Trapping and Proteomic Identification of Cellular Substrates of the

Subscriber access provided by Brown University Library

Article

Trapping and Proteomic Identification of Cellular Substrates of the ClpP Protease in Staphylococcus aureus Jingyuan Feng, Stephan Michalik, Anders Nissen Varming, Julie Hove Andersen, Dirk Albrecht, Lotte Jelsbak, Stefanie Krieger, Knut Ohlsen, Michael Hecker, Ulf Gerth, Hanne Ingmer, and Dorte Frees J. Proteome Res., Just Accepted Manuscript • DOI: 10.1021/pr300394r • Publication Date (Web): 19 Dec 2012 Downloaded from http://pubs.acs.org on December 23, 2012

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Journal of Proteome Research is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Proteome Research

Trapping and Proteomic Identification of Cellular Substrates of the ClpP Protease in Staphylococcus aureus Jingyuan Feng1, Stephan Michalik2, Anders N. Varming1, Julie H. Andersen1, Dirk Albrecht2, Lotte Jelsbak1, Stefanie Krieger3, Knut Ohlsen3, Michael Hecker2, Ulf Gerth2, Hanne Ingmer1 and Dorte Frees1*

1) Faculty of Life Sciences, Department of Veterinary Disease Biology, University of Copenhagen, Stigbøjlen 4, DK-1870 Frederiksberg C, Denmark and 2) Institut für Mikrobiologie, Ernst-Moritz-Arndt-Universität, 17487 Greifswald, Germany, and 3) Institute for Molecular Infectionsbiology, Würzburg University, Würzburg, Germany.

* corresponding author. Mailing address: Department of Veterinary Disease Biology, University of Copenhagen, Stigbøjlen 4, DK-1870 Frederiksberg C, Denmark. E-mail [email protected]; Tel (+45) 3533 2719; Fax (+45) 3533 2757.

1

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract In the important human pathogen Staphylococcus aureus the cytoplasmic ClpP protease is essential for mounting cellular stress responses and for virulence. To directly identify substrates of the ClpP protease, we expressed in vivo a proteolytic inactive form of ClpP (ClpPtrap) that will retain but not degrade substrates translocated into its proteolytic chamber. Substrates captured inside the proteolytic barrel were co-purified along with the His-tagged ClpP complex, and identified by mass spectrometry. In total, approximately 70 proteins were trapped in both of the two S. aureus strains NCTC8325-4 and Newman. About one third of the trapped proteins are previously shown to be unstable, or to be substrates of ClpP in other bacteria supporting the validity of the ClpP-TRAP. This group of proteins encompassed the transcriptional regulators CtsR and Spx, the ClpC adaptor proteins McsB and MecA, and the cell division protein FtsZ. Newly identified ClpP substrates include the global transcriptional regulators, PerR, and HrcA, proteins involved in DNA damage repair (RecA, UvrA, UvrB), and proteins essential for protein synthesis (RpoB, and Tuf). Our study hence underscores the central role of Clp-proteolysis in a number of pathways that contribute to the success of S. aureus as a human pathogen.

2


Page 2 of 44

Page 3 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction The ATP-dependent ClpP proteases are highly conserved and widely distributed among eubacteria, and in chloroplasts and mitochondria.1 Extensive structural and mechanistic analysis on the Escherichia coli ClpP proteases has paved the way for understanding their function (reviewed by Sauer and Baker, 2011).2 These proteases are compartmentalized proteases composed of separately encoded proteolytic subunits and ATPase subunits. The ClpP subunits contain the conserved catalytic triad (Ser-His-Asp) that is typical of serine proteases. Two heptameric rings of ClpP subunits are stacked to form a barrel-shaped proteolytic chamber, where the active sites line the inner surface. Access to this secluded proteolytic chamber is restricted by pores that are too narrow to allow entry of folded proteins. This restriction prevents the undesirable degradation of most cellular proteins. In order to be degraded, substrates must first interact with the Clp ATPase component that powers unfolding and subsequent translocation of the substrate into the ClpP proteolytic chamber.3 In the cell, ClpP associates with different Clp ATPases that either recognize protein substrates directly, or alternatively interact with substrates via socalled adaptor proteins (reviewed by Kirstein et al., 2009).4 Although some substrates are recognized by more ClpATPases, the ClpATPases generally confer distinct substrate specificities to the ClpP protease complexes. Structurally and functionally, ClpP proteases are related to the eukaryotic proteasome, and like other ATP-dependent proteases are required for both general and regulated proteolysis.2 General proteolysis disposes the cell of damaged or excessive proteins thereby ensuring protein quality and homeostasis. Regulated proteolysis, on the other hand, is the specific and conditional degradation of regulatory proteins that allows the bacterium to control cellular adaptations and 3



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

differentiations in response to extra- or intracellular signals. Notable examples of cellular regulators subject to conditional degradation by Clp proteases include the competence regulator ComK in Bacillus subtilis and the stationary phase Sigma factor, σS in E. coli and Salmonella Typhimurium.5-7 Staphylococcus aureus is an opportunistic pathogen that due to its profound ability to acquire resistance to antibiotics remains a major threat to human and animal health. We previously showed that the ClpP protease is required for virulence of S. aureus in a mouse abscess model.8 Global transcriptional, and proteomic analysis of clpP mutants further revealed that the absence of the ClpP protease results in massive changes in expression of genes and proteins related to pathogenicity and adaptation to stresses, indicating that ClpP controls the stability of global transcriptional regulators.9, 10 In S. aureus, ClpP can associate to the ClpATPases ClpC or ClpX to form either the ClpXP or the ClpCP proteases.11 While the ClpXP protease is essential for virulence and for the expression of virulence factors like hemolysins and extracellular proteases, the ClpCP protease is required for growth at high temperatures and at other conditions that elevate protein denaturation.8, 9, 11, 12 Despite the diverse phenotypes of the S. aureus clpP mutants, only a few ClpP substrates have been identified in this organism: ClpCP is responsible for the rapid degradation of three antitoxins (MazEsa, Axe1, and Axe2), while ClpXP degrades the N-terminal LexA fragment generated upon auto-cleavage of LexA in response to DNA damage.13, 14 The list of known ClpXP substrates in E. coli was greatly extended when Flynn and co-worker used a tagged, active-site mutant of ClpP to capture substrates in the inactive ClpP barrel.15 This ClpPtrap has the ability to accept and retain proteins translocated into the proteolytic chamber. However, as the translocated proteins are 4


Page 4 of 44

Page 5 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


not degraded they can be co-purified with the ClpPtrap complex and following electrophoresis, identified using mass-spectrometry.15, 16 Although the TRAP studies pointed to degradation motifs that destine proteins for ClpP-dependent degradation, it is still not possible to predict from the sequence or the structure of a protein, whether it will be a substrate for ClpP (reviewed by Baker and Sauer, 2006).17 To identify substrates of ClpP in S. aureus, we therefore constructed a staphylococcal ClpPtrap variant and expressed it in two different strains of S. aureus (8325-4 and Newman), and in strains lacking either the ClpX or ClpC ATPase. By using this approach we identified a high number of new potential ClpP substrates.

5



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Materials and Methods Bacterial strains and plasmids S. aureus strains were grown in Tryptic Soya Broth media (TSB) in Erlenmeyer flasks (with a 5:1 flask-to medium ratio) at 37°C, and with vigorous agitation (200 rpm). Chloramphenicol (10 µg/ml) was added as required. To generate the ClpPtrap, the active-site serine 98 was exchanged with an alanine (S98A) by amplifying the 3’ end of clpP including the serine codon using the primers: forward: 5´-GGATATCGGTATGGCTGCAGCAATGGG-3´, and reverse: 5´GCTCTAGATTAGTGATGATGATGATGATGACTACCACGTGGTACTAGTCCACTA CTTTTTGTTTCAGGTACCATCAC-3´. The forward primer contains the base substitution (in bold) which alters the serine codon (TCA) to an alanine codon (GCA) (italic). Furthermore, a 5´-EcoRV site was introduced (underlined). The reverse primer introduces a His-tag and a 5´-XbaI site (underlined). The PCR product was digested with EcoRV and XbaI and inserted into the pBluescriptKS+ (Stratagene) derivative pHI1879 that has the erythromycin resistance gene from pUC7 cloned into the NaeI site, resulting in pLOJ37. The 5’-end of clpP was amplified using the primers: forward: 5´CCAAGCTTGCGTCAAACAATGTAACTATTTAAAGTCAAAGTGTTTG-3´, and reverse: 5´-ACAAATTGTTTGAACATCAGGTTTAATGTG-3´. The PCR product was digested with HindIII (restriction site underlined in the forward primer) and inserted into pLOJ37 digested with HindIII and EcoRV, resulting in pLOJ38. This plasmid now contained the clpPtrap gene. The construct was sequenced to confirm the successful introduction of the S98A substitution and to verify the absence of other mutations. In order to be able to control expression of the clpPtrap gene, the clpPtrap including the

6


Page 6 of 44

Page 7 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Shine Dalgarno sequence but not the native promoter was amplified from pLOJ38 using the primers: forward 5´GATAGAATTCTTACAAGGAGGAAATATAGATGAATTTAATTCC-3´, and reverse 5´GATAGAATTCTTAGTGGTGGTGGTGGTGGTGTTTTGTTTCAGGTACCATCAC-3´. (EcoRI sites underlined), and via the EcoRI site cloned into the shuttle vector pRMC2, to put transcription of clpPtrap under control of the tetO promoter.18 The resulting plasmid was designated pJYF2. pJYF2 was used as template in Quickchange site directed mutagenesis (Stratagene) to construct pJYF6 that carries wildtype clpP C-terminally fused to His6 , (forward primer 5'ATTTGTATCGGTATGGCTGCATCAATGGGATCATTCTTATTAG-3' and reverse primer 5'-CTAATAAGAATGATCCCATTGATGCAGCCATACCGATACAAAT-3'). Plasmids pJYF2 and pJYF6 were first electroporated into S. aureus strain RN4220. From RN4220, pJYF2 was then transduced into S. aureus strain 8325-4∆clpP, 83254∆clpP∆clpX, 8325-4∆clpP∆clpC, and Newman∆clpP using phage ф11, to generate the strains used for trapping: JYF22 (8325-4∆clpP/pJYF2), JYF23 (83254∆clpP∆clpX/pJYF2), JYF24 (8325-4∆clpP∆clpX/pJYF2), JYF56 (Newman∆clpP/pJYF2). From RN4220, pJYF6 was transduced into S. aureus strain NCTC8325-4∆clpP, to generate the strain used as a negative control in the trapping experiments: JYF47 (8325-4∆clpP/pJYF6).

In vivo trapping of ClpP substrates Strains JYF22, JYF23, JYF24, JYF56, JYF47, and JYF48 were grown in 1 liter of TSB/Chloramphenicol (10 µg/ml) at 37°C to an OD600 of 0.4-0.5. At this point 400 ng/ml of the inducer anhydrotetracycline (AHT) was added and the cultures were

7



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

grown for 3 additional hours. Cells were harvested by centrifugation at 8,000 g for 10 min at 4°C, and resuspended in 4 ml of lysis buffer (50 mM NaH2PO4, 1 M NaCl, 5 mM imidazole, and 10% glycerol). Cell lysis was achieved by adding 5 µg/ml lysostaphin (Sigma-Aldrich) and incubating for 2 hours at 37°C with shaking, followed by physical disruption of cells using glass beads and FastPrep at 6.0 m/s for 45 seconds three times. The cell lysate was then centrifuged twice at 10,000 g for 30 min at 4°C, and the supernatant was collected. For purification of the ClpPtrap, the cleared cell lysate was incubated with 1.5 ml Ni-NTA agarose resin (Qiagen) for 2 hours with shaking on ice, and then packed into a column. The column was washed with 5 times volume of each of the buffers W20, W50 and W120, and the ClpPtrap was eluted with 3 times volume of the buffers W250 and W500. (W20, W50, W120, W250 and W500: 50 mM NaH2PO4, 1 M NaCl, 10% glycerol with respectively 20, 50, 120, 250 and 500 mM imidazole added; pH 8.0). The elution buffer was then exchanged into TE buffer and the proteins were upconcentrated by using the Amicon Ultra Centrifugal Filter Units with MW cut-off = 100 kDa. The protein concentration was measured by Bradford (Roti-Nanoquant). Three biological replicates were used to identify substrates of ClpC/XP, ClpXP and ClpCP in the 8325-4 background, while two biological replicates were used to identify substrates of ClpC/XP in the Newman background.

2-D PAGE and mass spectrometry 2-D PAGE was run as described before.19, 20 For IEF, the Multiphore II system from GE Healthcare was used with 200 µg of protein sample loaded onto Immobiline dry strips (7 cm, pH 4–7; GE Healthcare). For the second dimension, 12% SDS-PAGE 8


Page 8 of 44

Page 9 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


gels were run with Mini-Protean cells (Bio-Rad). After separation, the protein gels were fixed with 40% v/v ethanol and 10% v/v acetic acid for 1 h and subsequently stained by Coomassie blue silver.21 The gels were washed with distilled water until the background was clear. For mass spectrometry identification, the protein spots were excised from the stained 2-D gel using a spot cutter (Proteome WorksTM, Biorad, Hercules, CA, USA) with a picker head of 2 mm diameter. Cut spots were transferred into 96 well micro titer plates. The tryptic digest with subsequent spotting on a MALDI-target was carried out automatically with the Ettan Spot Handling Workstation (Amersham Biosciences, Uppsala, Sweden) using a modified standard protocol.22 The MALDI-TOF measurement was carried out on the 4800 MALDI TOF/TOF Analyzer (Applied Biosystems, Foster City, CA, USA). This instrument is designed for high throughput measurement, being automatically able to measure the samples, calibrate the spectra, and analyze the data using the 4000 Explorer™ Software V3.5.3. The spectra were recorded in a mass range from 900 to 3700 Da with a focus mass of 2000 Da. For one main spectrum 25 sub-spectra with 100 shots per sub-spectrum were accumulated using a random search pattern. If the autolytical fragment of trypsin with the mono-isotopic (M+H)+ m/z at 2211.104 reached a signal to noise ratio (S/N) of at least 10, an internal calibration was automatically performed as one-point-calibration using this peak. The standard mass deviation was less than 0,15 Da. If the automatic mode failed (in less than 1 %) the calibration was carried out manually. The MALDI-TOF-TOF measurements were carried out on the 4800 MALDI TOF/TOF Analyzer (Applied Biosystems, Foster City, CA, USA). From the TOF-spectra were measured the three strongest peaks. For one main spectrum 20 sub-spectra with 125 shots per sub-spectrum were accumulated using a random 9



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

search pattern. The internal calibration was automatically performed as one-pointcalibration with the mono-isotopic Arginine (M+H)+ m/z at 175,119 or Lysine (M+H)+ m/z at 147,107 reached a signal to noise ratio (S/N) of at least 5. The peak lists were created by using the script of the GPS Explorer™ Software Version 3.6 (build 332). Settings for TOF-MS were a mass range from 900 to 3700 Da, a peak density of 20 peaks per 200 Da, maximal 65 peaks per spot and an S/N ratio of 15. The TOF-TOF-MS settings were a mass range from 60 to Precursor - 20 Da, a peak density of 50 peaks per 200 Da and maximal 65 peaks per precursor. The peak list was created for an S/N ratio of 10. For database search the Mascot search engine Version: 2.1.04 (Matrix Science Ltd, London, UK) with a specific Staphylococcus aureus NCBI based sequence database was used. Protein scores greater than 55 are considered significant (p < 0.05)

LC-MS/MS Protein samples from the in vivo trapping experiments were prepared as described above. Protein concentrations were measured by Qubit protein assay kit (Invitrogen). Each sample was digested with trypsin (0.4 µg/ml) overnight at 37°C, desalted with ZipTips, µC18 (Millipore) and suspended in 5% acetonitrile /0.1% acetic acid. For LC-MALDI acquisition, peptides were separated on an Acclaim PepMap100 column (75µm x 15cm, C18, 3µm, 100A, Thermo-Scientific) with an 80 minute linear gradient of 2% – 100% acetonitrile (in 0.1% acetic acid) at 300 nl/min. using the Easy nLC from Thermo Proxeon. 550 spots were collected per LC run (15 sec per spot) with online mixing of 2 mg/ml alpha-cyano-4-hydroxycinnamic acid matrix (Bruker).

10


Page 10 of 44

Page 11 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


MS/MS spectra were acquired on the AB SCIEX TOF/TOFTM 5800 Analyzer (AB Sciex / MDS Analytical Technologies). The 20 strongest precursors per spot were gauged with DynamicExit. All datasets were analysed using ProteinPilotTM Software version 3.0 (using the ParagonTMAlgorithm) with a specific Staphylococcus aureus sequence database. Detected protein threshold [unused ProtScore (Conf.)] > 1.30 (95%).

Protein stability testing Cultures of 8325-4 and 8325-4∆clpP were grown in TSB at 37°C with shaking until the OD600 reached 0.8, and 150 µg/ml of chloramphenicol was then added. Immediately before (t=0) and 30, 60, 90 min after (t= 30, 60, 90) addition of chloramphenicol, 1 ml of cells were harvested. Cell pellets were resuspended in 200 µl 50 mM Tris-HCl (pH 8.0) and lysed by lysostaphin treatment (Sigma). 10 µl of each sample was loaded onto NuPAGE Bis-Tris gel (Invitrogen) and electrophoresis was carried out according to the manufacture’s instruction. After separation, proteins were transferred to a PVDF membrane (Invitrogen) using an XCell SureLock MiniCell system (Invitrogen) as recommended by the supplier. Detection of specific protein signal was performed by using the WesternBreeze Chemiluminescent AntiRabbit kit (Invitrogen). Primary antibodies: anti-RecA (from Cosmo Bio Co.), antiSle1 (from Motoyuki Sugai, Hiroshima University)23, anti-Spx (from Jakob Engman, Lund University)24, anti-TrfA (anti-MecA) (from Bill Kelley, Geneva University Hospital)25, and anti-CodY (from Linc Sonenshein, Tufts University).26 To test CodY stability in mupirocin-treated cells, 60 µg/ml mupirocin was added when OD600 reached 0.5, and 30 min later, 150 µg/ml of chloramphenicol was added to stop

11



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

protein synthesis. To test RecA stability in mitomycin-treated cells, 1 µg/ml mitomycin was added when OD600 reached 0.5, and 15 min later, 150 µg/ml of chloramphenicol was added to stop protein synthesis. In TSB, the clumping of 83254 following addition of mupirocin/mitomycin + chloramphenicol hampered reliable OD-measurements.27 Instead cells were grown in Müller-Hinton broth that prevented clumping of 8325-4 (J. Haaber, personal communication). 1 ml of cells was harvested immediately before mupirocin/mitomycin addition( t=0’), chloramphenicol addition (t=0), and 0.5 h and 3 h after chloramphenicol addition. Cell pellets were resuspended in 200 µl 50 mM Tris-HCl (pH 8.0) plus 0.1mM PMSF and lysed by lysostaphin. Clear cell extracts were obtained by centrifugation at 15.000 g for 20 min. Protein concentrations were determined by using Qubit protein assay (Invitrogen). 3 µg of total protein from each extract was used for western blotting.

Pulse-chase labeling followed by immuneprecipitation experiments To assay the stability of Sle1 in wild type and clp mutant, cells were grown in chemically defined medium (CDM).28 When OD500 reached 0.8 and 0.4 for the wild type and the clpP mutant cultures, respectively (corresponding to mid-exponential growth phase for respectively the wild type and the clpP mutant when grown in CDM), cells were labeled with L-[35S]-methionine (1.5mCi/100mL cell culture). After 45 min of labeling, radioactive methionine was chased by addition of 10 mM of cold methionine. 15 ml of culture was taken out immediately, and 10, 30 and 60 min after cold methionine was added. After centrifugation at 8,500 rpm, 4°C for 5 minutes, cell pellets were washed twice with TE-PMSF buffer. The washed pellet was resuspended in 400 µl of TE-PMSF buffer. For complete disruption of the cells, 30 µl

12


Page 12 of 44

Page 13 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


of lysostaphin (5mg/ml) were added into, followed by physical disruption of cells using glass beads and Precellys 24 (Bertin technologies) at 6800/m for 30 seconds for four times. Immunoprecipitation was done as described before.29 The samples were then separated by SDS-PAGE using Mini-Protean cells (Bio-Rad). After electrophoresis, gels were vacuum-dried and exposed to phosphor screens overnight. Autoradiographs were scanned with a TyphoonTM scanner (GE Healthcare).

RNA techniques RNA was isolated as described elsewhere with only a few modifications.30 Briefly, total RNA was isolated from cultures of 8325-4 and the clpP mutant in late exponential growth phase (OD600=2.0 +/-0.1). Prior to harvesting of bacterial cells RNA Protect (Qiagen, Hilden, Germany) was added according to the manufacturer’s instructions. RNA was isolated from bacterial pellets using manufacture`s “Fast prep” protocol for the RNeasy Mini-Prep Kit (Qiagen). To remove DNA, isolated RNA was treated with RNase-free DNase I (Roche, Penzberg, Germany) and total RNA was then purified using the RNeasy Mini Prep clean-up protocol as recommended by the manufacturer (Qiagen). The integrity of RNA was monitored by analysis with a bioanalyzer (Agilent Technologies). Only probes with an RNA integrity number of >9 were used in subsequent experiments.

Microarray analysis

13



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

For transcriptional profiling a custom-made S. aureus cDNA microarray was used (Scienion, Berlin, Germany) based on the genomic sequence of S. aureus N315 obtained from the Institute for Genomic Research (http://www.tigr.org). Each slide contained 6,336 features corresponding to duplicate copies of each ORF and several controls.9 The RNA was isolated from cultures in the late exponential growth phase at an OD600 of 2.0 at 37°C. Ten micrograms of total RNA was used for RT with random primers and Superscript III reverse transcriptase (Invitrogen). Fluorescent labelling was performed during the RT reaction by incorporating the dyes dCTP-Cy3 and dCTP-Cy5 according to the manufacturer’s instructions (Scienion, Berlin, Germany). Microarray hybridization and washing of slides were carried out as recommended by the manufacturer (Scienion, Berlin, Germany). The intensity of the fluorescence on the microarray was determined with a GenePix 4000B laser scanner (Axon Instruments Inc., Union City, CA), and individual signal intensities were analyzed using Acuity 4.0 software (Axon Instruments Inc.) according to the manufacturer’s instructions and linearly normalized. The obtained mean values and standard deviations of each gene were used to calculate significant changes in gene expression by applying one-sample t-test. Genes were considered to be upregulated in the clpP mutant when the RNA level was at least two-fold increased relative to the wild type. A two-fold lower RNA-level was considered to a downregulation of the gene. Data analysis was repeated on at least four independent microarray experiments.

14


Page 14 of 44

Page 15 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


15



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Results and Discussion Establishment of the ClpPtrap in S. aureus In E. coli it was previously shown that when the active site of ClpP is mutated, the inactive protease chamber functions as a “trap” that will retain but not degrade substrates translocated into the chamber.15 To identify new substrates of ClpP in S. aureus, an S. aureus ClpPtrap was constructed by substituting the active site serine with alanine (S98 → A98). To allow purification a C-terminal His-tag was added, and the His-ClpPtrap construct was expressed in S. aureus NCTC8325-4∆clpP under the control of the Ptet/oxy promoter that is inducible by anhydrotetracycline (AHT).18 For the in vivo trapping experiments, ClpPtrap expression was induced with AHT in midexponential growth phase (OD600=0.5), and cells were harvested 3 hours later (OD600=2.0-2.4) (Supplemental Fig. 1). The ClpPtrap and proteins trapped herein were purified and analysed by SDS-PAGE or two-dimensional gel analysis (2-D) (Fig. 1, lane 3 and Fig. 2). As controls, we purified in parallel proteins from the strain 8325-4∆clpP carrying the pRMC2 vector, and from the strain 8325-4∆clpP harbouring a His-tagged wild-type copy of clpP cloned under control of the AHT inducible promoter in pRMC2. As expected, no proteins appeared in the SDS-PAGE gel after purification of proteins from 8325-4∆clpP/pRMC2, demonstrating the specificity of the His-tag purification (Figure 1, lane 1). From the strain 83254∆clpP/pRMC2-clpPwt, approximately 20 proteins co-purified with the His-tagged ClpPwt (Fig. 1, lane 2). Since the His-tagged ClpPwt in this strain has an intact active site, substrates will be degraded upon entry into the ClpP-proteolytic chamber. Hence, the co-purified proteins do not represent trapped substrates but rather proteins that are non-specifically associated with the ClpP barrel. These proteins were separated by 2-D protein electrophoresis and identified by mass-spectrometry 16


Page 16 of 44

Page 17 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and are listed in Supplemental Table 1. In contrast the proteins that co-purified with the ClpPtrap (Fig. 1 lane, 3) but were not captured by His-ClpPwt represent putative substrates.

The ClpPtrap captures known ClpP substrates and unstable proteins Proteins that co-purified along with the ClpPtrap were separated by 2-D protein electrophoresis, and the identity of the protein spots was determined by MALDI-TOF mass spectrometry - Fig. 2. In this way we identified approximately 70 captured proteins representing potential ClpP substrates (Table 1). 2-D was used as the proteomic tool because it allows for comparisons of the abundance of the trapped proteins, and because it will separate posttranslationally modified versions of the same protein. This was important, as we hypothesized that proteins may be targeted for ClpP mediated degradation by specific modifications as for example phosphorylation. However, the 2-D analyses did not support this hypothesis. In an attempt to identify more trapped substrates, we additionally did gel-free LC-MALDITOF/TOF analysis, and this highly sensitive analysis identified more than 200 trapped proteins by two or more peptides (Supplemental Table 2). Importantly, the proteins identified with most confidence in this analysis agreed with those identified by the 2-D analysis. The first thing we noted was that several of the identified proteins were previously shown to be substrates of the Clp proteases in S. aureus or other bacteria (Table 2).31-35 Notable examples include Spx (global regulator of thiol-stress), McsB (adaptor protein for ClpC), CtsR (heat shock transcriptional regulator), FtsZ (regulator of cell division), and the ClpC adaptor protein, MecA. (To avoid confusion 17



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

with the mecA gene product involved in methicillin resistance we in the following use the designation TrfA (=teicoplanin resistance factor) proposed in accordance with the role of MecA/TrfA in glycopeptide resistance in S. aureus). 25 Additionally, 21 of the captured proteins were also identified as ClpP substrates in E.coli using a ClpPtrap and, finally, several proteins described as unstable in S. aureus or B. subtilis were captured in the ClpPtrap (Table 2).28, 29 These proteins include enzymes involved in DNA metabolism and transcription (NrdE, NrdF,GyrB, Pnp), a number of chaperones (DnaJ, DnaK, GroL, Tig, HslU, SecA, ClpX), as well as metabolic enzymes and biosynthesis proteins (GuaB, GuaA, LipA, GyrB, MetK, PnP, and Rho). The repeated capture of known ClpP substrates and unstable proteins in the ClpPtrap strongly supports that ClpP substrates are specifically co-purified with the ClpPtrap. To confirm that the trapped proteins are ClpP substrates in S. aureus, we examined the in vivo stability of selected proteins in wild-type and clpP mutant cells. For this experiment we focused on two abundantly trapped proteins, namely Spx and TrfA that are both degraded by ClpP in the closely related species Bacillus subtilis.6, 33, 36 Previously, Spx was suggested to be a substrate of ClpXP in S. aureus, as Spx accumulates in clpP and clpX mutants, despite that transcription of the gene is reduced.34 To verify that Spx is a substrate of ClpP in S. aureus, we inhibited protein synthesis with chloramphenicol (supplemental Fig. 2A and 2B) and followed the fate of Spx using Western blot analysis. The stability test shown in Fig. 3, clearly shows that while Spx was quickly degraded in wild-type cells, it was completely stable in the clpP mutant confirming that Spx indeed is a substrate of ClpP. Using a similar approach, we showed that while the level of TrfA was increased about 5 fold, and was stable in the absence of ClpP, TrfA also appeared stable in wild-type cells (Fig. 3). Accumulation of TrfA in the clpP mutant could be the result of reduced 18


Page 18 of 44

Page 19 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


degradation. Alternatively, increased synthesis of TrfA may cause its accumulation in the clpP mutant. Northern blot analysis revealed that trfA transcription is only modestly (

Trapping and Proteomic Identification of Cellular Substrates of the

Recommend Documents