Tubulin Inhibitors from an Endophytic Fungus Isolated from Cedrus

Feb 6, 2013 - (1, 2) These endophytes also interfere with biosynthetic pathways of the host plants and .... 4, 50, 71, 26, 0, 23, 59 ..... 1995, 58, 1...
2 downloads 0 Views 4MB Size
Download PDF
Article pubs.acs.org/jnp

Tubulin Inhibitors from an Endophytic Fungus Isolated from Cedrus deodara Manjeet Kumar,†,‡ Masroor Qadri,§,‡ Parduman Raj Sharma,⊥ Arvind Kumar,† Samar S. Andotra,† Tandeep Kaur,⊥ Kamini Kapoor,∥ Vivek K. Gupta,∥ Rajni Kant,∥ Abid Hamid,⊥ Sarojini Johri,§ Subhash C. Taneja,† Ram A. Vishwakarma,† Syed Riyaz-Ul-Hassan,*,§ and Bhahwal Ali Shah*,† †

Natural Product Microbes, Indian Institute of Integrative Medicine, Canal Road, Jammu-Tawi, 180001, India Microbial Biotechnology Division, Indian Institute of Integrative Medicine, Canal Road, Jammu-Tawi, 180001, India ⊥ Cancer Pharmacology Division, Indian Institute of Integrative Medicine, Canal Road, Jammu-Tawi, 180001, India ∥ Post-Graduate Department of Physics, University of Jammu, Jammu-Tawi, 180006, India §

S Supporting Information *

ABSTRACT: From an endophytic fungus, a close relative of Talaromyces sp., found in association with Cedrus deodara, four compounds including two new ones (2 and 4) were isolated and characterized. The structures of two compounds (1 and 4) were confirmed by X-ray crystallography. The compounds displayed a range of cytotoxicities against human cancer cell lines (HCT-116, A-549, HEP-1, THP-1, and PC-3). All the compounds were found to induce apoptosis in HL-60 cells, as evidenced by fluorescence and scanning electron microscopy studies. Also, the compounds caused significant microtubule inhibition in HL-60 cells.

E

history of the endophyte, inferred with the neighbor-joining method10 and based on the analysis of the 18S-ITS1 ribosomal gene sequence (GenBank Acc. No. JQ769262). The sequence showed highest similarity (93%) with Talaromyces trachyspermus, followed by 90% similarity with Talaromyces ucrainicus and 86% with Talaromyces f lavus and Penicillium sp. The sequence also displayed a similarity of 85% with Paecilomyces pascuus, however, with lower sequence coverage (87%). The data indicate that the endophyte is related to the Talaromyces, the teleomorphic stage of Penicillium and Paecilomyces. However, as the sequence similarity is only 93%, it cannot be assigned to a particular genus and species. Thus, this organism shows significant taxonomic novelty and was therefore selected for the potential isolation of novel bioactive molecules. Fermentation and Isolation of Secondary Metabolites. The fungus was cultured in potato dextrose broth (PDB) medium for 15 days with constant shaking. The fermentation broth was then extracted with dichloromethane following the National Cancer Institute’s protocol.12 The extract was concentrated in vacuo, and the crude mixture was subjected to column chromatography on silica gel using hexane−ethyl acetate, leading to the isolation of pure compounds 1−4. Two of the isolated compounds were identified as (−)-ramulosin (1)13 and (−)-epoformin (3),14 whereas compounds 2 and 4

ndophytes have proved to be an excellent source of new bioactive molecules including antibiotics, antioxidants, and anticancer, antiviral, immunosuppressive, and antidiabetic agents.1,2 These endophytes also interfere with biosynthetic pathways of the host plants and sometimes produce the metabolites of the host plant, e.g., paclitaxel from Taxomyces andreanae,3 camptothecin from Entrophospora inf requens,4 and podophyllototxin, vinblastine, and vincristine from an Alternaria sp.,5 thus offering great promise for the isolation of new molecules. In this article, we report the isolation and characterization of two new (2 and 4) and two known metabolites, i.e., (−)-ramulosin (1) and (−)-epoformin (3), from an endophytic fungus isolated from the plant Cedrus deodara. The structures of the metabolite 1 and 4 were defined by X-ray crystallography. The phylogentic analysis of the fungus showed that it is related to the Talaromyces, the teleomorphic stage of Penicillium and Paecilomyces; the genus Penicillium has also proven to be a rich source of biologically active compounds6 such as antibiotics,7 isocoumarins,8 and antifungal agents.9 The isolated metabolites were screened for their in vitro cytotoxicity against different human cancer cell lines. Importantly, all the isolated metabolites induced cell death chiefly by apoptosis and displayed microtubule inhibition in human leukemia (HL-60) cell lines.

■

RESULTS AND DISCUSSION

The organism DEF3 (NFCCI-2857) in nature was found associated with C. deodara. Figure 1 shows the evolutionary © 2013 American Chemical Society and American Society of Pharmacognosy

Received: September 27, 2012 Published: February 6, 2013 194

dx.doi.org/10.1021/np3006666 | J. Nat. Prod. 2013, 76, 194−199

Journal of Natural Products

Article

Figure 1. The evolutionary history of DEF3 was inferred using the neighbor-joining method. The optimal tree with the sum of branch length = 0.68880060 is shown. Numbers on branches represent the bootstrap values.11

(δH 2.48) and H-5 (δH 1.97, 1.37), H-5 (δH 1.97, 1.37) and H-6 (δH 1.73, 1.37), and H-6 (δH 1.73, 1.37) and H-7 (δH 4.26− 4.27). The NMR (1H and 13C) shifts of 2 at C-3 and C-4a were similar to those of 1, suggesting that the stereochemistry at C-3 and C-4a was C-3S and C-4aR, respectively. The stereochemistry at C-7 was elucidated to be C-7S, as it did not show any correlation with C-4a in the NOESY. Thus, the structure of compound 2 was elucidated as (3S,4aR,7S)-7,8-dihydroxy-3methyl-3,4,10,5,6,7-hexahydro-1H-isochromen-1-one. The molecular formula of compound 4 was determined to be C9H14O2 by HRESIMS and supported by NMR experiments. 1 H and 13C NMR spectra confirmed the presence of nine carbon atoms and 14 proton signals, including a methyl group. The IR (KBr) spectrum showed absorption bands at 1073 and 1698 cm−1, indicating the presence of etheral C−O stretching (1073 cm−1) and a carbonyl function (1698 cm−1), respectively. 1 H NMR reveals that the methyl group is attached to CH-3, showing a doublet at δH 1.11, which in turn shows an upfield signal at δH 3.67−3.71 due to direct linkage with an etheral O group. The proton signals for CH2-8 split in the spectra, having two multiplets at δH 2.79 (1H) and δH 2.47−2.50 (1H) due to the CH-1. Also signals for CH2-9 split into two multiplets at δH 1.75 (1H) and δH 2.05 (1H) due to CH-1 and CH-5 stereocenters. Cross-peak correlations were shown in the HMBC spectrum between H-8 (δH 2.79, 2.48) and the carbonyl group C-7 (δC 208.4), H-1 (δH 4.42−4.43) and C-3 (δC 63.7), and H-6 (δH 2.56−2.57) and C-7 (δC 208.4). Furthermore, a H-1 and H-8 linkage has been confirmed by a 1 H−1H COSY correlation between H-1 (δH 4.42−4.43) and H8 (δH 2.48). Similarly the linkage of 3→6 has also been

were new. The structures of compounds 1 and 4 were confirmed by X-ray crystallography.

Figure 2. Structures of compounds 1−4.

Structure Elucidation. The molecular formula of compound 2 was determined as C10H14O4 by HRESIMS and NMR experiments. 1H and 13C NMR spectra confirmed the presence of 10 carbons and 14 protons, including methyl and hydroxyl groups. The IR (KBr) spectrum showed absorption bands at 1643 and 3418 cm−1, exhibiting the presence of an α,βunsaturated ester group (1643 cm−1) and a hydroxy (3418 cm−1) group, respectively. The complete structural elucidation of 2 as well as assignment of all 1H and 13C NMR signals was based on 2D NMR experiments (HMBC, HSQC, and COSY). 1 H NMR spectra revealed that the methyl group is attached to C-3, having a doublet at δH 1.37 (J = 6.3 Hz), whereas the methine proton is located as a multiplet at δH 4.48−4.50. The H-7 was assigned to a doublet (J = 4.4 Hz) at δH 4.26−4.27. Cross-peak correlations were clearly depicted in the HMBC spectrum between H-4a (δH 2.48) and C-8a (δC 96.40). Furthermore, the linkage of 3→7 was also confirmed by 1H−1H COSY correlations between H-3 (δH 4.48−4.50, m) and H-4 (δH 1.97, 1.73), H-4 (δH 1.97, 1.73) and H-4a (δH 2.48), H-4a

Table 1. 1H and 13C NMR Chemical Shifts (ppm) of Compounds 2 and 4 in CDCl3 pos. 1 2 3 4 4a 5 6 7 8 8a 9

δH (J in Hz) (2)

4.48−4.50 (m) 1.97 (m), 1.73 (m) 2.48 (m) 1.97 (m), 1.37 (m) 1.73 (m), 1.37 (m) 4.26−4.27 (d)

1.34−1.41 (d, J = 6.3 Hz)

δC, type (2)

HMBC correlations

pos.

170.82, C

C-7

76.92, CH 36.32, CH2 33.12, CH 27.61, CH2 24.46, CH2 64.96, CH 171.53, C 98.40, C 22.39, CH3

C-4a, C-5 C-4a, C-5, C-6 C-3, C-4, C-5, C-6, C-9 C-4, C-4a, C-6 C-5, C-7 C-4, C-5, C-6 C-4, C-4a, C-5, C-6 C-4, C-4a, C-5, C-6, C-7 C-4, C-5, C-6 195

1 2 3 4 5 6 7 8 9 10

δH (J in Hz) (4)

δC, type (4)

HMBC correlations

4.42−4.43(m)

70.11, CH

C-3, C-8

3.67−3.71(m) 1.58−1.59(m) 2.46 (m) 2.56−2.57(m)

63.71, CH 39.28, CH2 27.98, CH 46.96, CH2 210.14, C 47.16, CH2 31.34, CH2 22.34, CH3

C-4, C-6, C-1, C-4, C-1, C-1, C-5, C-3,

2.79 (m), 2.47−2.50 (m) 1.75(m), 2.05(m) 1.11 (d, J = 5.9 Hz)

C-10 C-8, C-10 C-3, C-4, C-6, C-10 C-8, C-9 C-6, C-8 C-6, C-8 C-6, C-9, C-10 C-4

dx.doi.org/10.1021/np3006666 | J. Nat. Prod. 2013, 76, 194−199

Journal of Natural Products

Article

Figure 3. (A) ORTEP view of compound 1. (B) ORTEP view of compound 4.

confirmed by 1H−1H COSY correlations between H-3 (δH 3.67−3.71) and H-4 (δH 1.58−1.59), H-4 (δH 1.58−1.59) and H-5 (δH 2.46), and H-5 (δH 2.46) and H-6 (δH 2.56−2.57). The stereochemistry was deduced as 1S*, 3R*, 5R* through Xray crystallography of compound 4. Thus, the structure of compound 4 was elucidated as (1S*,3R*,5R*)-3-methyl-2-oxabicyclo[3.3.1]nonan-7-one. ORTEP15 views of compounds 1 and 4 with their atomic labelings are shown in Figure 3. The data indicate that in compound 1, the cyclohexene ring (A) has a distorted sofa conformation, while the heterocyclic ring (B) adopts a sofa conformation. In compound 4, ring B adopts a normal chair conformation. Biological Activity. The sulforhodamine B cytotoxicity assay was performed using the four isolated compounds and the positive controls on a panel of human cancer cell lines of various origins. The following cell lines were used: colon (HCT-116), lung (A-549), liver (HEP-1), leukemia (THP-1), and prostate (PC-3). The isolated molecules displayed a range of cytotoxicity as shown in Table 2. (−)-Epoformin was found Table 2. Cytotoxicity of the Isolated Molecules sample

conc, μM

1 2 3 4 paclitaxel fluorouracil mytomycin C

50 50 50 50 1 20 1

lung, A-549 (%)

liver, HEP-1 (%)

leukemia, THP-1 (%)

prostate, PC-3 (%)

colon, HCT (%)

15 35 98 71 82 22

23 3 100 26

54 40 50 0 71 84

23 34 22 23

44 35 56 59 72 55

59

Figure 4. (A−H) Scanning electron microscopy of untreated (A, B) and 2 (C, D)-, 3 (E, F)-, and 4 (G, H)-treated HL-60 cells showing surface ultrastructure. The untreated cells show microvilli on the cell surface (A, B, arrow). Treatment with 50 μM 2 (C, D), 3 (E, F), and 4 (G, H), respectively, after 30 h causes condensation, smoothening of cell surface, and blebbing of the plasma membrane (C−H, white arrows) and the formation of apoptotic bodies (C−H, asterisks). (Magnification A, C, E, G: 2000×; B, D, F, G: 5000×.)

to be the most active, followed by compounds 4, 1, and 2, respectively. Further experiments were carried out to obtain mechanistic insights into their mode of action. Fluorescence and Scanning Electron Microscopy. In an attempt to gain insight into cell death, compounds 1−4 were evaluated for their ability to induce apoptosis. In the present study we used morphological analysis by scanning electron microscopy (SEM) to identify the specific type of death of HL60 cells in both the control and treatment groups.16,17 It revealed that untreated HL-60 cells were spherical, having microvilli on the entire surface and with a few surface projections (Figure 4A, B). On incubation of the cells with

30 μM 1−4 for 30 h, condensation, smoothening of the cell surface, and blebbing of the plasma membrane in a few cells were noted, which represent the morphological features of apoptotic cells (data not shown). However, after 30 h of treatment with the isolated compounds at 50 μM, the number 196

dx.doi.org/10.1021/np3006666 | J. Nat. Prod. 2013, 76, 194−199

Journal of Natural Products

Article

microtubule organization compared to the untreated cells. Paclitaxel treatment at 1 μM for 24 h caused the stabilization of tubulin in the polymer form (data not shown). Although all the tested compounds showed significant influence on microtubules in THP-1-treated cells, compound 2 was observed to be the most potent in disintegrating microtubule organization, which eventually resulted in apoptotic cell death as observed in this study. Further studies are under way to isolate additional metabolites from this fungus. Additional studies on compounds 1−4 are aimed at elucidating more details of their molecular mode of action.

of cells and features of apoptosis increased in all the treated cells to various degrees (Figure 4C−H). The results were further corroborated by nuclear morphological changes of HL-60 cells. The HL-60 cells were chosen since most of the isolated molecules were found to be active against this leukemia cell line. HL-60 cells were treated with 50 μM of each compound for 30 h and subsequently stained with DAPI. Cells were observed under a fluorescence microscope (40×). The untreated cells have large intact nuclei (Figure 5A).

■

EXPERIMENTAL SECTION

General Experimental Procedures. MPs were measured in a Buchi-510 apparatus. 1H NMR and 13C NMR spectra in CDCl3 were recorded on Bruker ARX 200 and 500 MHz spectrometers with TMS as an internal standard. Chemical shifts are expressed in parts per million (δ ppm); J values are given in hertz. Reagents and solvents used were mostly AR grade. Silica gel coated aluminum plates from Merck were used for TLC. HRESIMS were recorded on an Agilent Technologies G6540-UHD LC/MS Q-TOF. Optical rotations were measured on a Perkin-Elmer 241 polarimeter at 25 °C using sodium D light. Growth medium RPMI-1640, minimum essential medium, fetal calf serum (Gibco), trypsin, penicillin-G, sulforhodamine dye, streptomycin, DMSO, and phosphate-buffered saline used were high-quality analytical and molecular biology grade. Sample Collection. Twigs of Cedrus deodara, not showing any signs of disease, were collected from Lolab Valley in the Western Himalayas of Kashmir (34°31′13″ N, 74°22′55″ E), transported to the lab in paper bags, and stored at 4 °C until processed. Plant materials were washed thoroughly in running tap water, cut under sterile conditions into small pieces (2−5 cm), and surface sterilized with 1% sodium hypochlorite and 70% alcohol for 30 s each. Before the alcohol treatment, sodium hypochlorite was washed off with a rinse in sterile distilled water. After drying under the sterile laminar air flow in a biosafety hood and passing through the flame, the outer tissues were removed and the internal tissues were cut into smaller pieces of 0.5 to 1 cm and plated on water agar (Difco, USA). The plates were incubated at 25 °C for three weeks. Hyphal tips of this particular isolate emerging out of the plant tissues plated on water agar were picked and plated on potato dextrose agar (PDA). After the proper incubation of the plates, the 7-day-old culture was preserved by placing pieces of hyphal growth in 15% glycerol and storing at −70 °C. The fungal culture DEF3 has been submitted to the National Fungal Culture Collection of India (NFCCI) under the accession no. NFCCI2857. Phylogenetic Analysis of ITS1-5.8S-ITS2 Ribosomal Gene Sequence. Phylogenetic analysis of DEF3 was carried out by the acquisition of the 18S-ITS1 ribosomal gene sequence. The fungus was grown on PDA for 7 days, and DNA templates were prepared by the CTAB method.10 The ITS regions of the fungus were amplified with the universal ITS primers ITS4 (5′ TCCTCCGCTTATTGATATGC 3′) and ITS5 (5′ GGAAGTAAAAGTCGTAACAA 3′) using the polymerase chain reaction (PCR). The PCR conditions used were as follows: initial denaturation at 94 °C for 3 min, followed by 30 cycles of 94 °C for 15 s, 50 °C for 30 s, 72 °C for 45 s, and a final extension at 72 °C for 5 min. The 50 μL reaction mixture contained 1× PCR buffer, 200 μM each dNTP, 1.5 mM MgCl2, 10 pmol of each primer, 1−5 ng of DNA, and 2.5 U of Taq DNA polymerase. The amplified product (5 μL) was visualized on 1% (w/v) agarose gel to confirm the presence of a single amplified band. The amplified products were purified by Amicon Ultra columns (Millipore, USA), and 20−40 ng was used in a 10 μL sequencing reaction using the Big Dye Terminator sequencing kit (v. 3.1) with 2 pmol of the forward or the reverse primer in the cycle sequencing reaction. Twenty cycles of 96 °C for 10 s, 50 °C for 5 s, and 60 °C for 4 min were performed, and the extension products were purified by ethanol precipitation, dissolved in

Figure 5. Effect of compounds 1 to 4 on nuclear morphology of HL60 cells. The cells were treated with 50 μM of different compounds for 30 h and subsequently stained with DAPI as described in the Experimental Section. Cells were observed under a fluorescence microscope (40×). The untreated cells (A) have large-sized intact nuclei. All four compounds, 1 (B), 2 (C), 3 (D), and 4 (E), induced the condensation and fragmentation of nuclei (white arrows) due to apoptosis. A greater number of apoptotic cells was seen in treatment with compound 2 (D).

The treatment induced the condensation and fragmentation of nuclei (arrow) due to apoptosis (Figure 5B−E), with the greatest number of apoptotic cells seen by treatment with compound 2. Effect of Compounds 1−4 on Microtubules by Immunoflouroscense Microscopic Studies. Microtubules are attractive targets for chemotherapeutic agents.18 Since these play an important role in the regulation of the mitotic progression, disrupting the assembly of microtubules can induce cell cycle arrest in the M phase and trigger apoptosis.19 The microtubule inhibitors such as vinca alkaloids, colchicinoids, and combretastatin inhibit tubulin polymerization,20 and the microtubule promoters, such as taxanes and epothilones, promote or stabilize the tubulin polymer form.21 We investigated the effect of compounds 1−4 on the microtubule structure in leukemia cells using confocal microscopy. As shown in Figure 6, the treatment of THP-1 cells for 48 h with 50 μM 1−4 showed a remarkable disruption and loss of 197

dx.doi.org/10.1021/np3006666 | J. Nat. Prod. 2013, 76, 194−199

Journal of Natural Products

Article

Figure 6. Effect of compounds 1−4 on microtubules in THP-1 cells. Cells were plated on coverslips. After 24 h, the cells were treated with 1−4 for 48 h at 50 μM. Immunocytochemical staining was conducted using anti-α-tubulin antibody and Alexa Flour-488-labeled secondary antibody. Nuclei were stained with DAPI (left panel indicated by arrows). The data are representative of three separate sets of experiments. Compounds 1, 2, and 4 cause the fragmentation of nuclei (white arrows) due to apoptosis. 10 μL of HiDi formamide, incubated at 95 °C for 1 min, and loaded on an ABI Prism 377 genetic analyzer (Perkin-Elmer, USA) for sequencing. All the reagents for sequencing were from Applied Biosystems, USA. The amplified products were sequenced and aligned with the sequences in GenBank by the BLASTN program.22 Relevant sequences were downloaded, and a phylogenetic tree was constructed according to Tamura et al.23 The ribosomal gene sequence of this endophytic fungus has been submitted to GenBank under Accession No. JQ769262. Fermentation and Preparation of Extracts. The organism was grown in PDB broth at 25 °C for 15 days with constant shaking at 200 rpm. The broth was initially inoculated with 1% of 7-day-old seed prepared by inoculating 3 mm plugs of the fungus into 100 mL of PDB. Upon harvest, 10% of the volume of the whole broth of MeOH was added, and the entire culture was high-shear homogenized to disrupt fungal cells. The broth was extracted according to the National Cancer Institute’s12 protocol; that is, homogenized whole broth was transferred to a separating funnel with an equal volume of DCM added. Following shaking and separation of layers, the DCM phase was withdrawn and the organic solvent removed by rotary evaporation. The organic extract was then subjected to column chromatography on silica gel with ethyl acetate− hexane (85:15) as eluent. (3S,4aR,7S)-7,8-Dihydroxy-3-methyl-3,4,10,5,6,7-hexahydro1H-isochromen-1-one (2): colorless semisolid, [α]25D −40.0 (c 1.0, CHCl3); IR (neat) νmax 3418 (br), 2925, 1643 cm−1; HRESIMS (m/z) 199.2226 [M + H]+ (calcd for [C10H14O4 + H]+ 199.2221).

(1S,3R,5R)-3-Methyl-2-oxabicyclo[3.3.1]nonan-7-one (4): colorless solid, mp 98−100 °C; [α]25D +28.0 (c 1.0, CHCl3); IR (neat) νmax 3377, 2932, 1698, 1073 cm−1; HRESIMS (m/z) 155.2142 [M + H]+ (calcd for [C9H14O2 + H]+ 155.2139). Cell Lines, Growth Medium, and Treatment Conditions. The human cancer cell lines, colon (HCT-116), lung (A-549), liver (HEP1), leukemia (THP-1), and prostate (PC-3), were procured from European Collection of Cell Culture (ECACC), UK. Cells were grown in RPMI-1640 medium supplemented with 10% fetal calf serum (FCS) and 1% penicillin-G. Penicillin-G was dissolved in phosphate-buffered saline (PBS) and sterilized by filtering through 0.2 μm filter in a laminar air flow hood. Cells were cultured in a CO2 incubator (New Brunswick, Galaxy 170R, Eppendorf) with an internal atmosphere of 95% air and 5% CO2 gas, and the cell lines were maintained at 37 °C. The medium was stored at low temperature (2−8 °C). The medium for cryopreservation contained 20% FCS and 10% DMSO in growth medium. Cell Cytotoxicity Assay. The sulforhodamine B (SRB) assay was performed, in which cell a suspension of optimum cell density (8000− 14 000 cells/100 μL) was seeded and exposed to a 50 μM concentration of 1−4 in the culture medium. The cells were incubated with the test samples for 48 h. Then the cells were fixed by adding 50 μL of ice-cold Trichloroacetic acid for 1 h at 4 °C. After 1 h, the plates were washed five times with distilled water and allowed to dry in the air. This was followed by the addition of 100 μL of 0.4% SRB dye for 0.5 h at room temperature. Plates were then washed with 1% v/v acetic 198

dx.doi.org/10.1021/np3006666 | J. Nat. Prod. 2013, 76, 194−199

Journal of Natural Products

■

acid to remove the unbound SRB. The bound dye was solublized by adding 100 μL of 10 mM Tris buffer (pH = 10.05) to each well. The plates were put on the shaker platform for 5 min to solublize the dye completely, and finally the reading was taken at 540 nm.24 Fluorescence and Scanning Electron Microscopy. HL-60 cells were seeded in six-well tissue culture plates at a density of 2 × 105 cells per mL in complete medium supplemented with 10% FCS in the presence and absence (as controls) of compounds 1−4 at 50 μM concentrations for 30 h. The stock solution was prepared in DMSO and added to the medium to achieve the desired final concentration. The control samples were treated with DMSO vehicle alone. To assess the mechanism of cell death after incubation for specified times at 37 °C, the cells were processed for fluorescent microscopic and SEM studies. For SEM, HL-60 cells in both the control and treatment were processed.25 Briefly the cells on the coverslip were fixed immediately with 2.5% glutaraldehyde in 0.1 M phosphate buffer (pH 7.2) at 4 °C for 1 h, postfixed with 1% OsO4 for 1 h in the same buffer, dehydrated in acetone, dried in a critical point drier using CO2 (Blazer’s Union), and coated with gold using a sputter coater (Polaron). The specimens were examined with a JEOL-100CXII electron microscope with ASID at 40 kV. For fluorescent DAPI staining, air-dried smears of HL-60 cells were fixed in methanol at −20 °C for 20 min, air-dried, and stained with DAPI at 1 μg/mL in PBS at room temperature for 20 min in the dark, and the slides were mounted in glycerol−PBS (1:1) and examined in an inverted fluorescence microscope (Olympus, 1X81). Immunofluorescence Microscopic Studies. For the detection of tubulins, THP-1 cells were used. THP-1 cells (1 × 105 cells/well) were seeded onto 18 mm square coverslips in six-well plates in complete medium. Cells were allowed to adhere for 24 h and were treated with 30 and 50 μg/mL concentrations of compounds 1, 3, 2, and 4, respectively, for 48 h. Paclitaxel at 1 μM for 24 h was used as a positive control. After the treatment period, cells were fixed in 4% paraformaldehyde for 10 min at room temperature and permeabilized using 0.5% Triton-X in PBS for 5 min. The cells were blocked with 10% goat serum for 20 min at room temperature. Microtubules were detected with a monoclonal α-tubulin antibody (Sigma) diluted at 1:100 in 0.1% Triton X-100 in PBS for 1 h at room temperature and Alexa Fluor 488 conjugated secondary antibody (Invitrogen) diluted 1:500 in PBS for 1 h at room temperature. Cells were then washed three times in PBS and stained with 4′,6-diamidino-2-phenylindole (DAPI 1 μg/mL in PBS). The coverslips were mounted over glass slides, and cells were imaged by a laser scanning confocal microscope (Olympus Fluoview FV1000).

■

ACKNOWLEDGMENTS We thank CSIR, New Delhi, for financial assistance. Also M.K. and M.Q. thank CSIR and ICMR, New Delhi, for the award of research fellowships.

■

REFERENCES

(1) (a) Strobel, G.; Daisy, B. Microbiol. Mol. Biol. Rev. 2003, 67, 491− 502. (b) Strobel, G.; Daisy, B.; Castillo, U.; Harper, J. J. Nat. Prod. 2004, 67, 257−268. (2) (a) Pimentel, M. R.; Molina, G.; Dionisio, A. P.; Marostica, R. M., Jr.; Pastore, G. M. Biotech. Res. Int. 2011, 576286. (b) Zhao, J.; Zhou, L.; Wang, J.; Shan, T.; Zhong, L.; Liu, X.; Gao, X. Current Research, Technology and Education Topics in Applied Microbiology and Microbial Biotechnology; Mendez-Vilas, A., Ed.; Formatex Research Center: Badajoz, Spain, 2012; Vol. 1, pp 567−576. (3) Stierle, A.; Strobel, G. A.; Stierle, D. Science 1993, 260, 214−216. (4) Puri, S. C.; Verma, V.; Amna, T.; Qazi, G. N.; Spiteller, M. J. Nat. Prod. 2005, 68, 1717−1719. (5) (a) Guo, B.; Li, H.; Zhang, L. J. Yunnan Univ. 1998, 20, 214−215. (b) Cao, L.; Huang, J.; Li, J. Food Ferment. Ind. 2007, 33, 28−32. (6) (a) Kozlovsky, A. G.; Soloveva, T. F. Prikl. Biokhim. Mikrobiol. 1985, 21, 579−586. (b) Kozlovsky, A. G. Proc. Jpn. Mycotoxicol. 1990, 32, 31−34. (c) Kozlovsky, A. G.; Marfenina, O. G.; Vinokurova, N. G.; Zhelifonova, V. P.; Adanin, V. M. Mikrobiologiya 1997, 66, 112−116. (7) (a) Edrada, R. A.; Heubes, M.; Brauers, G.; Wray, V.; Berg, A.; Gräfe, U.; Wohlfarth, M.; Muhlbacher, J.; Schaumann, K.; Bringmann, G.; Proksch, P. J. Nat. Prod. 2002, 65, 1598−1604. (b) Shiomi, K.; Matsui, R.; Isozaki, M.; Chiba, H.; Sugai, T.; Yamaguchi, Y.; Masuma, R.; Tomoda, H.; Chiba, T.; Yan, H.; Kitamura, Y.; Sugiura, W.; Omura, S.; Tanaka, H. J. Antibiot. 2005, 58, 65−68. (8) Findlay, J. A.; Buthelezi, S.; Lavoie, R.; Rodriguez, L. P.; Miller, J. D. J. Nat. Prod. 1995, 58, 1759−1766. (9) Khokhar, I.; Mukhtar, I.; Mushtaq, S. Arch. Phytopathol. Plant Prot. 2011, 44, 1347−1351. (10) Ausubel, F. M.; Brent, R.; Kingston, R. E.; Moore, D. D.; Seidman, J. G.; Smith, J. A.; Struhl, K. Current Protocols in Molecular Biology; John Wiley & Sons: New York, NY, 1994; pp 2.9.1−2.9.15. (11) Tamura, K.; Dudley, J.; Nei, M.; Kumar, S. Mol. Biol. Evol. 2007, 24, 1596−1599. (12) McCloud, T. G. Molecules 2010, 15, 4526−4563. (13) (a) Enders, D.; Kaiser, A. Synthesis 1996, 209−214. (b) Islam, M. S.; Ishigami, K.; Watanabe, H. Tetrahedron 2007, 63, 1074−1079. (14) (a) Yamamoto, E.; Mizuta, T.; Henmi, T.; Yamatodani, S. J. Takeda Res. Lab. 1973, 32, 532−538. (b) Barros, M. T.; Maycock, C. D.; Ventura, M. R. Tetrahedron 1999, 55, 3233−3244. (15) Farrugia, L. J. J. Appl. Crystallogr. 1997, 30, 565. (16) Rello, S.; Stockert, J. C.; Moreno, V.; Gámez, A.; Pacheco, M.; Juarranz, A.; Canete, M.; Villanueva, A. Apoptosis 2005, 10, 201−208. (17) Salido, M.; Gonzalez, J. L.; Vilches, J. Mol. Cancer Ther. 2007, 6, 1292−1299. (18) Attard, G.; Greystoke, A.; Kaye, S.; De, B. J. Pathol. Biol. 2006, 54, 72−84. (19) Mollinedo, F.; Gajate, C. Apoptosis 2003, 8, 413−450. (20) Pellegrini, F.; Budman, D. R. Cancer Invest. 2005, 23, 264−273. (21) Schiff, P. B.; Horwitz, S. B. Proc. Natl. Acad. Sci. 1980, 77, 1561−1565. (22) Altschul, S. F.; Madden, T. L.; Schaffer, A. A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D. J. Nucleic Acids Res. 1997, 25, 3389−3402. (23) Tamura, K.; Nei, M.; Kumar, S. Proc. Natl. Acad. Sci. 2004, 101, 11030−11035. (24) Houghton, P.; Fang, R.; Techatanawat, I.; Stevanton, G.; Hylands, P. I. Method 2007, 42, 377−387. (25) Sharma, P. R.; Mondhe, D. M.; Shanmugavel, M.; Pal, H. C.; Shahi, A. K.; Saxena, A. K.; Qazi, G. N. Chem. Biol. Interact. 2008, 179, 160−168.

ASSOCIATED CONTENT

S Supporting Information *

1D and 2D NMR spectra for compounds 2 and 4, X-ray parameters, and CIF files for compounds 1 and 4. This material is available free of charge via the Internet at http://pubs.acs.org. Accession Codes

IIIM Communication No. IIIM/1506/2012.

■

Article

AUTHOR INFORMATION

Corresponding Author

* (S.R.H.) Tel: +91-(191)-2569000-010. Fax: +91(191)2569333/2569017. E-mail: [email protected]. (B.A.S.) Tel: +91-(191)-2569000-010. Fax: +91(191)-2569333/2569017. Email: [email protected]. Author Contributions ‡

These authors contributed equally.

Notes

The authors declare no competing financial interest. 199

dx.doi.org/10.1021/np3006666 | J. Nat. Prod. 2013, 76, 194−199