Triggerable Mutually Amplified Signal Probe Based SERS

Subscriber access provided by EDINBURGH UNIVERSITY LIBRARY | @ http://www.lib.ed.ac.uk

Article

A Triggerable Mutually Amplified Signal Probe Based SERS-Microfluidics Platform for the Efficient Enrichment and Quantitative Detection of miRNA Zhenxing Wang, Sujuan Ye, Na Zhang, Xun Liu, and Menglei Wang Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.8b05172 • Publication Date (Web): 22 Mar 2019 Downloaded from http://pubs.acs.org on March 24, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

A Triggerable Mutually Amplified Signal Probe Based SERSMicrofluidics Platform for the Efficient Enrichment and Quantitative Detection of miRNA Zhenxing Wang, Sujuan Ye*, Na Zhang, Xun Liu, Menglei Wang Key Laboratory of Optic-electric Sensing and Analytical Chemistry for Life Science, MOE; State Key Laboratory Base for Eco-chemical Engineering; Shandong Key Laboratory of Biochemical Analysis; Key Laboratory of Analytical Chemistry for Life Science in Universities of Shandong; College of Chemistry and Molecular Engineering. Qingdao University of Science and Technology, Qingdao 266042, PR China. ABSTRACT: Sensitive detection of microRNAs (miRNAs) that serve as a disease marker could advance the diagnosis and treatment of diseases. Many methods used for quantitative detection of miRNAs, such as PCR-based approaches or the hybridization chain reaction, have presented challenges due to the complicated and time-consuming-procedures that are required. In this manuscript, a simple triggerable mutually amplified signal (TMAS) probe was designed and enriched within the center of a microfluidic chip and then used for one-step quantitative detection of microRNAs via surface enhanced Raman scattering (SERS) technology. First, many mutually amplified double strands are produced via an enzyme-free target-strand displacement recycling reaction initiated by the target miRNA, that result in the generation of an enhanced SERS signal. Second, microfluidic chips that utilize alternating current (AC) electrokinetic flow technology produce efficient mixing and rapid concentration to improve the DNA hybridization rate and further enhance the SERS signal intensity. This method enables the sensitive and rapid detection of miR-21 in human breast cancer cells within 30 min with a detection limit of 2.33 fM. Compared with traditional methods, this novel method overcomes the shortcomings resulting from complex operations, and has the advantages of high sensitivity, short assay time, and reduced sample usage.

MicroRNA (miRNA), which is a biomarker of many important diseases1, consists of short (19-23 bases), nonprotein-coding RNA molecules.2 Aberrant expression of miRNAs provides valuable information that can be useful for the early diagnosis of cancer.3-4 In fact, many miRNAs have already been utilized to predict tumor relapse and survival in patients. There are many strategies that use enzymatic or nonenzymatic DNA cycling amplification techniques to enhance the sensitivity of miRNA detection. For example, Miao et al. implemented a miRNA detection assay that used a triple signal amplification method with specific nuclease digestion and DNA-gold bridge nanoparticles.5 Wang et al. developed a signal-amplified detection method that used a split-DNAzyme-gold probe.6 The use of DNA cyclic amplification technology is an excellent way to enhance detection sensitivity. However, it can be quite difficult to use for sophisticated biomedical analysis and often requires timeconsuming reactions. Microfluidic technology, which involves the engineered manipulation of liquid at millisecond time scales and at submillimeter spatial scales, has been shown to have much promise for improving biological and diagnostic research. Recently, instead of a series of complex experimental steps, several integrated microsystems have been effectively combined with other techniques, for use in biomedical analysis.7-9 Microfluidic-based techniques have been developed for the detection of tumor-related miRNA and DNA. Chen et al. has developed a continuous-flow microfluidic process that can be used to amplify a targeted

miRNA signal.10 Shih et al. has established an individual DNA hybridization detection method that utilizes a microfluidics chamber.11 Among the various microfluidic control technologies, AC electrodynamics has been widely used in the field of bioactive molecule detection. With the aid of AC electrokinetics, irreversible electrochemical reactions can be avoided, and the use of an electrode can be combined with a microfluidic device to generate strong electrical fields with relatively small voltages.12-14 Within a microfluidic chip, the motion of particles and fluids is determined by dielectrophoresis (DEP)、 AC electrothermal and AC electroosmosis force. The dielectrophoresis (DEP) force, which is caused by the difference in the dielectric constant between a particle and its surrounding medium, is especially influential near the electrode edge, and can result in the motion of polarizable particles. Based on the relative magnitude of the polarizability of the particle and the medium, the DEP force can be classified as one of two types: positive and negative.15-16 When the particle is more polarizable than the medium, a positive DEP force will result that is directed toward a strong electric field. When the reverse is true, a negative DEP force will result that is directed toward a weak electric field. The AC electrothermal force is determined by the temperature gradient of the liquid that is induced by joule heating of the fluid.17-18 AC electrothermal flow occurs when a current frequency greater than 100 kHz acts on the electrode, during which electrode polarization can be ignored and the

ACS Paragon Plus Environment

Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

formation of bubble can be avoided.19-21 In a microfluidic chip, microfluidic electrodes are used as heat sources to generate heat continuously, which causes the temperature of the solution closer to the electrode to be greater and thereby generates a temperature gradient within the solution. This temperature gradient can result in changes in local density within the solution as well as the dielectric constant. These gradients act together within the fluid and drive it to move. Under conditions in which the current frequency is less than 1 MHz, AC electroosmosis will occur and cause the movement of liquid surrounding the electrode surface.22 The AC electroosmotic force can result in extensive fluid movement. Flowing liquids will constantly induce the solutes in the solution to move and concentrate them on the surface of the electrode. In opposition to the dielectrophoresis forces that can concentrate particles near the center of the electrode, AC electroosmotic flow permits the large-scale aggregation of targets.23-24 However, the advantages of microfluidic technology, such as its smaller size and reduced consumption, limit its application within traditional signal amplification technology based on DNA cycling reactions. During enzyme-assisted DNA cycling reactions, the enzyme is easily adsorbed onto the surface of the electrode, which decreases its sensitivity. Moreover, the DNA hybridization reaction creates a bottleneck that is one of the important factors that determines the total reaction time. Therefore, the development of an efficient method to shorten the time required for DNA hybridization is greatly desired for the detection of miRNA. To meet these challenges, a new type of triggerable mutually amplified signal (TMAS) probe was designed. An enzyme-free target-strand displacement recycling signal amplification (TS-DRSA) reaction was combined with a SERS microfluidics technique for the purposes of miRNA detection. This approach combines the advantages of the SERS signal amplification assay and microfluidic technology that utilizes alternating current (AC) electrokinetics.25-27 During the TS-DRSA reaction, many mutually amplified double strands are generated to enhance the intensity of the SERS signal. Meanwhile, the use of microfluidic technology with active mixing and improved enrichment can enhance the hybridization rate and further amplify the SERS signal. In this paper, we demonstrate that this quantitative detection method enables the sensitive and rapid monitoring of miRNA-21 (miR-21) within a complex biological matrix for 0.5 hours at femtomolar concentrations within a linear range from 10.0 fM to 10.0 nM.

EXPERIMENTAL SECTION Instrumentation: The instrument used for the reaction and detection processes was a laser excitation, two-channel SERS detection system. The instrument was composed of a reservoir microchip, a controllable electrode power supply, two microelectrodes, and a Raman detection system. A 5 mW HeNe laser operating at 633 nm was utilized to produce Rox Raman scattering, which was used for the quantitative and qualitative detection of the target miRNA. The collected Rox wavelength was 1499 cm-1. Microfluidic Chip Fabrication. The lift-off process was used to fabricate the microelectrode on the glass substrate. As shown in Figure 1A, the glass substrate was first attached with photoresist at a slewing speed of 300 rpm for 30 seconds with

a spin coater. The mask for the electrode pattern was printed and exposed on the layer of photoresist that coated the glass pane. Subsequently, the photoresist was developed and corroded in the region where the microelectrodes would be located. The patterned substrate was then coated with Ti and Au (Ti was used to improve the adhesion of Au and the substrate) and the residual photoresist was etched away. A photograph of the microelectrode is shown in Figure S1A. A concentric electrode design was used to generate three dimensional vortices within the microfluidic chamber. The diameter of the concentric electrodes was 1.5 mm, and the inner and outer diameters of the circular ring electrode were 2.5 mm and 4.0 mm, respectively. The distance between the concentric electrodes and the circular ring electrode was 500.0 µm. Figure 1B shows the overall design of the microfluidic device that was designed for miRNA detection. An acrylic plate (PMMA) mold that contained the patterns for the fluidic chamber and two microchannels, was constructed using photolithography. The fluidic chamber and the microchannels were prepared by pouring polydime-thylsiloxane28 (PDMS) into the PMMA mold. After degassing and curing, the PDMS components were bonded to the glass substrate with plasma cleaner. The fluidic chamber was 1.0 mm deep and 5.0 mm in diameter, and the microchannels were 1.0 mm deep and 1.0 mm wide. One end of a flexible pipe (1.0 mm in diameter) was inserted into one end of each microchannel via a punched 1.0 mm hole to complete the fabrication of the sampling channel. Preparation of the TMAS Probe. The sequences of the oligonucleotides that were used are shown in Table 1. The AuNPs were synthesized using the citrate reduction method; a detailed description of the method used is given in the supporting information. TMAS probes are functionalized DNA AuNPs. Two types of TMAS probes were manufactured via the following methods. For the preparation of the TMAS-1 probe, H1 hairpin DNA strands containing a 3’-thiol and Roxmodified T in the middle of the DNA were incubated in 90 °C water for approximately 5 min and then allowed to cool to room temperature. Fifty microliters of a solution containing 1.0 μM of H1 strands were mixed into 1.0 mL of a freshly prepared gold nanoparticle (AuNP) solution and shaken for approximately 16 h at 37 °C in a constant temperature vibrato r. The thiol-modified H1 strands were immobilized on the surfaces of the AuNPs via a covalent gold−thiol bond. Subsequently, 200.0 μL of 0.05 M NaCl was blended with the mixture, and then 200.0 μL of 0.1 M NaCl was added after 6 hours to enhance the stability of the TMAS probe. After 6 hours, the redundant H1 strands in the supernatant were removed by centrifugation for 30 min at 10000 rpm. To wash the TMAS probes, the red sediment was dispersed in 0.01 M phosphate buffer (PBS, pH 7.4) and centrifuged three times. For the preparation of the TMAS-2 probe, H2 hairpin DNAs containing a 3’-thiol and a Rox-modified T in the middle of the DNA) were processed according to the abovedescribed method. The prepared TMAS probes were eventually dispersed in 0.01 M PBS (pH 7.4). Polyacrylamide Gel Electrophoresis. First, H1 and H2 DNA strands were annealed at 95 °C for 5 min and cooled to room temperature prior to use. Second, 100.0 mL of 50 × TAE was prepared by mixing deionized water, glacial acetic acid, Tris and Na2EDTA•2H2O. Next, a 17.5% polyacrylamide gel was prepared with 40% PAGE Pre-Solution, TEMED, 10%


Page 2 of 9

Page 3 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry APS, 50 × TAE and deionized water. Later, the gel was added into the glass tank with the 1.0 mL transfer liquid gun until the glass was filled with the gel. In addition, an electrophoretic comb was inserted into the gel to form the lanes and the gel was frozen for 2.5 h. Next, the electrophoretic comb was pulled out, 1 × TAE was poured into the electrophoretic pool and 110 V was applied for 10 min. Next, 10.0 μL of DNA and 1.5 μL of 6 × loading buffer was mixed and 10.0 μL of the mixture was pipetted into a lane,; 200 V was applied for 6 min and then 125 V was applied for 110 min until the bright bands reached the last 1/4 of the gel. Finally, the gel was stained with GelRed for 1h1 h and imaged through UV. miRNA Analysis with the Microfluidic Device. Different concentrations of miR-21 were added to a microfluidic device containing the TMAS-probe solution, which contained the TMAS-1 and TMAS-2 probes 8.0 μL PBS. At the same time, 6.0 V was applied to the microfluidic device to complete the mixing process. SERS detection was initiated after 30 min of incubation. The SERS measurements were obtained with a Renishaw Invia Raman microscope equipped with a 633 nm HeNe laser using streamline mode with a 20 × objective lens. The power of the laser directed onto the sample was 0.5 mW, the accumulation time was 3 s, and the exposure time was 1 s. The diameter of the laser spot was 1.0 µm. WiRE Raman Software version 3.4 Renishaw Ltd. was used to acquire and analyze the Raman data. Ten different locations were used for the measurement of each sample, and the average value was used as the final SERS result. The experiments were completed in triplicate and the standard deviation of the average value is represented by the error bars. When combining the linear measurement data, the detection limit of this method can be determined by the following formula.

transferred to the microfluidic chip. The experimental procedure that was used was the same as that described as above. Table 1. Sequences of the Oligonucleotides Oligonucleotides Name

5’-GTTAGCATATCAGACAT-RoxTATCAA GGCATCAACATTAGTCTGATAAGCTAAC -SH-3’

H2

5’-GACATTATCAAGGCATGT-RoxAGCTT ATCAGACTAATGTTGATGCCTTGATAAT GTC-SH-3’

miR-21

5’-UAGCUUAUCAGACUGAUGUUGA-3’

miR-203

5’-GUGAAAUGUUUAGGACCACUAG-3’

miR-200

5’-CUGUGCGUGUGACAGCGGCUGA-3’

miR-141

5’-UAACACUGUCUGGUAAAGAUG-3’

RESULTS AND DISCUSSION Principle of Quantitation Underlying the miR-21 Using the TMAS Probe. A TS-DRSA SERS microfluidic platform was fabricated that was used for the sensitive detection of miR-21. In Figure 1B, the TMAS nanoprobes shown are DNA-functionalized AuNPs. Each AuNP is coated with a single layer of dense DNA strands that are attached via a gold−thiol bond. The probes utilize the superior properties of AuNP, such as its SERS-enhancing efficiency31-32 and its ability to increase the probability of DNA hybridization33 due to the adsorption of AuNPs. The TMAS-1 nanoprobe contains H1 hairpin DNA strands that are immobilized on AuNP, named, while TMAS-2 contains complexes of H2-AuNP. Each probe also contains Rox-modified bases in the middle of

3𝑚

Cmin

( )

3𝑚 𝑥min = lg ; 𝑥min = ; C = 10 fM 𝑘 min

Sequences

H1

𝑘

fM

where Cmin represents the detection limit, xmin represents the abscissa of the linear measurement curve, and m and k represent the standard deviation of the signal obtained from the blank solution and the slope of the linear measurement curve, respectively 29-30. miRNA Analysis in Eppendorf (EP) Tubes. First, the TMAS-1 and TMAS-2 probes were prepared according to the previously described method used for the synthesis of the TMAS probes, and the prepared probes were dispersed in 30.0 μL of PBS solution. Subsequently, samples with different concentrations of miR-21 were added to EP tubes containing the two newly prepared TMAS probes. The mixture was placed in a 37 °C constant temperature oscillator and incubated with shaking for 2 hours. Finally, 1.0 μL of the mixture solution was withdrawn with a pipette and placed onto the surface of the gold plate. The SERS measurements were obtained from these the drops. Ten locations were used for each sample, and each experiment was repeated three times. Determination of the miR-21 Content in the Cell Lysates. The cell lysates was prepared by disrupting different numbers of cells with an ultrasonic cell disruptor, which were then dispersed in 10 μL of 0.01 M PBS buffer. The cell lysates obtained from 50, 100, 150 and 200 MCF-7 cells were dispersed in 10.0 μL of TMAS probe solution and then



Page 4 of 9

Figure 1. (A) Fabrication process used to place a microelectrode on the glass substrate. (B) The schematic diagram depicting the use of the double-signal amplification mechanism-based SERSmicrofluidics platform for the measurement of miR-21.

Figure 2. (A) Electrokinetic schematic diagram showing the Raman signal intensity at the location of the center electrode. The Raman signal intensity prior to applying voltage (B), when the voltage is applied (C), and when the circuit is broken (D) is also shown.

the H1 or H2 DNA strands that serve as Raman signal molecules. Figure 1B shows the approximate position of Rox (in pink) in the probe. In the absence of miR-21, Rox is far from the AuNPs; thus, the TMAS probes are in the “off” state. In the presence of miR-21, the TS-DRSA reaction is activated and the miR-21-H1 intermediate is formed, which opens the hairpin structure of H1. After that, the sticky end of H1 binds to the H2 hairpin strand. Because the H1/H2 duplex is more stable than the hybridization of miR-21 and H1, this initiates a competing reaction that displaces miR-21. A complex is formed between TMAS-1 and TMAS-2, which allows both of the Rox molecules to interact with the AuNPs so the TMAS probes are in the “on” state. miR-21 is then released into the solution, where it hybridizes with another H1 strand to trigger successive reaction cycles. As a result, many mutuallyamplified double strands are produced, which results in the enhancement of the SERS signal due to the increasing number of Rox that are allowed to interact with the AuNPs. AC Electrokinetic Effects of the Microfluidic Chip for Enhanced SERS Signal Detection. In our experiment, the working current frequency was set to 300 kHz, and the working voltage was set to 6.0 V. The temperature of the electrode can reach 50 °C, and the temperature of the upper solution is approximately 40 °C. Therefore, the total force in the microfluidic reaction chamber is due to electrothermal, AC electroosmotic, and dielectrophoretic forces. Due to the combined actions of the electrothermal and AC electroosmotic forces, bulk fluid flow will occur, and the reactants will continue to move in the microfluidic reaction chamber. Simultaneously, the dielectrophoretic force will push the particles onto the surface of the central electrode34, which will result in the enrichment of the TMAS probes within the microfluidic reaction chamber. Figure 2A and Video S1 show the motion trajectories of the molecules within microfluidic chips. To investigate the effects of the probe on enrichment, the change in the Raman signals at 1499 cm-1 at the location of the central electrode were also characterized before and after the chip was electrified using Raman mapping imaging of the surface of the central electrode. As shown in Figure 2B, before switching on the circuit, relatively weak Raman signals were observed due to probe scattering in the solution. After

switching on the circuit, the particles rapidly changed their direction of movement and became concentrated in the central electrode area. As shown in Figure 2C, the Raman signal intensity was clearly increased when the circuit was connected, and the Raman signal intensity decreased after the circuit was disconnected (Figure 2D). These experimental results demonstrate that the microfluidic chip has a great capacity to aggregate nanoparticles and enhance Raman signaling. The Ability to Detect miR-21 with the SERSmicrofluidic Platform. The experiments that evaluated the hybridization of the TMAS probes in microfluidic devices were conducted by UV−visible spectroscopy. The UV-visible spectra generated by the signal probes (H1, H2: Rox-DNA), miR-21, AuNPs and TMAS probes were monitored using a Cary 50 UV/Vis-NIR spectrophotometer. In Figure 3A, curves a, b, and c exhibit the absorbance characteristic of AuNPs (~520 nm), 5.0 μM miR-21 (~260 nm) and H1/H2 (Rox-DNA, ~260 nm and ~600 nm), respectively. The characteristic absorption peaks of Rox-DNA and AuNPs appeared simultaneously in curve d, which indicated that the Rox-DNA had successfully conjugated with the AuNPs.

Figure 3. (A) UV-visible spectra generated by the AuNPs (a), 5.0 μM miR-21 (b), 5.0 μM H1/H2 (Rox-DNA) (c), and TMAS Probes (d). (B) SERS spectra generated by the AuNPs (a), and SERS spectra generated by the TMAS probes before and after the


Page 5 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry reaction (b, c). 10.0 pM of miR-21 was used. (C) Gel electrophoresis characterization of the experiment. Lane 0: Marker. Lane 1: H1 (1.0 µM). Lane 2: H2 (1.0 µM). Lane 3: miR21 (1.0 µM). Lane 4: H1 and H2 (0.5 µM). Lane 5: H1, H2 (both 0.5 µM), and miR-21 (1.0 µM).

The feasibility of the use of the TS-DRSA reaction was also investigated. In Figure 3B, the results obtained from a pure AuNP solution, which generated no signal, are shown (curve a). The TMAS probes then were dispersed in PBS buffer. In the absence of miR-21, the TMAS-2 probe maintained a stemloop structure and the Rox was separated from the AuNPs, which resulted in the observation of only a very weak Raman signal (curve b). In the presence of 10.0 pM miR-21, the TSDRSA reaction was initiated and the resulting increase in Raman signaling (curve c) demonstrated the feasibility of this method for the detection of miR-21. The polyacrylamide gel electrophoresis diagram further demonstrates the feasibility of the method. In Figure 3C, lanes 1, 2, and 3 shows the hairpin strands H1, H2 and miR-21, respectively. No new bright bands appear in lane 4, which contains a mixture of H1 and H2, and this proves that H1 and H2 will not interact without the presence of the target miRNA. A new bright band appears at a higher position in lane 5, which contains a mixture of H1, H2 and target miRNA, and this band does not appear at this position in any other lane except 3. This result demonstrates the complete feasibility of this method. Optimization of Assay Conditions. Because they serve as both a substrate and a carrier, the size of the AuNPs is an important factor that effects the stability and signal intensity of the TMAS probe.35 We synthesized AuNPs with different diameters (16.0 to 45.0 nm), which are shown in the TEM images in Figure 4 (A-D). In Figure 4E, the Raman intensity of Rox (the characteristic peaks of 1499 cm−1) demonstrates that the size of the AuNPs has a great influence on the enhancement effects of the AuNPs. Based on Figure 4F, it can be concluded that the maximum enhancement effects occur with a nanoparticle size of 35.0 nm. The Raman intensity at 45.0 nm slightly declined. This finding is in line with the results of other studies.36-37 Based on the above results, 35.0 nm was shown to be the optimal AuNP diameter in terms of the enhancement of Raman signaling.

Figure 4. (A-D) TEM image of AuNPs with different diameters. (E) SERS spectra and (F) signal intensities corresponding to AuNPs of different sizes.

To develop the sensitive SERS microfluidics assay, the effects of the incubation time were investigated. A detailed

description of the optimization of the solution pH and temperature is provided in the supporting information (Figures S2, SI). Under optimal conditions, the effect of the reaction time was investigated. Figure 5A reveals the relationship between the Raman intensity and incubation time used for miR-21. The results revealed that the Raman signal intensity reached a maximum after 30 min. Thus, 30 min was the optimum incubation time for the assay.

Figure 5. Effect of the reaction time on SERS intensity generated with the SERS microfluidics platform (A) and EP tubes (B). The uniformity in detecting miR-21 is based on a concentration of 10.0 nM being used in the SERS-microfluidics platform (C) and EP tubes (D).

Evaluation of the Performance of miR-21 Detection with the SERS-microfluidics Platform. In optimized conditions, different concentrations of miR-21 were analyzed with the SERS microfluidics platform. In Figure 6A, it is shown that the intensity of the Raman signal increases as the concentration of miR-21 is increased. Moreover, the Raman intensity at 1499 cm−1 exhibits a linear relationship with the logarithm of the miR-21 concentrations, which is shown in Figure 6C. The equation obtained from the linear regression is y = 1934.1 + 1194.1 lg x, where y is the signal intensity at 1499 cm−1, x is the ratio of CmiR-21 to 1.0 fM and the square of the correlation coefficient (R2) is 0.9982. The standard deviation for each triplicate experiment is represented by error bars. A relative standard deviation (RSD) of 8.3% was obtained by 11 replicate measurements of 10.0 pM miR-21, which indicates that the assay has good reproducibility. The calculated limit of detection (LOD) for this method was 2.33 fM, which was obtained with the equation LOD = 103m/k fM 1617. Compared with traditional microfluidic chip methods38-39, the strategy used here is unique in several advantageous ways: (i) during the TS-DRSA reaction, many mutually-amplified double strands are produced that enhance the intensity of the SERS signal, and the enrichment of the SERS probes enables further enhancement of the SERS signals due to AC electrokinetic effects; (ii) microfluidic chips can be reused after a simple cleaning procedure and have good reusability; iii) microfluidic chips that utilize alternating-current electrokinetic flow technology can produce efficient mixing to improve the DNA hybridization rate, which greatly reduces the detection time.



Page 6 of 9

To assess the uniformity of the SERS microfluidics platform, ten different positions on the SERS microfluidics platform were selected for the measurement of Raman intensity at 1499 cm−1 (CmiR-21= 10.0 pM). In Figure 5C, it can be seen that there are no significant differences in the intensities of the ten resulting Raman spectra. This result reflects the excellent uniformity of the SERS microfluidics platform. The calculated value of the standard deviation is 2.32%, which again provides excellent proof. The standard deviation was estimated by the following formula:40

∑(𝑥 ― 𝑥)2 𝑠=√ 𝑥 × 100% 𝑛―1 where x represents the Raman intensity for each test, 𝑥 represents the average value of the Raman intensity at n time, and n is the number of tests. Comparison of TS-DRSA Assays with Different Modes. For a proof-of-concept demonstration of signal amplification during the SERS microfluidics assay, a series of control experiments were performed for miR-21 detection. With optimized conditions (shown in Figures 5B and S2), the analytical performance of the TMAS probes were measured in EP tubes. First, the signal uniformity of the detection of miR21 in EP tubes was investigated, and the final experimental results are shown in Figure 5D. The calculated value of the standard deviation is 7.46%, which is higher than that of the SERS microfluidics assay. The comparison of the results shows that the uniformity of detection in EP tubes is lower than that in the SERS microfluidics platform. Different concentrations of miR-21 were simultaneously analyzed, as shown in Figure 6B. Figure 6D shows that the signal intensity increased as the miR-21 concentration increased from 10.0 fM to 10.0 nM. The equation obtained from the linear regression was y = 3452.4 + 767.6 lg x (the square of the correlation coefficient was 0.9937); a relative standard deviation (RSD) of 11.6% was obtained by 11 replicate measurements of 10 pM miR-21, which implies a relatively poor linear correlation and reproducibility. Compared with the TS-DRSA assays conducted in EP tubes, the TS-DRSA assays conducted in the SERS microfluidics platform have some advantages: (i) the reagent mixing, reaction, detection and washing steps are integrated within the chip, a shorter assay time (Figure 5A) is required for experiments (30 min compared with 120 min for EP tubes; Figure 5B), and an increased uniformity in signaling was obtained during the detection of miR-21; (ii) microfluidic chips based on alternating-current electrokinetic flow technology can produce efficient enrichment that improves detection sensitivity and reproducibility.

Figure 6. SERS spectra for different concentrations of miR-21 detected with the SERS microfluidics platform (A) and EP tubes (B). Variability in the signal intensity that was correlated with the concentration of miR-21 was detected when using the SERS microfluidics platform (C) and EP tubes (D), respectively.

Selectivity of Detecting miR-21 with the SERSMicrofluidics Platform. To investigate the selectivity of the SERS microfluidics method, changes in signal intensity due to interference were assessed. Here, miR-200, miR-141, miR-203, miR-21 and a mixture were tested separately with the SERS microfluidics platform. In Figure 7A, the corresponding Raman intensities obtained for 1.0 nM miR-200, miR-141 and miR-203 are as low as that obtained for the blank sample. In contrast, when 10.0 pM of the target miR-21 is measured alone or in the presence of interference, a high Raman signal can be detected regardless. All of these results demonstrate that this method exhibits high specificity for miR-21 analysis.

Figure 7. (A) Specificity of the detection of miR-21 compared to that of miR-200, miR-141, and miR-203 at a concentration of 1.0 nM for miR-200, miR-141, miR-203 and 10.0 pM for miR-21. (B) The average miR-21 content of the lysates containing different numbers of living cells detected by the SERS microfluidic platform is shown. The average content of miR-21 with different numbers of cells (50, 100, 150, 200) is also shown.

Investigation of the Reusability of Microfluidic Chip. To investigate the reusability of microfluidic chip, the same microfluidic chip was used for repeated experiments. Before each test, the microfluidic chip was treated with ultrasound for three minutes and then washed three times with deionized water. After ten cycles of the reusability process, the Raman signals that were obtained were almost as high as the original values, which indicate good reusability of the microfluidic chip (Figure S3).


Page 7 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry Determination of miR-21 Content in Cell Lysates. To assess the capability for detecting miR-21 in a complex biological matrix, we detected the content of miR-21 in cell lysates from the same batch that contained different numbers of living cells. A comparison experiment is shown in Figure 7B. The data show that detection results will change as the number of cells in the cell lysate is increased, which confirms that the SERS microfluidic method can be applied to detection in a complex biological matrix.

CONCLUSION In summary, we developed an SERS microfluidics system that utilizes signal amplification for the detection of miRNAs that combines the advantages of SERS signal amplification assays and microfluidic technology based on AC electrokinetics. Using a TMAS probe, the SERS microfluidics method can provide sensitive and rapid detection of miR-21 within 30 min and with a detection limit of 2.33 fM. Meanwhile, the AC electrokinetic effect also improves both the reproducibility and uniformity of this method, and the SERS microfluidics system exhibits reusability, which greatly reduces consumption associated with detection. This novel method could offer an effective approach for the rapid and sensitive quantitative detection of other biomolecules.

ASSOCIATED CONTENT Supporting Information Additional information can be found as noted in the text. This material is available free of charge via the Internet at http://pubs.acs.org. Experimental Section: Materials and Reagents, Equipment, Preparation of Gold Nanoparticles (AuNPs), Cell Culture; Results and Discussion: Characterization of Microfluidic Electrodes, Optimization of the Reaction Temperature and pH, Visualization of the Particle Trajectories. Figure S1-S3, Video S1, Table S1.

AUTHOR INFORMATION Corresponding Author *E-mail: yesujuan2010@126. com.

Notes The authors declare no competing financial interests.

ACKNOWLEDGMENTS This work was financially supported by the Natural Science Foundation of China (Grants 21775081), the Postdoctoral Science Foundation of China (Grants 2015M572074), Shandong Provincial Key Laboratory Open Fund (ZDSYS-KF201501), Key Laboratory Open Fund, SATM201602.

REFERENCES (1) Ma, F.; Liu, W.; Zhang, Q.; Zhang, C. Y. Sensitive detection of microRNAs by duplex specific nuclease-assisted target recycling and pyrene excimer switching. Chem. Commun. 2017, 53, 10596-10599. (2) Chen, X.; Ba, Y., Ma, L.; Cai, X.; Yin, Y.; Wang, K.; Guo, J.; Zhang, Y.; Chen, J.; Guo, X.; Li, Q.; Li, X.; Wang, W.; Zhang, Y.; Wang, J.; Jiang, X.; Xiang, Y.; Xu, C.; Zheng, P.; Zhang, J.; Li, R.; Zhang, H.; Shang, X.; Gong, T.; Ning, G.; Wang, J.; Zen, K.; Zhang, J.; Zhang, C. Y. Characterization of MicroRNAs in Serum: A Novel Class of Biomarkers for Diagnosis of Cancer and Other Diseases. Cell Res. 2008, 18, 997-1006. (3) Thompson, M. A.; Casolari, J. M.; Badieirostami, M.; Brown, P.

O.; Moerner, W. E. Three-Dimensional Tracking of Single mRNA Particles in Saccharomyces Cerevisiae using a Double-Helix Point Spread Function. Proc. Natl. Acad. Sci. 2010, 107, 17864-17871. (4) Qian, R. C.; Lv, J.; Long, Y. T. Controllable AggregationInduced Exocytosis Inhibition (CAIEI) of Plasmonic Nanoparticles in Cancer Cells Regulated by MicroRNA. Mol. Pharm. 2018, 15, 40314037. (5) Bo, B.; Zhang, T.; Jiang, Y.; Cui, H.; Miao, P. Triple Signal Amplification Strategy for Ultrasensitive Determination of MiRNA Based on Duplex Specific Nuclease and Bridge DNA-Gold Nanoparticles. Anal. Chem. 2018, 90, 2395-2400. (6) Wu, Y.; Huang, J.; Yang, X.; Yang, Y.; Quan, K.; Xie, N.; Li, J.; Ma, C.; Wang, K. Gold Nanoparticle Loaded Split-DNAzyme-Probe for Amplified miRNA Detection in Living Cells. Anal. Chem. 2017, 89, 8377-8383. (7) Gorkin, R.; Park, J.; Siegrist, J.; Amasia, M.; Lee, B. S.; Park, J. M.; Kim, J.; Kim, H.; Madou, M.; Cho, Y. K. Centrifugal Microfluidics for Biomedical Applications. Lab. Chip. 2010, 10, 1758-1773. (8) Li, N.; Zhang, W.; Lin, L.; He, Z. Y.; Khan, M.; Lin, J. M. Live imaging of cell membrane-localized MT1-MMP activity on a microfluidic chip. Chem. Commun. 2018, 54, 11435-11438. (9) Fan, Y. Y.; Dong, D. F.; Li, Q. L.; Si, H. B.; Pei, H. M.; Li, L.; Tang, B. Fluorescent analysis of bioactive molecules in single cells based on microfluidic chips. Lab. Chip. 2018, 18, 1151-1173. (10) Guo, S.; Lin, W. N.; Hu, Y.; Sun, G.; Phan, D. T.; Chen, C. H. Ultrahigh-Throughput Droplet Microfluidic Device for Single-cell miRNA Detection with Isothermal Amplification. Lab. Chip. 2018, 18, 1914-1920. (11) Qi, J.; Zeng, J.; Zhao, F.; Lin, S. H.; Raja, B.; Strych, U.; Willson, R. C.; Shih, W. C. Label-free, in Situ SERS Monitoring of Individual DNA Hybridization in Microfluidics. Nanoscale. 2014, 6, 8521-8526. (12) Bown, M. R.; Meinhart, C. D. AC Electroosmotic Flow in A DNA Concentrator. Microfluid. Nanofluid. 2006, 2, 513-523. (13) Cheng, I. F.; Yang, H. L.; Chung, C. C.; Chang, H. C. A Rapid Electrochemical Biosensor Based on An AC Electrokinetics Enhanced Immuno-Reaction. Analyst. 2013, 138, 4656-4662. (14) Sin, M. L. Y.; Shimabukuro, Y.; Wong, P. K. Hybrid Electrokinetics for Separation, Mixing, and Concentration of Colloidal Particles. Nanotechnology. 2009, 20, 165701-165710. (15) Pethig, R. Dielectrophoresis: Using Inhomogeneous AC Electrical Fields to Separate and Manipulate Cells. Crit. Rev. Biotechnol. 1996, 16, 331-348. (16) Voldman, J. Electrical Forces for Microscale Cell Manipulation. Annu. Rev. Biomed. Eng. 2006, 8, 425-454. (17) Wong, P. K.; Wang, T. H.; Deval, J. H.; Ho, C. M. Electrokinetics in micro devices for biotechnology applications. IEEE-ASME T. MECH. 2004, 9, 366-376. (18) Sin, M. L. Y.; Gau, V.; Liao, J. C.; Haake, D. A.; Wong, P. K. Active Manipulation of Quantum Dots using AC Electrokinetics. J. Phys. Chem. C. 2009, 113, 6561-6565. (19) González, A.; Ramos, A.; Morgan, H.; Green, N. G.; Castellanos, A. Electrothermal Flows Generated by Alternating and Rotating Electric Fields in Microsystems. J. Fluid. Mech. 2006, 564, 415-433. (20) Prabhakaran, R. A.; Zhou, Y.; Patel, S.; Kale, A.; Song, Y.; Hu, G.; Xuan, X. Joule Heating Effects on Electroosmotic Entry Flow. Electrophoresis. 2017, 38, 572-579. (21) Liu, W.; Ren, Y.; Tao, Y.; Yao, B.; Li, Y. Simulation Analysis of Rectifying Microfluidic Mixing with Field ‐ Effect ‐ Tunable Electrothermal Induced Flow. Electrophoresis. 2017, 39, 779-793. (22) Ramos, A.; Morgan, H.; Green, N. G.; Castellanos, A. Ac Electrokinetics: A Review of Forces in Microelectrode Structures. J. Phys. D. Appl. Phys. 1999, 31, 2338-2353. (23) Wong, P. K.; Chen, C. Y.; Wang, T. H.; Ho, C. M. Electrokinetic Bioprocessor for Concentrating Cells and Molecules. Anal. Chem. 2004, 76, 6908-6914. (24) Choi, S.; Goryll, M.; Sin, L. Y. M.; Wong, P. K.; Chae, J. Microfluidic-Based Biosensors Toward Point-of-Care Detection of Nucleic Acids and Proteins. Microfluid. Nanofluid. 2011, 10, 231-247.



(25) Green, N. G.; Ramos, A.; González, A.; Castellanos, A.; Morgan, H. Electrothermally Induced Fluid Flow on Microelectrodes. J. Electrost. 2001, 53, 71-87. (26) Wu, J.; Ben, Y. X.; Battigelli, D.; Chang, H. C. Long-Range AC Electroosmotic Trapping and Detection of Bioparticles. Ind. Eng. Chem. Res. 2005, 44, 2815-2822. (27) Pohl, H. A.; Crane, J. S. Dielectrophoretic Force. J. Theor. Biol. 1972, 37, 1-13. (28) Xia, Y.; Whitesides, G. M. Soft Lithography. Angew. Chem., Int. Ed, 1998, 37, 550-575. (29) He, Y.; Yang, X.; Yuan, R.; Chai, Y. Switchable TargetResponsive 3D DNA Hydrogels as A Signal Amplification Strategy Combining with SERS Technique for Ultrasensitive Detection of miRNA 155. Anal. Chem. 2017, 89, 8538-8544. (30) Radi, A. E.; Acero, Sánchez. J. L.; Baldrich, E.; O'Sullivan, C. K. Reagentless, Reusable, Ultrasensitive Electrochemical Molecular Beacon Aptasensor. J. Am. Chem. Soc. 2006, 128, 117-124. (31) Li, Y.; Ma, Z. Facile Fabrication of Truncated Octahedral Au Nanoparticles and its Application for Ultrasensitive Surface Enhanced Raman Scattering Immunosensing. Nanotechnology. 2013, 24, 275605-275612. (32) Mu, Z. D.; Zhao, X. W.; Xie, Z.; Zhao, Y. J.; Zhong, Q. F.; Bo, L.; Gu, Z. Z. In Situ Synthesis of Gold Nanoparticles (AuNPs) in Butterfly Wings for Surface Enhanced Raman Spectroscopy (SERS). J. Mater. Chem. B. 2013, 1, 1607-1613. (33) Silvestrini, M.; Ugo, P. Ensembles of Nanoelectrodes Modified with Gold Nanoparticles: Characterization and Application to DNAHybridization Detection. Anal. Bioanal. Chem. 2013, 405, 995-1005. (34) Du, J. R.; Wei, H. H. Focusing and Trapping of DNA Molecules by Head-on Ac Electrokinetic Streaming Through Join Asymmetric Polarization. Biomicrofluidics. 2010, 4, 3766-3779. (35) Fang, P. P.; Li, J. F.; Yang, Z. L.; Li, L. M.; Ren, B.; Tian, Z. Q. Optimization of SERS Activities of Gold Nanoparticles and GoldCore-Palladium-Shell Nanoparticles by Controlling Size and Shell Thickness. J. Raman. Spectrosc. 2010, 39, 1679-1687. (36) Hong, S.; Li, X. Optimal size of gold nanoparticles for surfaceenhanced Raman spectroscopy under different conditions. J. nanomater. 2013, 49, 1-9. (37) Zeman, E. J.; Schatz, G. C. An Accurate Electromagnetic Theory Study of Surface Enhancement Factors for Silver, Gold, Copper, Lithium, Sodium, Aluminum, Gallium, Indium, Zinc, and Cadmium. J. Phys. Chem. B. 1987, 91, 634-643. (38) Kang, T.; Kim, H.; Lee, J. M.; Lee, H.; Choi, Y. S.; Kang, G.; Seo, M. K.; Chung, B. H.; Jung, Y.; Kim, B. Ultra-Specific Zeptomole MicroRNA Detection by Plasmonic Nanowire Interstice Sensor with Bi-Temperature Hybridization. Small. 2014, 10, 42004206. (39) Novara, C.; Chiadò, A.; Paccotti, N.; Catuogno, s.; Esposito, C. L.; Condorelli, G.; Franciscis, V. D.; Geobaldo, F.; Rivolo, P.; Giorgis, F. SERS-active metal-dielectric nanostructures integrated in microfluidic devices for label-free quantitative detection of miRNA. Faraday Discuss. 2017, 27, 37-38. (40) Wohland, T.; Rigler, R.; Vogel, H. The Standard Deviation in Fluorescence Correlation Spectroscopy. Biophys. J. 2001, 80, 29872999.


Page 8 of 9

Page 9 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

For TOC only

9 ACS Paragon Plus Environment

Triggerable Mutually Amplified Signal Probe Based SERS

Recommend Documents