AMY), 2 unigenes for β-AMY, and 4 unigenes for starch phosphorylase (SP) (Table 4). These families of unigenes (red color) were mapped onto the generalized starch and sucrose metabolism pathway generated by KEGG protein database (black color) (Figure 2). Among the identified unigenes, 23 unigenes coding for AGP, ANT, GLG, SSS, GBSS, SBE, and SDBE were involved in starch biosynthesis, whereas 11 unigenes coding for AMY, SP, Mex1, and α-amylase/subtilisin inhibitor were involved in starch degradation (Figure 2). A total of 14 unigenes coding for SuS and SuPS were involved in sucrose metabolism and 9 unigenes coding for enzymes to convert sucrose into β-D-fructose (Figure 2). Ten unigenes converted UDP-glucose into α-D-glucose, whereas 13 unigenes were used to convert cellulose into β-D-glucose (Figure 2). In addition, 40 unigenes starting from UDP-glucose were committed to pectin and pectate biosynthesis (Figure 2). Finally, 11 unigenes starting from UDP-glucose were committed to trehalose biosynthesis and 6 unigenes encoding trehalase for pectate hydrolysis to glucose (Figure 2). 935

DOI: 10.1021/jf505247d J. Agric. Food Chem. 2015, 63, 929−942

Journal of Agricultural and Food Chemistry

Article

Table 3. Digital Expression Analysis of Major Starch and Sucrose Metabolism Genes Expressed in Chinese Chestnut Endosperm (RPKM > 50) unigene ID

C1 (no.)a

C1 (RPKM)b

C2 (no.)a

C2 (RPKM)b

C2Ug23993 C2Ug23382 C1Ug41886 C1Ug30240 C1Ug39284 C1Ug33458 C1Ug40932 C1Ug35570 C1Ug38445 C2Ug29836 C2Ug30776

40586 24521 18711 5456 5545 6077 5966 9061 6201 7256 6064

994.32 565.36 447.14 284.62 200.21 199.30 187.57 177.54 165.73 158.82 128.28

100097 33715 6903 7185 4753 6009 4332 12900 7555 10398 6308

2343.23 742.76 157.63 358.15 163.98 188.30 130.14 241.52 192.94 217.48 127.50

C1Ug41090 C1Ug44096 C2Ug29276 C1Ug37665 C1Ug39221 C1Ug42915 C1Ug40350 C1Ug39763 C1Ug40531 C1Ug44890 C2Ug30240 C1Ug38157 C1Ug44094 C2Ug24779 C2Ug31317 C2Ug24961

3518 3589 3727 2416 2820 2993 2360 2867 1958 5025 1494 1721 2145 507 338 261

137.05 102.77 99.81 90.44 74.64 71.52 70.86 54.83 53.34 51.99 51.50 48.57 46.34 29.68 13.39 8.47

1672 2111 3545 2843 4454 3394 1272 783 1813 2524 1985 2573 3424 1896 1425 2973

62.24 57.76 90.71 101.69 112.65 77.50 36.49 14.31 47.20 24.95 65.38 69.38 70.68 106.05 53.93 92.20

173183

4514.09

238842

5946.77

summary

KEGG annotation [international enzyme name] granule-bound starch synthase [EC 2.4.1.242] sucrose synthase [EC 2.4.1.13] sucrose synthase [EC 2.4.1.13] fructokinase [EC 2.7.1.4] UDP-glucose 6-dehydrogenase [EC 1.1.1.22] UTP-glucose-1-phosphate uridylyltransferase [EC 2.7.7.9] pectinesterase [EC 3.1.1.11] starch phosphorylase [EC 2.4.1.1] glucose-1-phosphate adenylyltransferase [EC 2.7.7.27] glucose-1-phosphate adenylyltransferase [EC 2.7.7.27] α-1,4-glucan branching enzyme [EC 2.4.1.18] UDP-glucuronate 4-epimerase [EC 5.1.3.6] α-1,4-galacturonosyltransferase [EC 2.4.1.43] sucrose synthase [EC 2.4.1.13] UDP-glucuronate 4-epimerase [EC 5.1.3.6] glucose-1-phosphate adenylyltransferase [EC 2.7.7.27] phosphoglucomutase [EC 5.4.2.2] glucose-6-phosphate isomerase [EC 5.3.1.9] α,α-trehalose-phosphate synthase (UDP-forming) [EC 2.4.1.15] hexokinase [EC 2.7.1.1] α-1,4-galacturonosyltransferase [EC 2.4.1.43] pectinesterase [EC 3.1.1.11] glucose-6-phosphate isomerase [EC 5.3.1.9] starch phosphorylase [EC 2.4.1.1] pectinesterase [EC 3.1.1.11] α-amylase [EC 3.2.1.1] pectinesterase [EC 3.1.1.11]

The numbers under “C1 (no.)” and “C2 (no.)” columns represent the number of total reads in each unigene identified in the chestnut transcriptomes. bThe numbers under “C1 (RPKM)” and “C2 (RPKM)”columns represent those most abundantly expressed unigenes with at least 50 RPKM in at least one of the two nut stages collected 45 and 75 DAF.

a

Digital Expression Analysis of Starch and Sucrose Metabolism Gene Families in Chestnut Seed Transcriptome. RPKM values of individual unigenes were pooled together according to the classified gene families (Table 4). Thirteen families of unigenes had RPKM values >100 in both 45 and 75 DAF seed transcriptomes (Table 4). The most abundantly expressed unigenes represented by total RPKM values were SuS (1159), GBSS (1001), pectinesterase (403), and AGP (399) in 45 DAF seed transcriptome, but the order of the abundance of expression was changed to GBSS (2345), SuS (1007), AGP (523), and pectinesterase (459) in 75 DAF seed transcriptome (Table 4). Soluble SS, isoamylase- and pullulanase-type SDBE, brittle1-type ANT, and Mex1 had 200 RPKM in both seed stages (Table 4). GLG RPKM was extremely low in 45 DFA and undetectable in 75 DAF transcriptomes (Table 4). In addition, three unigenes were identified in the nut transcriptomes, which coded for phosphotransferase system (PTS), including one unigene for maltose- and glucose-specific IIC component and two unigenes for trehalose-specific IIC component. Quantitative Analysis of Selected Genes Involved in Starch and Sucrose Pathways. We used qPCR to evaluate the expression profiles of 11 genes involved in starch and sucrose metabolism pathway as well as 10 other genes predicted

to be important in chestnut tree carbohydrate metabolism using primers designed according to the sequences of the unigenes (Table 1). The qPCR results showed that five of these genes were significantly up-regulated and peaked at 75 DAF with >2fold of increases in mRNA levels compared to those at 30 DAF (Figure 3E, C1Ug38445; 3H, C1Ug41228; 3Q, C2Ug26944; 3S, C2Ug29836; and 3T, C2Ug30790). These five genes were important enzymes for starch synthesis because they coded for AGP large subunit (C1Ug38445) and small subunit (C2Ug29836), GBSS2 (C1Ug41228), SSS1 (C2Ug26944), and SSS4 (C2Ug30790) (Table 1). Twelve of the genes were down-regulated during seed development (Figure 3A, C1Ug19275; 3B, C1Ug22044; 3C, C1Ug31955; 3D, C1Ug36303; 3F, C1Ug39763; 3G, C1Ug41090; 3I, C1Ug41886; 3J, C1Ug42679; 3K, C1Ug43056; 3M, C1Ug46084; 3N, C2Ug23382; and 3R, C2Ug29276). Five of the down-regulated genes coded for sucrose synthase (C1Ug41886, C1Ug19275, C2Ug23382, C2Ug29276, and C1Ug31955) (Table 1). Correlation between Gene Expression Levels and Starch Content in Chestnut Seeds. The correlation between gene expression levels and starch content was performed by SPSS software (Table 5). Expression levels of five genes were highly correlated with the amount of starch including both amylose and amylopectin with correlation 936

DOI: 10.1021/jf505247d J. Agric. Food Chem. 2015, 63, 929−942

Journal of Agricultural and Food Chemistry

Article

Table 4. Classification and Digital Expression Analysis of Unigenes Coding for 37 Protein Families in Starch and Sucrose Metabolism in Chinese Chestnut Endosperm Transcriptomes family

KEGG annotation [international enzyme name]a

unigene no.b

C1 (no.)c

C1 (RPKM)d

C2 (no.)c

C2 (RPKM)d

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37

1,4-α-glucan branching enzyme [EC 2.4.1.18] (SBE) 1,4-β-D-xylan synthase [EC 2.4.2.24] 4-α-glucanotransferase [EC 2.4.1.25] α,α-trehalase [EC 3.2.1.28] α,α-trehalose-phosphate synthase (UDP-forming) [EC 2.4.1.15] α-1,4-galacturonosyltransferase [EC 2.4.1.43] α-amylase [EC 3.2.1.1] α-amylase/subtilisin inhibitor [Vitis vinifera] adenylate transporter (brittle1 type) α-glucosidase [EC 3.2.1.20] β-amylase [EC 3.2.1.2] β-fructofuranosidase [EC 3.2.1.26] β-glucosidase [EC 3.2.1.21] endoglucanase [EC 3.2.1.4] fructokinase [EC 2.7.1.4] glucose-1-phosphate adenylyltransferase [EC 2.7.7.27] (AGP) glucose-6-phosphate isomerase [EC 5.3.1.9] glycogenin glucosyltransferase [EC 2.4.1.186] (GLG) granule-bound starch synthase [EC 2.4.1.242] (GBSS) hexokinase [EC 2.7.1.1] isoamylase [EC 3.2.1.68] (SBDE) naltose excess protein 1 [Malus × domestica] (Mex1) pectinesterase [EC 3.1.1.11] phosphoglucomutase [EC 5.4.2.2] polygalacturonase [EC 3.2.1.15] PTS system, maltose- and glucose-specific IIC component PTS system, trehalose-specific IIC component pullulanase [EC 3.2.1.41] (SDBE) soluble starch synthase [EC 2.4.1.21] (SSS) starch phosphorylase [EC 2.4.1.1] (SP) sucrose synthase [EC 2.4.1.13] (*SuS) sucrose-phosphate synthase [EC 2.4.1.14] (SuPS) trehalose-6-phosphate hydrolase [EC 3.2.1.93] trehalose-phosphatase [EC 3.1.3.12] UDP-glucose 6-dehydrogenase [EC 1.1.1.22] UDP-glucuronate 4-epimerase [EC 5.1.3.6] UTP-glucose-1-phosphate uridylyltransferase [EC 2.7.7.9] (UGP)

2 1 3 6 6 13 3 1 4 2 2 5 12 1 4 3 2 1 4 7 2 1 17 2 3 1 2 3 4 4 11 3 1 5 5 5 1

6064 1683 1649 565 3175 13890 834 6 1463 4158 2 1491 1595 375 6633 16277 4081 25 40653 3052 1871 196 10936 4452 0 0 0 317 2948 11208 47616 3102 0 3363 6154 6213 6077

128.28 27.54 43.20 46.91 74.24 311.48 27.26 0.80 55.50 83.16 0.43 48.22 61.36 12.98 336.52 399.20 119.43 2.52 1000.64 98.02 41.10 7.63 403.03 100.30 0.00 0.00 0.00 18.15 72.96 224.44 1158.98 57.82 0.00 81.43 246.90 248.87 199.30

6309 137 1398 148 939 7604 1695 92 1339 1793 3 501 1259 778 8586 22407 3845 0 100110 2764 1660 248 12837 4863 49 3 6 201 1993 16326 44390 2693 4 2678 5838 4690 6009

127.79 2.14 36.89 15.06 25.89 165.75 60.80 11.72 48.58 33.08 0.64 15.31 39.37 25.73 414.39 523.07 105.88 0.00 2345.28 86.98 34.76 9.23 459.28 105.18 8.77 0.61 1.32 11.27 49.76 312.68 1006.60 47.12 0.79 67.47 245.92 176.52 188.30

152

212124

5738.60

266195

6809.95

summary

Gene families 18 and 19 were identified from “glycosyltransferases” categories according to the KEGG protein database; gene families 8, 9, 21, 22, and 28 were identified by keyword search of unigene database manually. bThe numbers under “unigene no.” column represent the total number of unigenes in each enzyme family identified in the chestnut transcriptomes. cThe numbers under the “C1 (no.)” and “C2 (no.)” columns represent the total reads in each enzyme family identified in the chestnut transcriptomes. dThe numbers under “C1 (RPKM)” and “C2 (RPKM)” columns represent the total values of unigene RPKM in each enzyme families identified in the chestnut transcriptomes. a

coefficients >0.9 (boldfaced in Table 5). These five genes (C1Ug38445, C1Ug41228, 2Ug26944, C2Ug29836, and C2Ug30790) were identical to those genes for which mRNA levels were up-regulated in later stage of nuts (75 DAF) at least 2-fold relative to those in early stage of nuts (30 DAF) (Figure 3E, C1Ug38445; 3H, C1Ug41228; 3Q, C2Ug26944; 3S, C2Ug29836; and 3T, C2Ug30790). Similarly, all downregulated genes were negatively correlated with starch content in the nuts (Table 5 vs Figure 3).

biochemical and molecular levels of starch biosynthesis in chestnuts. Our objectives in this study were to analyze composition profiles and characterize genes involved in starch biosynthesis in developing nuts. As expected, starch constituted approximately half of the dry mass including 33% of amylopectin and 14% of amylose in the seed endosperm collected 90 DAF. In addition, 17% of the dry mass was soluble sugars, but there were only 4% protein and 100 in both 45 and 75 DAF seed transcriptomes. The most abundantly expressed unigenes represented by total RPKM values were SuS (1159), GBSS (1001), pectinesterase (403), and AGP (399) in 45 DAF seed transcriptome, but the order of the abundance of expression was changed to GBSS (2345), SuS (1007), AGP (523), and pectinesterase (459) in 75 DAF seed transcriptome (Table 4). The altered key gene expression implies that sucrose metabolism is more active in the earlier stages of nut development and that starch accumulation becomes more predominant in the later stages. It is interesting to note that

soluble SS, isoamylase- and pullulanase-type SDBE, brittle1 type ANT and GLG had 200 RPKM in both seed stages. These observations suggest that SSS, SBDE, ANT, and GLG are possibly limiting factors for starch biosynthesis, and SP is the major enzyme for starch degradation in the seeds. Future experiments will be needed to characterize the significance of PTS genes discovered from this transcriptome analysis. Digital expression analysis showed that 58 of 152 unigenes in starch and sucrose metabolism exhibited ≥2-fold of expression difference between the two seed stages. Transcripts for 18 unigenes were almost exclusively detected in 45 DAF seeds, whereas 15 unigene transcripts were exclusively detected in 75 DAF seeds. Additional experiments will be required to understand the physiological significance of these stage-specific unigenes in the chestnuts. The expression profiles of 21 unigenes putatively coding for major enzymes in starch and sucrose metabolism were confirmed by qPCR using RNA from five seed stages. Expression profiles and correlation analyses indicated that the mRNA levels of AGP (large and small subunits), GBSS2, and soluble SS1 and SS4 were wellcorrelated with starch accumulation in the seeds. Interestingly, two of the most abundant transcripts with RPKM values >1000 in chestnut seed transcriptomes coded for GBSSII-1 (C2Ug23993) and fructose-bisphosphate aldolase (C1Ug33347). GBSS is responsible for amylose synthesis,48 whereas fructose-bisphosphate aldolase is an important enzyme in the glycolytic pathway regulating carbohydrate metabolism.49 940

DOI: 10.1021/jf505247d J. Agric. Food Chem. 2015, 63, 929−942

Journal of Agricultural and Food Chemistry

■

We also noted that gene expression profiles by RPKM and qPCR methods were generally in agreement. Ten of the 11 unigenes (C1Ug22044, C2Ug24779, C2Ug24961, C2Ug31317, C1Ug39763, C1Ug41090, C1Ug41886, C1Ug42679, C1Ug43056, and C1Ug46084) selected for qPCR assays exhibited similar patterns of expression to those estimated by RPKM. The expression of the other unigene (C1Ug36303) showed a similar trend between the two methods, but the expression levels were not significantly different among the seed stages (Figure 3). These results suggest that both methods are reliable and complementary to each other for estimating gene expression. In conclusion, metabolite analysis showed that starch was the major component and rapidly accumulated during Chinese chestnut seed development. Amylopectin was approximately 3fold of amylose content in chestnut starch. Transcriptome sequencing identified 152 unigenes involved in starch and sucrose metabolism, which are classified into 37 gene families including glycogenin glucosyltransferase, adenylate transporter, ADP-glucose pyrophosphorylase, starch synthase, starch branching enzyme, starch debranching enzyme, sucrose synthase, and sucrose-phosphate synthase. Among them, 58 unigenes showed a ≥2-fold expression difference between the 45 and 75 DAF seeds including 11 up- and 47 down-regulated unigenes. The expression of 21 unigenes putatively coding for major enzymes in starch and sucrose metabolism was validated by qPCR using RNA from five seed stages. Expression profiles and correlation analysis indicated that the mRNA levels of AGP, granule-bound SS2, and soluble SS1 and SS4 were wellcorrelated with starch accumulation in the seeds. Our data suggest that the starch biosynthesis pathway in Chinese chestnut endosperm is similar to that of potato tubers and Arabidopsis leaves and differs from that of maize endosperm. This study provides valuable metabolic and genetic resources for future research in starch and sucrose metabolism in the Chinese chestnut tree.

■

Article

ABBREVIATIONS USED

ADPG, ADP-glucose; AGP, ADP-glucose pyrophosphorylase; AMY, amylase; ANT, adenylate transporter; DAF, days after flowering; FDR, false discovery rate; GBSS, granule-bound starch synthase; GLG, glycogenin glucosyltransferase; KEGG, Kyoto Encyclopedia of Genes and Genomes; Mex, maltose exporter; qPCR, quantitative real-time polymerase chain reaction; PTS, phosphotransferase system; RIN, RNA integrity number; RPKM, reads per kilobase per million mapped reads; SBE, starch branching enzyme; SDBE, starch debranching enzyme; SP, starch phosphorylase; SSS, soluble starch synthase; SuPS, sucrose-phosphate synthase; SuS, sucrose synthase; UGP, UDP-glucose pyrophosphorylase

■

REFERENCES

(1) De Vasconcelos, M. C. B. M.; Bennett, R. N.; Rosa, E. A.; Ferreira Cardoso, J. V. Primary and secondary metabolite composition of kernels from three cultivars of Portuguese chestnut (Castanea sativa Mill.) at different stages of industrial transformation. J. Agric. Food Chem. 2007, 55 (9), 3508−3516. (2) Borges, O.; Gon+°alves, B.; de Carvalho, J. L. S.; Correia, P.; Silva, A. P. Nutritional quality of chestnut (Castanea sativa Mill.) cultivars from Portugal. Food Chem. 2008, 106 (3), 976−984. (3) Liang, L.; Xu, J.; Wang, G.; Ma, H. Relationship between starch pasting, amylose content and starch granule size in different Chinese chestnut variety groups. Sci. Agric. Sinica 2009, 42, 251−260. (4) Cruz, B. R.; Abraao, A. S.; Lemos, A. M.; Nunes, F. M. Chemical composition and functional properties of native chestnut starch (Castanea sativa Mill). Carbohydr. Polym. 2013, 94 (1), 594−602. (5) Barreira, J. C.; Pereira, J. A.; Oliveira, M. B.; Ferreira, I. C. Sugars profiles of different chestnut (Castanea sativa Mill.) and almond (Prunus dulcis) cultivars by HPLC-RI. Plant Foods Hum. Nutr. 2010, 65 (1), 38−43. (6) Pizzoferrato, L.; Rotilio, G.; Paci, M. Modification of structure and digestibility of chestnut starch upon cooking: a solid state (13)C CP MAS NMR and enzymatic degradation study. J. Agric. Food Chem. 1999, 47 (10), 4060−4063. (7) Tsujita, T.; Yamada, M.; Takaku, T.; Shintani, T.; Teramoto, K.; Sato, T. Purification and characterization of polyphenols from chestnut astringent skin. J. Agric. Food Chem. 2011, 59 (16), 8646−8654. (8) Blaiotta, G.; La Gatta, B.; Di Capua, M.; Di Luccia, A.; Coppola, R.; Aponte, M. Effect of chestnut extract and chestnut fiber on viability of potential probiotic Lactobacillus strains under gastrointestinal tract conditions. Food Microbiol. 2013, 36 (2), 161−169. (9) Warmund, M. R.; Elmore, J. R.; Adhikari, K.; McGraw, S. Descriptive sensory analysis and free sugar contents of chestnut cultivars grown in North America. J. Sci. Food Agric. 2011, 91 (11), 1940−1945. (10) Emes, M. J.; Bowsher, C. G.; Hedley, C.; Burrell, M. M.; ScraseField, E. S.; Tetlow, I. J. Starch synthesis and carbon partitioning in developing endosperm. J. Exp. Bot. 2003, 54 (382), 569−575. (11) Morell, M. K.; Myers, A. M. Towards the rational design of cereal starches. Curr. Opin. Plant Biol. 2005, 8 (2), 204−210. (12) Zeeman, S. C.; Kossmann, J.; Smith, A. M. Starch: its metabolism, evolution, and biotechnological modification in plants. Annu. Rev. Plant Biol. 2010, 61, 209−234. (13) Baroja-Fernandez, E.; Munoz, F. J.; Akazawa, T.; PozuetaRomero, J. Reappraisal of the currently prevailing model of starch biosynthesis in photosynthetic tissues: a proposal involving the cytosolic production of ADP-glucose by sucrose synthase and occurrence of cyclic turnover of starch in the chloroplast. Plant Cell Physiol 2001, 42 (12), 1311−1320. (14) Preiss, J. ADPglucose pyrophosphorylase: basic science and applications in biotechnology. Biotechnol. Annu. Rev. 1996, 2, 259− 279. (15) Shannon, J. C.; Pien, F. M.; Cao, H.; Liu, K. C. Brittle-1, an adenylate translocator, facilitates transfer of extraplastidial synthesized

AUTHOR INFORMATION

Corresponding Author

*(H.C.) E-mail: [email protected]. Phone: (504) 2864351. Fax: (504) 286-4367. Present Address ⊥

(X.Z.) School of Life Science and Environmental Resources, Yichun University, Yichun, Jiangxi Province 336000, People’s Republic of China. Funding

This work was supported by the Chinese National Science and Technology Pillar Program (2013BAD14B04) and USDA-ARS Quality and Utilization of Agricultural Products Research Program 306 through CRIS 6435-41000-102-00D. Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We thank Dr. Chris Mattison (USDA-ARS) for helpful comments on the manuscript. 941

DOI: 10.1021/jf505247d J. Agric. Food Chem. 2015, 63, 929−942

Journal of Agricultural and Food Chemistry

Article

ADP-glucose into amyloplasts of maize endosperms. Plant Physiol. 1998, 117 (4), 1235−1252. (16) James, M. G.; Denyer, K.; Myers, A. M. Starch synthesis in the cereal endosperm. Curr. Opin. Plant Biol. 2003, 6 (3), 215−222. (17) Hannah, L. C.; James, M. The complexities of starch biosynthesis in cereal endosperms. Curr. Opin. Biotechnol. 2008, 19 (2), 160−165. (18) Keeling, P. L.; Myers, A. M. Biochemistry and genetics of starch synthesis. Annu. Rev. Food Sci. Technol. 2010, 1, 271−303. (19) Cao, H.; Imparl-Radosevich, J.; Guan, H.; Keeling, P. L.; James, M. G.; Myers, A. M. Identification of the soluble starch synthase activities of maize endosperm. Plant Physiol. 1999, 120 (1), 205−216. (20) Cao, H.; James, M. G.; Myers, A. M. Purification and characterization of soluble starch synthases from maize endosperm. Arch. Biochem. Biophys. 2000, 373 (1), 135−146. (21) Beatty, M. K.; Rahman, A.; Cao, H.; Woodman, W.; Lee, M.; Myers, A. M.; James, M. G. Purification and molecular genetic characterization of ZPU1, a pullulanase-type starch-debranching enzyme from maize. Plant Physiol. 1999, 119 (1), 255−266. (22) Cao, H.; Sullivan, T. D.; Boyer, C. D.; Shannon, J. C. Bt1, a structural gene for the major 39−44 kDa amyloplast membrane polypeptides. Physiol. Plant. 1995, 95 (2), 176−186. (23) Berrocal-Lobo, M.; Ibanez, C.; Acebo, P.; Ramos, A.; PerezSolis, E.; Collada, C.; Casado, R.; Aragoncillo, C.; Allona, I. Identification of a homolog of Arabidopsis DSP4 (SEX4) in chestnut: its induction and accumulation in stem amyloplasts during winter or in response to the cold. Plant Cell Environ. 2011, 34 (10), 1693−1704. (24) Barakat, A.; DiLoreto, D. S.; Zhang, Y.; Smith, C.; Baier, K.; Powell, W. A.; Wheeler, N.; Sederoff, R.; Carlson, J. E. Comparison of the transcriptomes of American chestnut (Castanea dentata) and Chinese chestnut (Castanea mollissima) in response to the chestnut blight infection. BMC Plant Biol. 2009, 9, 51. (25) Barakat, A.; Staton, M.; Cheng, C. H.; Park, J.; Yassin, N. B.; Ficklin, S.; Yeh, C. C.; Hebard, F.; Baier, K.; Powell, W.; Schuster, S. C.; Wheeler, N.; Abbott, A.; Carlson, J. E.; Sederoff, R. Chestnut resistance to the blight disease: insights from transcriptome analysis. BMC Plant Biol. 2012, 12, 38. (26) Allen, T. D.; Dawe, A. L.; Nuss, D. L. Use of cDNA microarrays to monitor transcriptional responses of the chestnut blight fungus Cryphonectria parasitica to infection by virulence-attenuating hypoviruses. Eukaryot. Cell 2003, 2 (6), 1253−1265. (27) Morris, D. L. Quantitative determination of carbohydrates with Dreywood’s anthrone reagent. Science 1948, 107 (2775), 254−255. (28) Liu, T.; Hu, Y.; Li, X. Comparison of dynamic changes in endogenous hormones and sugars between abnormal and normal Castanea mollissima. Prog. Nat. Sci. 2008, 18, 685−690. (29) Liang, L.; Lin, S.; Zhang, B.; Wang, G. Effect of de-fat and deprotein treatments on swelling power of Chinese chestnut (C. mollissima BI.) powder. Sci. Agric. Sinica 2012, 45, 3820−3831. (30) Cao, H.; Shockey, J. M. Comparison of TaqMan and SYBR Green qPCR methods for quantitative gene expression in tung tree tissues. J. Agric. Food Chem. 2012, 60 (50), 12296−12303. (31) Zhang, L.; Jia, B.; Tan, X.; Thammina, C. S.; Long, H.; Liu, M.; Wen, S.; Song, X.; Cao, H. Fatty acid profile and unigene-derived simple sequence repeat markers in tung tree (Vernicia fordii). PLoS One 2014, 9 (8), No. e105298. (32) Grabherr, M. G.; Haas, B. J.; Yassour, M.; Levin, J. Z.; Thompson, D. A.; Amit, I.; Adiconis, X.; Fan, L.; Raychowdhury, R.; Zeng, Q.; Chen, Z.; Mauceli, E.; Hacohen, N.; Gnirke, A.; Rhind, N.; di, P. F.; Birren, B. W.; Nusbaum, C.; Lindblad-Toh, K.; Friedman, N.; Regev, A. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 2011, 29 (7), 644−652. (33) Jones, P.; Binns, D.; Chang, H. Y.; Fraser, M.; Li, W.; McAnulla, C.; McWilliam, H.; Maslen, J.; Mitchell, A.; Nuka, G.; Pesseat, S.; Quinn, A. F.; Sangrador-Vegas, A.; Scheremetjew, M.; Yong, S. Y.; Lopez, R.; Hunter, S. InterProScan 5: genome-scale protein function classification. Bioinformatics 2014, 30 (9), 1236−1240. (34) Audic, S.; Claverie, J. M. The significance of digital gene expression profiles. Genome Res. 1997, 7 (10), 986−995.

(35) Mortazavi, A.; Williams, B. A.; McCue, K.; Schaeffer, L.; Wold, B. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat. Methods 2008, 5 (7), 621−628. (36) Cao, H.; Shockey, J. M.; Klasson, K. T.; Mason, C. B.; Scheffler, B. E. Developmental regulation of diacylglycerol acyltransferase family gene expression in tung tree tissues. PLoS One 2013, 8 (10), No. e76946. (37) Livak, K. J.; Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-ΔΔC(T)) method. Methods 2001, 25 (4), 402−408. (38) Denyer, K.; Dunlap, F.; Thorbjornsen, T.; Keeling, P.; Smith, A. M. The major form of ADP-glucose pyrophosphorylase in maize endosperm is extra-plastidial. Plant Physiol. 1996, 112 (2), 779−785. (39) Sullivan, T. D.; Strelow, L. I.; Illingworth, C. A.; Phillips, R. L.; Nelson, O. E., Jr. Analysis of maize brittle-1 alleles and a defective suppressor-mutator-induced mutable allele. Plant Cell 1991, 3 (12), 1337−1348. (40) Niittyla, T.; Messerli, G.; Trevisan, M.; Chen, J.; Smith, A. M.; Zeeman, S. C. A previously unknown maltose transporter essential for starch degradation in leaves. Science 2004, 303 (5654), 87−89. (41) Bahaji, A.; Li, J.; Sanchez-Lopez, A. M.; Baroja-Fernandez, E.; Munoz, F. J.; Ovecka, M.; Almagro, G.; Montero, M.; Ezquer, I.; Etxeberria, E.; Pozueta-Romero, J. Starch biosynthesis, its regulation and biotechnological approaches to improve crop yields. Biotechnol. Adv. 2014, 32 (1), 87−106. (42) Shannon, J. C.; Pien, F. M.; Liu, K. C. Nucleotides and nucleotide sugars in developing maize endosperms (synthesis of ADPglucose in brittle-1). Plant Physiol. 1996, 110 (3), 835−843. (43) Sullivan, T. D.; Kaneko, Y. The maize brittle 1 gene encodes amyloplast membrane polypeptides. Planta 1995, 196 (3), 477−484. (44) Smith, A. M. The biosynthesis of starch granules. Biomacromolecules 2001, 2 (2), 335−341. (45) Cao, H.; Shannon, J. C. BT1, a protein critical for in vivo starch accumulation in maize endosperm, is not detected in maize endosperm suspension cultures. Physiol. Plant. 1996, 97 (4), 665−673. (46) Cao, H.; Shannon, J. C. BT1, a possible adenylate translocator, is developmentally expressed in maize endosperm but not detected in starchy tissues from several other species. Physiol. Plant. 1997, 100 (2), 400−406. (47) Martin, C.; Smith, A. M. Starch biosynthesis. Plant Cell 1995, 7 (7), 971−985. (48) Shure, M.; Wessler, S.; Fedoroff, N. Molecular identification and isolation of the Waxy locus in maize. Cell 1983, 35 (1), 225−233. (49) Zeng, Y.; Tan, X.; Zhang, L.; Jiang, N.; Cao, H. Identification and expression of fructose-1,6-bisphosphate aldolase genes and their relations to oil content in developing seeds of tea oil tree (Camellia oleifera). PLoS One 2014, 9 (9), No. e107422.

942

DOI: 10.1021/jf505247d J. Agric. Food Chem. 2015, 63, 929−942