Tunneling Nanotubular Expressways for Ultrafast ... - ACS Publications

www.acsnano.org

Downloaded via IOWA STATE UNIV on January 4, 2019 at 21:29:57 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

Tunneling Nanotubular Expressways for Ultrafast and Accurate M1 Macrophage Delivery of Anticancer Drugs to Metastatic Ovarian Carcinoma Ling Guo,†,‡,∥ Ye Zhang,†,‡,∥ Zeping Yang,†,‡ Hui Peng,§ Runxiu Wei,†,‡ Cuifeng Wang,*,†,‡ and Min Feng*,†,‡ †

School of Pharmaceutical Sciences and ‡Guangdong Provincial Key Laboratory of New Drug Design and Evaluation, Sun Yat-sen University, University Town, Guangzhou 510006, P. R. China § Department of Surgery, Washington University School of Medicine, St. Louis, Missouri 63110, United States S Supporting Information *

ABSTRACT: It is extremely difficult for cancer chemotherapy to control the peritoneal metastasis of advanced ovarian carcinoma given its inability to target disseminated tumors and the severe toxic side effects on healthy organs. Here, we report antitumor M1 macrophages developed as live-cell carriers that deliver anticancer drugs for the treatment of the metastatic ovarian carcinoma. Engineered doxorubicin-loaded M1 macrophages (M1-Dox) significantly enhanced tumor tropism by upregulation of CCR2 and CCR4 compared with their parent cells. Meanwhile, M1-Dox inhibited doxorubicin-induced tumor invasion, whereas commercial Lipo-Dox did not limit these side effects. Importantly, our data uncovered a drug delivery mechanism by which M1-Dox transferred drug cargoes into tumor cells via a tunneling nanotube pathway. The tunneling nanotube network acted as a transportation expressway for ultrafast drug delivery of M1-Dox, leading to efficient ovarian carcinoma cell death. Furthermore, genetic, pharmacological, and physical perturbations of these tunneling nanotubes obviously decreased drug transfer of M1-Dox, which further validated the evident correlation between drug delivery of M1-Dox and tunneling nanotubes. Finally, in peritoneal metastatic ovarian carcinoma-burdened mice, M1-Dox specifically penetrated into and accumulated deep within disseminated neoplastic lesions compared with commercial Lipo-Dox, resulting in reducing metastatic tumors to a nearly undetectable level and significantly increasing overall survival. Overall, the strategy of engineered macrophages for ultrafast and accurate drug delivery via the tunneling nanotubular expressway potentially revolutionizes the treatment of metastatic ovarian carcinoma. KEYWORDS: tunneling nanotubes, cell-to-cell transfer, M1 macrophage, tumor tropism, metastatic ovarian carcinoma

A

surmount the clinic challenge of high-grade serous ovarian carcinoma. Macrophages are essential components of innate immunity. To fulfill their functionally distinct roles, macrophages are capable of polarizing toward a spectrum of phenotypes, including classically activated macrophages (CAM/M1). M1 macrophages not only mediate host defense against infections but also contribute to the antitumor response and are associated

dvanced ovarian carcinoma is one of the deadliest forms of cancer.1 The 10 year survival is 0.05 by Student’s t test. (D−G) Typical AFM images and height profile curves of M1 macrophages, M1-Dox, M0 macrophages, and M0-Dox. (D1−G1) 3D surface topography images of a single rough cell. (D2−G2) AFM topographic images representing the general morphology of the surface over a (5 × 5) μm2 area. (D3−G3) 3D surface topography images and (D4−G4) height profile line analysis corresponding to (D2−G2). (H) Surface roughness of M1 macrophages, M1-Dox, M0 macrophages, and M0-Dox (n = 10). The data are shown as mean ± s.d., *** is p < 0.001, n.s. is p > 0.05 by two-way ANOVA test. (I) Cell viability of Dox-loaded macrophages at the indicated times after loading (equivalent to 16 μM), n = 6 independent experiments. The data are shown as mean ± s.d., **** is p < 0.0001, #### is p < 0.0001, n.s. is p > 0.05 by two-way ANOVA test. (J) The heat map of eight macrophage apoptosis-related genes (GO: 2000110, GO: 2000111) that were not significantly different between M1-Dox and M1 macrophages. Green color represents lower expression, and red color represents higher expression. (K) In vitro Dox leakage from M1-Dox or M0-Dox in cell culture medium at 37 °C during 96 h (n = 6). The data are shown as mean ± s.d., ** is p < 0.01, **** is p < 0.0001 by two-way ANOVA test. B

DOI: 10.1021/acsnano.8b08872 ACS Nano XXXX, XXX, XXX−XXX

Article

ACS Nano

have been recently reported to exist in human tumor tissues and play a role in efflux of daunorubicin in tumor cells.22 Therefore, it is intriguing to hypothesize that activation and utilization of a tunneling nanotube network between macrophages and target cells to transfer drugs may develop alternative drug delivery strategies. Here, we develop M1 macrophages as cell drug carriers for rapidly and accurately delivering doxorubicin (Dox) to improve the treatment of metastatic ovarian carcinoma in vivo. To assess their therapeutic potential, we investigated the significant properties of M1-Dox, such as tumor tropism and inhibition of Dox-induced invasion, which are critical for effectively suppressing metastatic ovarian carcinoma. The antitumor efficacy of M1-Dox was determined in a three-dimensional (3D) tumor-immune model and human ovarian carcinoma metastatic mice model. Importantly, we also identified the tunneling nanotube pathway as the predominant drug transportation expressway for M1-Dox, which is completely different from the endocytic pathway of conventional anticancer drug-loaded nanomedicines. These results provide insights to a previously unknown mechanism for macrophage-mediated drug delivery.

with favorable clinical outcomes. M1 macrophages are highly specialized in programmed cell removal and tend to recognize and capture tumor cells.5 On the other hand, tumor cells and tumor-associated stromal cells are biased to produce monocyte chemoattractant protein-1 (CCL2), a member of the C-C chemokine family.6 CCL2 recruits monocytes/macrophages into the tumor microenvironment via a CCL2-CCR2 mechanism.7 Activated macrophages migrate through the extracellular space in response to CCL2 to reach the target tumor site. Therefore, M1 macrophages and tumor cells are mutually attracted to each other in vivo. Furthermore, it has been recently reported that macrophages in tumor tissues take up a large amount of Pt-based anticancer pro-drug and then gradually release the drug to neighboring tumor cells.8 These findings prompted us to hypothesize that M1 macrophages act as an immune cell-based drug carrier for oriented transport of anticancer drugs to disseminated tumor sites in patients with metastatic ovarian carcinoma. Recently, macrophages have emerged as cell carriers for anticancer drug delivery applications due to a strong drug tolerance and significant tumor tropism.9 To our knowledge, a limited number of studies have employed macrophages engulfing anticancer drug-loaded nanomedicines or directly encapsulating anticancer drugs, including delivering anti-BRAF V600E mutant melanoma-specific drug PLX4032-loaded poly(lactic acid) nanoparticles to effectively kill melanoma cells in vitro,10 carrying an oncolytic adenovirus to prostate tumors,11 delivering gold nanoshells for photothermal treatment of glioma in vitro12 and transporting paclitaxel/N-succinyl-N′-octyl chitosan nanoparticles to Ehrlich ascites carcinoma.9 However, a thorough investigation addressing their therapeutic potential in vivo and the detailed cellular mechanisms underlying macrophage-mediated drug delivery is lacking. After a drug delivery carrier attaches to its target cell, it must find some way to enter the cell. Extensively investigated anticancer drug delivery carriers, such as liposomes and other synthetic drug nanoparticle carriers, enter cells mainly through endocytosis. However, the infection process of the viral particles demonstrates that cellular internalization by means of the endocytic pathway results in poor infectivity of target cells. Some studies have indicated that viral infection via cell-to-cell transmission is more effective than endocytosis of viral particles. For example, cell-to-cell transmission of the virus promotes activation of pyroptosis, whereas viral particles that are taken up by endocytosis fail to cause pyroptosis even when added in large amounts.13 Similarly, virus can spread efficiently in vivo via cellto-cell transmission even at very low concentrations.14 We rationalize that delivering cargoes to target cells via cell-to-cell transport is more efficient compared with transport via the endocytic pathway. Tunneling nanotubes represent a signifiant and efficient cellto-cell communication pathway.15 With diameters of 20−200 nm and lengths up to several cell diameters,16 tunneling nanotubes physically link cell bodies over long distances to transfer diverse intracellular cargoes from one cell to neighbor and remote cells.17,18 Extrinsic factors, such as oxidative stress, viral infections, prion-like proteins in neuronal cells, and other pathological species have been shown to trigger the formation of tunneling nanotubes.19 Human immunodeficiency virus type 1 (HIV-1) hijacks macrophages such that they are involved in the rapid dissemination of virus.20 The infected macrophages act as viral reservoirs and facilitate viral transfer to other cells via tunneling nanotube networks.21 Notably, tunneling nanotubes

RESULTS AND DISCUSSION Preparation and Characterization of M1-Dox. M1 macrophages were chosen as immune cell drug carriers for anticancer drugs given their native immune response to tumors.23 Dox was used as a model drug for investigating the macrophage-based targeted drug delivery that leveraged both the functions of the drug cargoes and the native functions of the cells. First, it was necessary to select one optimal type of macrophage as the drug carrier that tolerates Dox well. Three types of macrophages, including the murine macrophage RAW264.7 cell line, murine primary peritoneal macrophages, and murine peripheral blood monocyte-derived macrophages, were used to study drug tolerance. Co-incubation of macrophages with Dox for 12 and 24 h resulted in sharp attenuation of cell viability in either primary peritoneal macrophages or murine peripheral blood monocyte-derived macrophages (Figure 1A). In contrast, RAW264.7 cells maintained approximately 100% viability at the same Dox concentration after 12 h of coincubation. Thus, the RAW264.7 cell line was selected as the optimal Dox carrier for further experiments. M1 macrophages were derived from the RAW264.7 cells upon lipopolysaccharide (LPS) and interferon-γ (IFNγ) stimulation (Figure S1A).24 Dox-loaded M1 macrophages (M1-Dox) were prepared by a simple co-incubation method via electrostatic and hydrophobic interactions between Dox and macrophage membrane. Nonstimulated RAW264.7 macrophages loaded with Dox (M0-Dox) served as the control. Unlike the previous studies in which loading drugs with the help of nanocarriers into macrophages are typically prepared for 12−24 h,9,25 here fabrication without using nanocarriers offered the advantage of rapidly attaining efficient drug loading within 2 h. The optimal drug entrapment efficiency and the drug loading content of M1-Dox was 83.37% and 0.25 pmol/macrophage, respectively, which was approximately a 30% increase compared with that of M0-Dox (Figure 1B). Western blot analysis revealed that inducible nitric oxide synthase (iNOS), as an M1 marker, was expressed at comparable levels in M1-Dox and parent M1 macrophages (Figure 1C), suggesting that M1-Dox still retained the M1 phenotype. Otherwise, M1-Dox exhibited no noticeable changes in particle size and surface ζ potential compared with M1 macrophages. In contrast, the surface ζ potential of M0-Dox showed a significant C


Article

ACS Nano

Figure 2. Evaluation of natural tropism of Dox-loaded macrophages in vitro. (A) Schematic illustration of a real-time tropism assay. Representative real-time traces of M1-Dox, M0-Dox and M1 macrophages toward (B) SKOV3 tumor cell culture supernatants and (C) CHO normal cell culture supernatants. (D) Gene-expression analysis of C-C chemokine receptors in M1-Dox and M1 macrophages by using RNAsequencing data. (E) Quantification of relative CCL2 chemokine expression by SKOV3 tumor cells by real-time qPCR analysis. (F and G) Validation of CCR2 and CCR4 gene expression in macrophages by real-time qPCR analysis. (TCS: tumor cell culture supernatants; NCS: normal cell culture supernatants). The data are shown as mean ± s.d., * is p < 0.05, ** is p < 0.01, *** is p < 0.001, **** is p < 0.0001, n.s. is p > 0.05 by Student’s t test or one-way ANOVA test.

10% FBS were used to fill the lower chambers. Following upper chamber attachment, M1-Dox, M0-Dox, or M1 macrophages in RPMI 1640 supplemented with 10% FBS were loaded in the upper chambers. The upper and lower chambers were separated by a porous filter, allowing for the migration of macrophages. The migration profiles indicated that M1 macrophages exhibited a natural tropism to the tumor cell-conditioned medium. Strikingly, M1-Dox displayed stronger migration to the simulated tumor microenvironment compared with their parent M1 macrophages (Figure 2B). M1-Dox even exhibited positive tropisms in response to 4-fold dilutions of tumor cellconditioned medium (Figure S2A). In contrast, M1-Dox, M0Dox, or M1 macrophages did not produce any response to CHO normal cell-conditioned medium (Figure 2C and Figure S2B). Evidence obtained from studies on the tumor microenvironment suggests that C-C chemokine receptors are involved in the recruitment of immune cells to tumor sites.27 Our RNA sequencing analysis revealed that the C-C chemokine receptor genes were in the direction of an increase in M1-Dox compared with M1 macrophages (Figure 2D). Furthermore, two specific genes, monocyte chemoattractant protein-1 (CCL2) receptors CCR2 and CCR4 of these C-C chemokine receptors, which bind CCL2,28 were assessed by quantitative RT-PCR analysis. CCL2 expression by tumor cells and tumor-associated stromal cells is a major regulator of induced macrophage migration.6 In the present study, chemokine CCL2 was indeed overexpressed in SKOV3 cells, but not in the normal ovary cells (Figure 2E). Meanwhile, the qPCR data validated that expression of both CCR2 and CCR4 genes versus control M1 macrophages was significantly up-regulated in M1-Dox (Figure 2F,G). Moreover, CCR2 and CCR4 mRNA expression levels in M1-Dox were also significantly increased compared with M0-Dox. Together, these results suggest that M1-Dox presenting a robust tropism to the SKOV3 simulated tumor microenvironment is likely due to the M1-Dox through further up-regulation of CCR2 and CCR4 to induce directional migration (Figure 2G). This mechanism represents one of the critical advantages of the macrophage-

reduction (Figure S1B,C). The surface roughness of cells potentially significantly influences the cellular response.26 Thus, we used atomic force microscopy (AFM) to directly visualize the surfaces of Dox-loaded macrophages. The AFM images revealed that M1-Dox did not exhibit different surface morphology compared with M1 macrophages (Figure 1D,E). In contrast, the surface roughness of M0-Dox was obviously decreased, and holes were observed on its surface (Figure 1F−H). Moreover, cell activity of Dox-loaded macrophages as monitored by the MTT and ATP-dependent assays demonstrated that M1-Dox did not induce significant cell death at its working concentration and could maintain >90% cell viability for 24 h, whereas M0-Dox was more sensitive to Dox and exhibited a significant decrease in cell viability (>24 h) and intracellular ATP levels (>48 h) after loading drugs (Figure 1I and Figure S1D,E). Moreover, eight macrophage apoptosis-related genes in M1-Dox after 24 h of loading drugs, including five genes of negative regulation (CCL5, CCR5, NOD2, SELENOS, and ST6GAL1) and three genes of positive regulation (CDKN2AIPN, MEF2C and SIRT1) indicated no differential expression levels, compared with M1 macrophages without loading Dox, as shown in Figure 1J. These results further suggested that M1-Dox could maintain cellular activities in subsequent experimental periods. Following these formulations, we evaluated drug leakage from macrophages. M1-Dox demonstrated a slow reduction in the drug leakage rate ( 0.05 by two-way ANOVA test or one-way ANOVA test.

in which Dox-loaded macrophages were co-cultured with SKOV3 cancer cells. Then, we monitored the invasive behavior of cancer cells using real-time cell analyzer (Figure S3B). DoxHCl and Lipo-Dox served as controls. Cell migration profiling data indicated that DoxHCl promoted ovarian cancer cell invasion compared with untreated cells, which is consistent with previous reports. Surprisingly, macrophages encapsulating Dox could alter the effects of the invasion induced by DoxHCl and appeared to inhibit the tumor cell invasion (Figure 3E). In contrast, commercial Lipo-Dox did not exhibit any anti-invasion effects. Interestingly, the visualization of cell-to-cell interactions in live cells using confocal laser scanning microscopy (CLSM) revealed that M1-Dox were tethered to SKOV3 cells by cytoskeletal filaments (Figure 3F and Video S1), which may contribute to their anti-invasion effects. In vitro efficacy and antiinvasion studies indicate that M1 macrophages, as immune cell drug carriers, not only enhance the efficacy of Dox but also inhibit Dox-induced invasion of cancer cells. Anti-Tumor Activity of M1-Dox against the 3D TumorImmune Model. The two-dimensional (2D) cell culture models do not fully represent the in vivo scenario given differences in terms of cellular heterogeneity, cell−cell interactions, oxygen gradients, and nutrient, resulting in poor in vitro-in vivo correlation.30 We next further evaluated whether M1-Dox delivery enhanced the antitumor efficacy of Dox in 3D tumor model, which provides more appropriate preclinical

based drug carrier over the extensively investigated polymeric drug carriers. Anti-Tumor and Anti-Invasion Effects of M1-Dox in Vitro. To evaluate the antitumor effects of M1-Dox, we first conducted the in vitro efficacy study. The half-maximal inhibitory concentration (IC50), a key measure of the effectiveness of drugs, was determined from cell viability curves after exposure of murine ovarian carcinoma ID8 cells and human ovarian carcinoma SKOV3 cells to Dox-loaded macrophages. The IC50 values of M1-Dox against ID8 cells and SKOV3 cells were 20.81 nM and 0.66 μM, respectively, which is reduced compared with values for M0-Dox under identical conditions (Figure 3A,B). Of note, M0 macrophages seemed to promote tumor cell growth at high concentrations, whereas M1 macrophages did not exhibit any appreciable proliferation. These results indicated that M1 macrophages provided a relatively safe carrier for delivering anticancer drugs. Cell viability and apoptosis assays demonstrated that M1-Dox displayed more potent anti-tumor effects against SKOV3 cells compared with commercial products of Lipo-Dox and DoxHCl at the same concentration of Dox (Figure 3C,D and Figure S3A). Dox and other clinically used anticancer drugs actively inducing invasion have been reported in recent years.29 We next tested whether M1 macrophages encapsulating Dox could alter the induction of invasion by Dox. We set up a simple experiment E


Article

ACS Nano

were treated with Dox-loaded macrophages or Lipo-Dox for 96 h. Then, cell viability was assessed using the fluorescence-based live/dead cell assay kit. Calcein-AM-stained live cells exhibited green fluorescence, whereas propidium iodide (PI) stained dead cells red (Figure 4C). M1-Dox induced cell death in tumorimmune spheroids more robustly compared with either LipoDox or M0-Dox treatment under identical conditions, as evidenced by the significant increase in the mean fluorescent intensity ratios of dead cells to live cells (Figure 4D). Moreover, M1-Dox inhibited tumor-immune spheroid growth more strongly compared with either Lipo-Dox or M0-Dox (Figure 4E and Figure S4). Together, M1-Dox displays high efficacy in tumor-immune models, demonstrating its therapeutic potential in vivo. Ultrafast Dox Transfer from M1-Dox to Tumor Cells. To better understand M1-Dox drug delivery, the red fluorescence of Dox was used to track drug transfer from M1Dox to tumor cells. The percentage of Dox-positive cells and the intense fluorescence of Dox were exploited to examine the kinetics of drug transfer and intracellular accumulation using flow cytometry and confocal microscopy. Interestingly, M1-Dox delivery of their drug cargoes into both ovarian carcinoma SKOV3 cells and ID8 cells was ultrafast and faster compared with free DoxHCl. Within 30 min, Dox fluorescence was detected in >85% of both SKOV3 cells and ID8 cells treated with M1-Dox, whereas DoxHCl > Lipo-Dox. Moreover, the M1-Dox delivery of Dox into ID8 cells was obviously faster compared with M0-Dox. The intensities of red fluorescence were considerably increased in cells exposed to M1-Dox compared with Lipo-Dox, indicating that macrophages encapsulating Dox enhanced the intracellular accumulation of Dox (Figure 5A2,B2). Consistent with flow cytometry results, confocal image analysis revealed that Dox red fluorescence was rapidly observable in tumor cells treated with M1-Dox and M0Dox for 2 h, and Dox even entered the nuclei of SKOV3 cells. In contrast, Lipo-Dox treatment exhibited low fluorescence intensity in cells under the identical conditions (Figure 5C,D and Figure S5). Together, the results clearly suggest that M1Dox provides the fastest delivery of drugs into tumor cells compared with Lipo-Dox and free DoxHCl. M1-Dox Stimulate an Increase in Tunneling Nanotubes with Ovarian Carcinoma Cells. Ultrafast drug transmission of M1-Dox raised the question of how M1 macrophages delivered their drug cargoes into tumor cells. The most interesting finding of this study was that drug transfer from M1-Dox was not via conventional drug release or cellular endocytosis but occurred efficiently through tunneling nanotubes, which are dynamic cellular connections between M1-Dox and target ovarian carcinoma cells. Scanning electron microscope (SEM) analysis clearly demonstrated that at least two distinct morphological types of tunneling nanotubes were observed (Figure 6A). Some of the connections appeared as thick short bridges between M1-Dox and nearby human ovarian carcinoma SKOV3 cells (Figure 6A1,A2). We also observed the formation of thinner, elongated structures, which had the

models to evaluate the potencies of anticancer drugs in solid tumors.31 To closely mimic the histological complexity of tumors, SKOV3-RAW264.7 (5:1) multicellular tumor spheroids were constructed,32 as shown in Figure 4A. Co-existence of SKOV3 tumor cells and RAW264.7 immune cells in multicellular spheroids was demonstrated by hematoxylin and eosin (H&E) staining (Figure 4B). The 3D tumor-immune models

Figure 4. Cytotoxic effects on the 3D tumor-immune spheroids. (A) Schematic depicting tumor-immune spheroid formation where cell spheroids have been generated by culturing SKOV3 tumor cells in combination with RAW264.7 macrophages. (B) Representative images of SKOV3 tumor cells and RAW264.7 macrophages stained with H&E co-culture. Cell boundaries of macrophages were marked with bold red lines. Scale bars, 100 μm. (C) Calcein-AM (green)/PI (red) assay was used to visualize the live cells (green) and dead cells (red) in spheroids. Scale bars, 400 μm. The spheroids were incubated with M1-Dox, M0-Dox, and Lipo-Dox, respectively (equivalent to 4.0 μM Dox) for 72 h. (D) The relative fluorescence intensities of the red-fluorescent (PI, λex 535 nm, λem 617 nm) dead cells versus the green-fluorescent (Calcein-AM, λex 490 nm, λem 515 nm) live cells were determined, indicating a significant increase in cell death followed by the M1-Dox treatment. (E) The volume of spheroids was calculated and normalized to the volume before treatments. Statistical analysis of images was based on ImageJ quantification of randomly selected fields of spheroids (n > 5) for each treatment. The data are shown as mean ± s.d., * p < 0.05, ** p < 0.01, **** p < 0.0001 by one-way ANOVA test. F


Article

ACS Nano

Figure 5. Ultrafast Dox transfer from M1-Dox to ovarian carcinoma cells. SKOV3 or ID8 cells were incubated with M1-Dox, M0-Dox, Lipo-Dox, and DoxHCl (equivalent to 16 μM of Dox) prior to further measurements. (A and B) Percentages of positive cells and fluorescence intensities were determined by flow cytometry at the indicated times (n = 3). The representative fluorescence intensities of Dox-positive SKOV3 cells and Dox-positive ID8 cells at 4 h were displayed. (C) CLSM images of SKOV3 cells show the Dox transfer into SKOV3 tumor cells at 2 h. The nuclei were stained with DAPI. Dox produced a red fluorescence. The merged images were the overlay of two individual images. Scale bar, 20 μm. (D) Statistical analyses of relative Dox fluorescent intensities in SKOV3 cells were based on ImageJ quantification of randomly selected cells (n = 10) from corresponding fluorescence images. The data are shown as mean ± s.d., ** p < 0.01, **** p < 0.0001, n.s. is p > 0.05 by one-way ANOVA test or two-way ANOVA test.

lengths of 41.2 and 56.8 μm when M1-Dox connected distant SKOV3 cells (Figure 6A3,A4). AFM analysis validated that SKOV3 cells were tethered to M1-Dox via tunneling nanotubes with dimensions of 253.3 ± 146.9 nm (n = 50), and their surface of the nanoscale membrane conduit was not smooth (Figure 6F). Furthermore, an individual M1-Dox could support up to 43 tunneling nanotubes (Figure 6A5,A6), suggesting that tunneling nanotube formation between M1-Dox and SKOV3 cells was not limited to pairs of cells, but resulted in criss-crossed cellular networks. Furthermore, M1-Dox exhibited a significant increase in tunneling nanotube formation compared with parent M1 macrophages under SEM observation (Figure 6A7,B). Next, we investigated whether M1-Dox could induce gene expression changes in regulating the formation of tunneling nanotubes by RNA sequencing analysis. Activated GTP-Rho binding, Ral GTPase binding, and Akt/PI3K/mTOR pathway were shown to be involved in inducing tunneling nanotubes,33−35 and their relative genes were identified in the Gene Ontology database (GO: 0017049; GO: 0017160; GO: 0051897; GO: 0016303; GO: 0038201). Our RNA sequencing data showed up-regulation of 81.25% and 68.75% genes involved in positively regulating GTP-Rho binding and GTPRho binding, respectively (Figure 6C). Moreover, the Akt/ PI3K/mTOR pathway analysis of specific RNAs differentially expressed in M1-Dox versus M1 macrophages showed that the change of most related genes was in the direction of an increase in M1-Dox (Figure 6D and Figure S6). Activation of the Akt/ PI3K/mTOR pathway could induce overexpression of M-Sec that is a tunneling nanotube marker and a central factor for their formations.34,36 To validate the results obtained by RNA-seq, we measured the expression fold changes of the downstream critical gene M-Sec mRNA, by quantitative RT-PCR. The results

demonstrated a significant up-regulation of M-Sec in M1-Dox compared with M1 macrophages (Figure 6E) and further depletion of M-Sec by RNA interference greatly reducing the number of tunneling nanotubes formed by M1-Dox with tumor cells (Figure 6B). Although it is technically difficult to visualize the process of tunneling nanotube formation given that these thin structures are sensitive to light exposure and chemical fixation, leading to visible vibration and rupture during subsequent processing for imaging,37−40 we nonetheless attempted to observe intercellular nanotube establishment between M1-Dox and SKOV3 tumor cells by live cell imaging. Live imaging indicated that M1-Dox extended several dorsal filopodia toward the target SKOV3 cell which also extended filopodia (see arrow in Figure 6G(a)). Following the mobilizable filopodia both from the M1-Dox and SKOV3 cell interplayed with each other and after attachment, the other filopodia from the cells retracted, generating a tunneling nanotube similar to a thin thread to tether the M1Dox and tumor cell (Figure 6G and Video S2). The tunneling nanotube did not attach to the substratum, representing one of its attributes.41 We also explored tunneling nanotube formation between M1Dox and murine ovarian carcinoma ID8 cells within the same species. SEM images indicated that M1-Dox could form rich tunneling nanotubes with ID8 cells, and the number of tunneling nanotubes did not exhibit any significant reduction compared with those between M1-Dox and SKOV3 cells (Figure 6H). In contrast, M1-Dox minimally formed tunneling nanotubes with most normal ovarian CHO cells, which were conducive to exerting selective drug delivery of M1-Dox. Tunneling Nanotubes Act As the Transportation Expressway for M1-Dox. The existence of expanded G


Article

ACS Nano

Figure 6. Architecture of tunneling nanotubes between M1-Dox and ovarian carcinoma cells. (A) M1-Dox or M1 macrophages connected with surrounding cells via one or several tunneling nanotubes. (A1−A6) Tunneling nanotubes between M1-Dox and SKOV3 cells. Rarely, dozens of tunneling nanotubes extended from one M1-Dox were observed by SEM. (A7) Tunneling nanotubes between M1 macrophages and SKOV3 cells. (B) Quantification of the number of tunneling nanotubes extended from per M1-like macrophages and M1-Dox (n = 25). (C) Gene expression of GTP-Rho binding and GTP-Rho binding was increased in M1-Dox by using RNA-sequencing data. (D) 32 selected gene expressions of the Akt/PI3K/mTOR pathway involved in inducing tunneling nanotubes was up-regulated in M1-Dox. (E) Quantification of relative M-Sec expression of M1 and M1-Dox by real-time qPCR analysis. (F) Representative AFM 3D images showed intercellular connections through tunneling nanotubes between M1-Dox and SKOV3. (F2−F3) 3D and 2D images of a tunneling nanotube under higher magnification. (G) Individual time-lapse images of live imaging of tunneling nanotube formation between M1-Dox and SKOV3 tumor cells. Cell bodies were overexposed so that tunneling nanotubes were visible. (H) Quantification of the number of tunneling nanotubes formed between M1-Dox and ID8 cells, between M1-Dox and SKOV3 cells, or between M1-Dox and CHO cells from SEM images (n = 25). Scale bar, 10 μm. The data are shown as mean ± s.d., ** p < 0.01, **** is p < 0.0001 by one-way ANOVA test or Student’s t test.

nanotubes. Strikingly, the structure of tunneling nanotubes between M1-Dox and a SKOV3 cell exhibited membranous conduits. Red Dox was present inside green tunneling nanotubes observed using a high-resolution Delta Vision OMX SR imaging system (Figure 7C). The results also revealed that one M1-Dox in direct contact with a tumor cell transferred Dox to another distant tumor cell through a tunneling nanotube between them (Figure S7A). In addition, one SKOV3 cell adhered to one M1Dox can connect to another M1-Dox by a tunneling nanotube (Figure 7C). Importantly, M1-Dox delivery of Dox via tunneling

intercellular networks prompted us to assess whether tunneling nanotubes could facilitate drug delivery of M1-Dox to ovarian carcinoma cells. We labeled the major cytoskeletal component of tunneling nanotubes, F-actin, with phalloidin.42 One M1-Dox could deliver Dox to one or two ovarian carcinoma cells simultaneously. In the tunneling nanotube, the fluorescence intensity of the red Dox from M1-Dox mostly co-localized with the green fluorescent signals with tunneling nanotubes, as shown in Figure 7A,B. These results indicate that drug transfer of M1Dox to ovarian carcinoma cells occurs through the tunneling H


Article

ACS Nano

Figure 7. Dox transfer from M1-Dox to SKOV3 cells via tunneling nanotubes. (A and B) Transport of Dox between tunneling nanotubeconnected cells. F-actin, the vital component of tunneling nanotubes, was stained with phalloidin (green), and Dox emitted red intrinsic fluorescence. CLSM images illustrated the transmission of Dox in tunneling nanotubes between M1-Dox and SKOV3 cells. Right: Plot profile of the representative images of fluorescence co-localization of the tunneling nanotube and Dox. (C) A representative image of red Dox presenting inside green tunneling nanotubes was observed by CLSM and the high-resolution Delta Vision OMX SR imaging system. (D) A representative SIM image of a tunneling nanotube network. (E) Series of confocal images extracted from a time-lapse video show M1-Dox drug delivery to SKOV3 cells via tunneling nanotubes. White arrows indicate the Dox signals within tunneling nanotubes. Scale bar, 10 μm.

SKOV3 cells (Figure 8A and Figure S9A,B). In addition, the working concentration of CytoB (350 nM) had no cytotoxic effect on SKOV3 cells (Figure S9C). Indeed, as shown in Figure 8B, pretreatment of M1-Dox and SKOV3 cells with CytoB (B1− B3) or M-Sec siRNA (B4−B6) disrupted the formation of intercellular tunneling nanotubes. The significant decrease in the total number of tunneling nanotubes counted from SEM images at more than 10 randomly selected regions indicated that both the CytoB and M-Sec siRNA treatment could efficiently block the formation of cellular nanostructures (Figure 8C). Strikingly, after down-regulation of tunneling nanotube formation by M-Sec siRNA, Dox transfer efficiency sharply decreased from approximately 100% to 0.05 by one-way ANOVA test.

diffusion after drug release from the cell carriers as reported in previous studies50−52 but by cell-to-cell transmission through tunneling nanotubes. Collectively, these data from pharmacological, generic, and physical inhibition assays strongly support that tunneling nanotubes act as the predominant transportation expressway for drug delivery from M1-Dox to tumor cells. Tumor Tropism and Penetration of M1-Dox in Vivo. To evaluate the tumor tropism of M1-Dox in vivo, a mouse model for peritoneal dissemination in ovarian carcinoma was established by intraperitoneally injecting SKOV3 cells into nude mice. When the mice were dissected 7 days after the cell injection, metastatic tumors were observed in the peritoneal cavities in all the mice examined. Mice with the metastatic ovarian carcinoma were injected with fluorescent membranestaining dye DiD labeled M1-DiD and Lipo-DiD. The fluorescence intensity in the tumor, diaphragm, and main organs (heart, lung, spleen, kidneys, gastrointestinal tract, and uterine appendage) was monitored at 24 h after i.p. administration. Intriguingly, M1-DiD-treated mice exhibited strong fluorescence intensity in disseminated peritoneal tumor nodules (Figure 10A and Figure S10). Furthermore, when the tumor nodules were removed, the main organs exhibited

exosome release using GW4869, an inhibitor of exosome biogenesis and release. Then, we evaluated the effects of inhibiting exosome secretion on Dox transfer.49 Interestingly, GW4869 (20 μM) pretreatment did not inhibit Dox transfer from M1-Dox to SKOV3 cells (Figure 8F), suggesting that M1Dox delivery of drug cargoes was not mainly dependent on exosomes. To exclude the possibility that Dox is transferred to ovarian carcinoma by diffusion, we cultured M1-Dox/SKOV3 cells in the presence or absence of physical tunneling nanotubeinhibiting conditions, as shown in Figure 9A. Tunneling nanotubes were inhibited by physical separation of M1-Dox and SKOV3 cells using a transwell dual-culture system (0.4 μm pore size), whereas diffusible free DoxHCl easily crossed the porous membrane. The transwell dual-culture conditions did not reduce the effects of DoxHCl on cell viability compared with co-culture conditions. In contrast, SKOV3 cell viability drastically increased after treatment with M1-Dox under the transwell conditions (Figure 9B,C, p < 0.001). These findings indicated that Dox transfer was inhibited by physical disruption of tunneling nanotubes. The results demonstrated that M1-Dox delivery of their cargoes into the target cells did not occur by J


Article

ACS Nano

Figure 9. Dox transfer from M1-Dox required direct cell-to-cell contact. (A) A schematic depicting the cell dual-culture and co-culture. As for transwell setup of cell dual-culture, M1-Dox was cultured in the upper chamber of transwells, and SKOV3 cells were plated in the bottom chamber. (B) Cell viability of SKOV3 cells exposed to M1-Dox and DoxHCl by cell dual-culture and co-culture. (C) The live SKOV3 cells exposed to M1-Dox and DoxHCl by cell dual-culture and co-culture for 24 h were stained by Calcein-AM. The data are shown as mean ± s.d., n = 6 per group, * is p < 0.05, *** is p < 0.001 by one-way ANOVA test.

substantially reduced fluorescence intensity, demonstrating that M1-DiD co-localized with disseminated tumor nodules. These results were consistent with our in vitro data demonstrating that M1-Dox exhibited significant tropism toward the human ovarian carcinoma SKOV3 cell conditional medium. Compared with M1-DiD-treated mice, the livers of Lipo-DiD-treated mice exhibited a dramatic increase in fluorescence intensity likely because liposomes and nanoparticles accumulate in the liver tissues by mononuclear phagocytic system (MPS) uptake (Figure 10B).53 To further validate the specificity of the targeting capability of M1-Dox, the organ distribution profiles were determined in nude mice. In tumor-bearing mice, M1-Dox exhibited high tumor accumulation, but only a trace amount in normal tissues (Figure 10C). In contrast, in mice without tumors, the distribution of M1-Dox was considerably different and did not show any specific accumulation (Figure 10D). Furthermore, the penetration of M1-DiD vs Lipo-DiD throughout metastatic tumor tissues was evaluated. M1-DiD exhibited substantial penetration throughout the tumor parenchyma in sections (>1000 μm), whereas Lipo-DiD largely localized around the edges of the tumor tissue to a depth of approximately 200 μm (Figure 10E−H). Together, the strong tumor tropism and penetration of M1-Dox in vivo make it ideally suited for cancer therapies. M1-Dox Suppress the Metastatic Progression of Human Ovarian Carcinoma. To determine the in vivo therapeutic efficacy of M1-Dox, we tested its effect on the established human ovarian carcinoma metastatic model through i.p. administration (2 mg/kg every 3 day) (Figure 11A). We counted metastatic nodules (milky in appearance) in various organs to preliminarily evaluate anticancer efficacy. Strikingly,

when control mice exhibited obvious metastatic nodules in main organs (liver, kidneys, spleen, gastrointestinal tract, diaphragm, and uterine appendages), metastatic tumors in M1-Dox-treated mice were reduced to nearly undetectable levels in these organs examined (Figure 11B−F, Figure S11A,B, and Figure S12). Although Lipo-Dox- and DoxHCl-treated groups exhibited a reduced number of metastatic nodules in some organs (kidneys and gastrointestinal tract), the reduction was considerably less compared with the M1-Dox-treated group. In addition, the tumor weight was also significantly reduced in M1-Dox-treated mice compared with other groups (Figure 11G,H). Histological analyses of these tumors demonstrated that the M1-Dox-treated group exhibited peripheral tumor necrosis, whereas Lipo-Doxand DoxHCl-treated groups exhibited obvious nuclear division and invasion of tumor cells (Figure 11L). After 25 day i.p. treatment, overall survival indicated robust improvement in M1Dox-treated mice, which exhibited a significantly longer median survival time (130 days) compared with mice treated with DoxHCl (22 days) or Lipo-Dox (58 days) (Figure 11I). Compared with mice in the control group, no substantial weight loss of organs was detected in the M1-Dox-treated group during the study, indicating that M1-Dox did not exert severe adverse effects on the mice at its effective anticancer dose (Figure 11J,K and Figure S11C,D). In addition, H&E staining of organ sections revealed metastatic ovarian carcinoma cells (black arrows) and necrosis (white arrows) in both DoxHCl- and LipoDox-treated groups. In contrast, no detectable ovarian carcinoma cells or abnormalities were observed in the organs examined in M1-Dox-treated mice, further demonstrating the safety of M1-Dox (Figure 11L). Taken together, these results K


Article

ACS Nano

Figure 10. M1 macrophages as immune-cell drug carriers exhibited tumor tropism and penetration into metastatic tumor nodules in the advanced ovarian carcinoma mouse model. Metastatic ovarian carcinomas were induced in mice by i.p. injection of SKOV3 cells into BALB/c nude mice. (A and B) Representative fluorescence images and bright-field images of excised organs at 24 h post-injection of DiD-labeled M1 macrophages (M1-DiD) or DiD-labeled Liposomes (Lipo-DiD). (A1 and B1) Representative fluorescence images of excised organs with metastatic nodules. (A2 and B2) The corresponding bright-field images of excised organs with metastatic tumors. White arrows indicate the bright tumor nodules. (A3 and B3) The fluorescence images of excised organs upon the removal of metastatic nodules. Color bars show the lowand high-intensity values in units of counts/s. (C) Biodistribution of M1-DiD or Lipo-DiD at 24 h was measured by fluorescence imaging in the heart, liver, spleen, lung, gastrointestinal tract, uterine appendages, and tumors. (D) Representative fluorescence images of excised organs at 24 h post-injection of M1-DiD in healthy mice. (E and G) Representative sections of the metastatic tumor tissue from tumor-bearing mice at 24 h after i.p. administration of M1-DiD or Lipo-DiD (red fluorescence), followed by staining for Ki67, a marker of tumor aggressiveness (green fluorescence), and DAPI for nuclei (blue fluorescence). (F and H) The fluorescence intensity of M1-DiD or Lipo-DiD across the metastatic tumor tissue. The data are shown as mean ± s.d., n = 3 per group, ** p < 0.01, **** p < 0.0001 by two-way ANOVA test. L


Article

ACS Nano

Figure 11. In vivo therapeutic efficacy of M1-Dox against advanced ovarian carcinoma. (A) Experimental procedure of tumor induction and treatment protocol. (B−F) The number and location of metastatic nodules on the livers, kidneys, spleens, gastrointestinal tracts, and diaphragms in control and treated mice (n = 6 per group). White arrows indicate tumor nodules. (G and H) Final tumor weights and photographs of metastatic nodules collected on several peritoneal organs after different treatments for 28 days (n = 6 per group). (I) Kaplan− Meier survival curves and the median survival time of metastatic ovarian carcinoma-bearing mice after treatment with M1-Dox, Lipo-Dox, and DoxHCl (n = 8 per group). (J and K) Organ weights of the spleen and uterine appendages after 28 days of treatment (n = 6 per group). (L) H&E stained tumors and tissues from control and treated tumor-bearing mice on day 28. Black arrows indicate tumor cells. Scales are shown below each image. The data are shown as mean ± s.d., * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 by one-way ANOVA test.

suggest that M1-Dox therapy for metastatic ovarian carcinoma is

CONCLUSIONS

effective and safe.

Macrophages have recently emerged as immune cell drug carriers for anticancer drug delivery applications.52,54 Macrophage-mediated drug delivery systems have the advantage of M


Article

ACS Nano

MATERIALS AND METHODS

exhibiting functional similarities with their parent cells. However, the detailed cellular mechanisms underlying macrophage-mediated drug delivery have not been explicitly reported. In the present study, we identified that tunneling nanotubes act as the predominant drug transportation expressways for M1Dox drug delivery to tumor cells. SEM and high-resolution CLSM analysis demonstrate that tunneling nanotube formation between M1-Dox and ovarian carcinoma cells is not limited to pairs of cells but results in a criss-crossed cellular network. Gene silencing, pharmacological, and physical perturbations of these tunneling nanotubes obviously reduce Dox transfer into tumor cells, further validating the correlation between drug delivery of M1-Dox and tunneling nanotube connections. Moreover, our studies suggest that M1-Dox exhibits ultrafast drug delivery through the cell-to-cell tunneling nanotube pathways which are even faster than free DoxHCl. In contrast, Dox transfer by commercial Lipo-Dox is significantly slow in SKOV3 and ID8 ovarian carcinoma cells. M1-Dox utilizes the tunneling nanotube pathway to transport drug cargoes into tumor cells, which is completely different from conventional nanomedicines, such as liposomes and other synthetic drug nanoparticle carriers that have been extensively investigated.55 These nanomedicines employ multiple endocytic pathways to enter cells.56 Following endocytic uptake, internalized nanomedicines enter endosomes and are sorted into lysosomes for degradation. Thus, nanomedicines need to rapidly escape from lysosomes to release drugs in the cytoplasm.57 Compared with the complex drug transport process of nanomedicines, M1-Dox quickly transfers drugs directly into the cytoplasm of tumor cells via tunneling nanotubes that are continuous with the membranes of connected cells.16 It is extremely difficult for cancer chemotherapy to control the peritoneal metastasis of advanced ovarian carcinoma given the inability to target disseminated tumors and severe toxic side effects on healthy organs. Here, we also report the use of engineered M1-Dox for the treatment of the metastatic ovarian carcinoma. The results of the real-time tropism assays indicate that M1-Dox significantly enhances tumor tropism by upregulating CCR2 and CCR4 compared with parent cells. M1Dox limits the adverse side effects of Dox-induced invasion, whereas commercial Lipo-Dox does not minimize these side effects. Ultrafast drug delivery of M1-Dox increases cell death in SKOV3 and ID8 ovarian carcinoma cells. Furthermore, the therapeutic efficacy of M1-Dox against advanced ovarian carcinoma in vivo demonstrates that M1-Dox specifically penetrates and accumulates deep within the disseminated tumor nodules, reducing metastatic tumors to approximately undetectable levels and minimizing the side effects of the anticancer drug on healthy organs. Therefore, M1-Dox confers a significant survival benefit. Collectively, our study offers insights into ultrafast and accurate drug delivery of M1-Dox through tunneling nanotubular expressways to potentially treat metastatic ovarian carcinoma in vivo. Although the engineered M1Dox therapies hold promise in cancer treatment, future challenges still exist in translating the approach to practical, including the use of autologous macrophages to avoid immune rejection, improvement of anticancer drug tolerance in primary macrophages, as well as establishment of sensitive and information-rich assays to monitor the accurate delivery of drugs through the tunneling nanotube network in vivo. Overcoming these challenges would make engineered macrophage-based drug delivery therapies a safe and effective platform for clinical applications.

Materials. Doxorubicin hydrochloride (DoxHCl) and Cytochalasin B were purchased from Meilun Biology Technology Co., Ltd. (Dalian, China). Lipophilic doxorubicin (Dox) was prepared by desalting DoxHCl into the protonated form. RPMI-1640 medium, Dulbecco’s Modified Eagle Media (DMEM) medium, fetal bovine serum (FBS), trypsin, and penicillin/streptomycin were obtained from Gibco (Canada). Annexin V-FITC apoptosis detection kit was purchased from Bestbio Biology (Shanghai, China). CellTiter-Lumi Luminescent Cell Viability Assay Kit was purchased from Beyotime Biotechnology (Shanghai, China). CellTiter-Lumi Luminescent Cell Viability Assay Kit, KitTRIzol reagent, and the far-red fluorescent, lipophilic carbocyanine DiD were the products of Invitrogen (USA). 4′,6Diamidino-2-phenylindole dihydrochloride (DAPI), dimethyl sulfoxide (DMSO), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT), and BCA Protein Quantitation Assay Kit were obtained from Sigma-Aldrich (USA). 2.5% Glutaraldehyde for SEM and 4% paraformaldehyde solution were supplied by Leagene Biotechnology (Beijing, China). RNAiso Plus (Total RNA extraction reagent), PrimeScript RT reagent Kit with gDNA Eraser (Perfect Real Time), and TB Green Premix Ex TaqII (TliRNaseH Plus) were purchased from Takara Bio (Shiga, Japan). The high-affinity F-actin probe Alexa Fluor 647 phalloidin and Antirabbit IgG, HRP-linked antibody were the products of Cell Signaling Technology (USA). RIPA lysis buffer, phenylmethanesulfonyl fluoride (PMSF), primary/ secondary antibody dilution buffer, and loading buffer were purchased from Beyotime Biotechnology (Shanghai, China). Immobilon Western chemiluminescent HRP substrate and polyvinylidene fluoride (PVDF) membranes were purchased from Millipore (USA). Anti-iNOS antibody (rabbit, ab3523), anti-TNFAIP2 antibody (rabbit, ab91235), anti-β Actin antibody (rabbit, ab8227), and anti-β Tubulin antibody (rabbit, ab6046) were supplied by Abcam (Britain). PE antimouse CD45 antibody and FITC antihuman CD14 antibody were supplied from Biolegend (San Diego, CA). The commercial product of Lipo-Dox is a liposomal formulation resembling DOXIL (doxorubicin hydrochloride liposome injection, manufactured by China Shijiazhuang Pharmaceutical Group Co., Ltd., Batch No: H20113320). Cell Lines and animals. A murine macrophage cell line RAW264.7, a human ovarian cancer cell line SKOV3, a mouse epithelial ovarian cancer cell line ID8, and a Chinese hamster ovary cell line CHO were purchased from the American Tissue Culture Collection. All cells were kept in a 37 °C humidified incubator (Thermo, USA) with 5% CO2. Female BALB/c nude mice (4 weeks old) were purchased from the Laboratory Animal Center, Sun Yat-sen University (Guangzhou, China) and kept under SPF conditions, with ready access to standardized food and water. All the animal experiments conducted strictly observed the Guiding Principles for the Use of Laboratory Animals and were approved by the Institutional Animal Care and Use Committee of the Sun Yat-sen University. To isolate peritoneal macrophage, mice were injected with 2 mL of 3% thioglycolate. Four days later, mice were anaesthetized, and elicited peritoneal macrophages were isolated from the peritoneal cavity. After centrifugation at 1000 rpm for 10 min at 4 °C, cell pellets were resuspended and seeded in 96-well plates or 6-well plates in RPMI 1640 medium containing 10% FBS, 100 U mL−1 penicillin and 100 μg/mL streptomycin. Peripheral blood-derived macrophages were isolated according to the refs 58 and 59. Briefly, peripheral blood-derived macrophages were isolated from healthy mice by Ficoll-Hypaque centrifugation (Sigma) and countercurrent centrifugal elutriation in the presence of 10 μg/mL polymyxin B using a JE-6B rotor (Beckman Coulter). To ensure the purity of peripheral blood-derived macrophages, cells were washed in Hank’s buffered salt solution, resuspended in serum-free RPMI for 1 h, followed by culturing in complete medium supplemented with 20% FBS for 7 days to differentiate peripheral blood-derived macrophages, which were then cultured in medium supplemented with 10% FBS. Isolated and differentiated peripheral blood-derived macrophages were routinely phenotyped to ensure >85% purity, as determined by flow cytometry for CD45 and CD14. N


Article

ACS Nano Preparation of Doxorubicin-Loaded Macrophages. RAW264.7 cells were polarized as M1 macrophages by 2 days of culture with the indicated stimulants: 2 ng/mL of recombinant murine IFNγ (315-05, PeproTech, USA) and 0.5 μg/mL of LPS (L3024, Sigma-Aldrich, USA). M1-Dox or M0-Dox were obtained by incubating M1 macrophages or M0 macrophages with Dox. Briefly, the prepared macrophages (1 × 105 cells/mL) were seeded in a sterile tube. After culture with the FBS free medium for 1 h, macrophages were incubated with lipophilic Dox at a concentration of 300 nmol/mL at 37 °C for 2 h. After washing with 5% glucose solution three times to remove free Dox, the M1-Dox or M0-Dox suspension was obtained. Characterization of Doxorubicin-Loaded Macrophage. Particle size distributions of M1-like macrophages, inactive M0 macrophages, M1-Dox, and M0-Dox were measured by Mastersizer 2000 particle size analyzer (Malvern, UK). The surface ζ potential was measured by Zetasizer Nano ZS90 (Malvern, UK). To quantify the amount of Dox in M1-Dox or M0-Dox, M1-Dox or M0-Dox were collected and centrifuged at 1000 rpm for 10 min. The cell pellet was suspended in 300 μL of DMSO and vortexed for 1 min for quantification. The concentration of Dox in M1-Dox or M0-Dox was determined using UV spectrophotometer at 481 nm. To calculate the entrapment efficiency, the standard curve of DOX was established. Entrapment efficiency (%) = [mass of loaded Dox (mg)/mass of added Dox (mg)] × 100%. Atomic Force Microscope. After growing on 20 mm glass coverslips around 5 h, cells were fixed with 2.5% glutaraldehyde at 4 °C. The samples were gently rinsed in three successive baths of ultrapure water and allowed to dry at 25 °C. For imaging in air, AFM images were obtained in peak force tapping mode at room temperature using a Dimension Fastscan AFM apparatus (Bruker Corporation, Germany). The AFM probe was a Silicon Tip that combined a microfabricated Si3N4 cantilever with a nominal spring constant of 0.3 N/m (SNL-C, Bruker Corporation). Images were analyzed using the Nanoscope Analysis (version 1.40, Bruker). Doxorubicin Leakage Profile. First, M1-Dox was dispersed in 0.5 mL of DMEM containing 10% FBS and placed in a 37 °C humidified incubator. The mixture was centrifuged at each hour point. The supernatant (300 μL) was taken for Dox detection by UV spectrophotometer at 481 nm. The Dox leakage profiles from M0Dox were also carried out by this method. The leakage rate of Dox was determined as a percentage compared to the amount of Dox loaded within M1-Dox or M0-Dox. Doxorubicin-Loaded Macrophage Activity Assay. The luminescent cell viability assay kit (Beyotime, China) was used for ATP assay following the manufacturer’s instructions. Briefly, 10,000 M1-Dox or M0-Dox per well were plated in black-wall and clear-bottom microplate in a 37 °C, 5% CO2 incubator. Then 100 μL/well of CellTiter-Lumi reagent was added at described time points. The luminescence was monitored at an integration time of 0.5 s with bottom read mode after incubating for 10 min. The control wells containing medium without cells served as a value for background luminescence. To visualize the morphology of M1-Dox and M0-Dox, cells were observed under digital inverted microscope (EVOS, Fisher Scientific, USA). Cell viability was measured by using the CCK-8 Counting Kit (Dojindo Molecular Technologies) or a 3-[4,5-dimethylthiazole-2-yl]2,5-diphenyltetrazolium bromide (MTT) assay according to the manufacturer’s instructions. Briefly, cells were incubated with culture medium containing the CCK-8 or MTT solution for 4 h at 37 °C, and then the absorbance was read at 450 or 570 nm. In Vitro Tumor Tropism. Tropism assays were carried out with CIM-16 well plates using xCELLigence RTCA-DP instrument (Roche Diagnostics, UK). SKOV3 cell culture supernatant or normal cell CHO culture supernatant after culturing over 48 h was collected and diluted further with RPMI 1640 medium to get desired concentrations. Then they were loaded in the lower wells of the CIM-16 plate. Following upper chamber attachment, the upper well was utilized with 30 μL prewarmed medium, and the plate left for 30 min at room temperature (RT) to pre-equilibrate. M1-Dox and M0-Dox were resuspended to 2 × 105 cells/mL, and 100 μL cell suspension (2 × 104 cells) was placed into each top well. The assembled plate was transferred to the RTCA-DP

machine, and data were collected every 5 min over the course of 240 sweeps (20 h in total). This produces a signal of electrical impedance, which is reflected in the cell index as shown in the representative trace. Rising cell impedance therefore correlates to increasing numbers of migrated macrophages adhering to the lower chamber. Cytotoxicity Assay. SKOV3 cells were incubated for 24 h at 5000 cells/well using 96-well plates (Costar, USA). When reaching to 70− 80% confluence, the cells were exposed to varying concentrations of M1-Dox or M0-Dox for another 48 h. To determine cell viabilities, 20 μL of MTT solution (5 mg/mL, in phosphate buffered saline) was added to 100 μL of medium in each well of the 96-well plate. The plate was placed in a cell culture incubator until purple precipitates were clearly visible (approximately 4 h). Then, 150 μL of DMSO was added. The absorbance in each well was measured at 570 nm in a microtiter plate reader (Bio-Tek, USA). Apoptosis Assay. Annexin-V/PI labeling was performed according to the manufacturer’s recommendations. Apoptosis assay was performed on a flow cytometer (EPICS XL, Beckman Coulter, USA). 2.0 × 105 cells were treated with cell culture medium (control), M1Dox, M0-Dox, Lipo-Dox, and DoxHCl at the concentration of 0.6625 μM for SKOV3. After 48 h incubation, cells were washed with 400 μL PBS twice and resuspended in 400 μL binding buffer. Cells were stained with 10 μL Annexin V-FITC and 5 μL propidium iodide (PI) solution provided in the kit in dark for 15 min. At least 10,000 cells were analyzed to determine the percentage of dead cells. In Vitro Anti-Invasion Activity. Cell invasion tests were carried out with CIM-16 well plates with each well consisting of an upper and a lower chamber separated by a microporous membrane containing randomly distributed 8 μm pores using xCELLigence RTCA-DP instrument (Roche Diagnostics, UK). This system measures a dimensionless parameter called cell index, which evaluates the ionic environment at an electrode/solution interface and integrates information on cell number. The cell culture complete medium was loaded in each lower well of the CIM-16 plate. After upper chamber attachment, the upper chamber was coated with matrigel and equilibrated at 37 °C for 4 h. To initiate an experiment, 100 μL of the cell suspension was then seeded into the wells (10,000 cells per well). After cell addition, CIM-16 plates were incubated for 30 min at room temperature in the laminar flow hood to allow the cells to settle onto the membrane according to the manufacturer’s guidelines. Tumor cells were seeded in upper wells and remained static for another 30 min at room temperature. Each condition was performed in duplicate with a programmed signal detection schedule for each 5 min during 7 h of incubation. All data were recorded by the supplied RTCA software (vs 1.2.1). To analyze the results, the cell index values of the selected wells at 1 h were set to a constant (delta constant) with a default value of one. Western Blot Analysis. M-Sec and iNOS expression levels in cells were detected by carrying out denaturing, nonreducing SDS-PAGE electrophoresis. Cells were lysed with RIPA-buffer (20 mM Tris pH 7.5, 150 mM NaCl, 0.5 mM EDTA-2Na, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate, 1% IGEPAL) supplemented with Complete Mini EDTA-free protease inhibitor (Roche Applied Science) and 1% phosphatase inhibitor cocktail 2 and 3 (P5726 and P0044, SigmaAldrich), scraped off after 5 min on ice, and centrifuged at 14,000 g for 20 min at 4 °C. SDS-polyacrylamide gel electrophoresis was carried out with 20−35 μg of whole-cell lysate from each sample. The gels were blotted onto polyvinylidenedifluoride membrane (Millipore) and blocked for 1 h at room temperature. Primary antibodies were added, and membranes were left to incubate overnight at 4 °C. After washing three times with TBST buffer, HRP-conjugated secondary antibodies, diluted 1:3000 in blocking buffer, were added, and blots were incubated further for 1 h at room temperature. Blots were scanned on gel imaging system (4600, Tanon, China). Western blots were quantified using ImageJ. The background of the blots was subtracted by applying the rolling ball subtraction with a radius of 50 pixels. Afterward the integrated intensity of the bands was measured. RNA Preparation and Real-Time Quantitative PCR. Total RNA was extracted from 5 × 106 cells using RNAiso Plus (TaKaRa) and was reverse-transcribed into cDNA using the PrimeScript RT Reagent Kit (TaKaRa) according to the manufacturer’s instructions. Prepared O


Article

ACS Nano cDNA was then subjected to quantitative PCR analysis. A Bio-Rad MyiQ Real-Time PCR Detection System (Bio-Rad Laboratories) was used to measure SYBR Green (IQ SYBR Green Supermix, Bio-Rad Laboratories) incorporation with the following protocol: 95 °C for 15 s, 40 cycles of 94 °C for 10 s, 60 °C for 30 s, 72 °C for 30 s. Data acquisition was performed during this 72 °C extension step. Melting curve analysis was performed from 72 to 95 °C. The change in cycling threshold (ΔΔCt) method was used to analyze levels of transcripts, and data were normalized to the level of GAPDH. The primers were as follows: CCR2: GCTCATCTTTGCCATCATGATT (for), TCATTCCAAGAGTCTCTGTCAC (rev); CCR4: AAATACAAGAGGCTCAAGTCCA (for), GATGGCCAGGTATCTGTCTATG (rev); CCL2: AGAATCACCAGCAGCAAGTGTCC (for), TTGCTTGTCCAGGTGGTCCATG (rev); M-Sec: CTGGAGGTGGTGGTGGAGAGG (for), CAGAGCAGCAGCAAGTAGGTATCC (rev). mRNA Sequencing. Samples were shipped to the Guangdong Longsee Medical Corporation for library construction, and mRNA-Seq RNA quality was assessed by a Bioanalyzer (Agilent). Total RNA with good integrity values (RNA integrity number >9.0) was used for poly(A) selection and library preparation using the Illumina TruSeq RNA library preparation kit. The samples were run on an Illumina Hiseq Xten instrument and were sequenced to the depth of 35−50 million paired-end 150-bp reads per sample. These RNA-seq data have been deposited in the National Center for Biotechnology Information Gene Expression Omnibus database (accession no. GSE112174). 3D Multicellular Tumor-Immune Spheroid Model. 3D tumorimmune spheroid model consisting of macrophages and tumor cells was prepared in 96-well low-attachment culture plates following the manufacturer’s instructions. When the cells reached approximately 80% confluence, they were harvested by trypsinization and resuspended to get single-cell suspension. To generate multicellular spheroids, the mixture of 100 RAW264.7 cells and 500 tumor cells in 100 μL of culture media was seeded into 96-well low-attachment culture plates, and the plates were incubated for 72 h in a 37 °C humidified incubator with 5% CO2 until spheroids formed. The successful construction of 3D tumorimmune spheroid model was determined by light microscopy of hematoxylin and eosin (H&E)-stained sections. After subsequent drug treatments, a digital inverted microscope (EVOS, Fisher Scientific, USA) was applied to monitor the spheroid formation and growth. Cell viability was measured using a Calcein-AM/propidium iodide (PI) double staining kit (YEASEN Biotechnology, China) based on manufacturer’s protocol. Live cells were identified by the conversion of the cell permeant nonfluorescent Calcein-AM to the fluorescent calcein dye by intracellular esterase activity, while dead cells with the permeabilized membrane were stained with membrane-impermeable fluorescent dye PI at 96 h after exposure to drugs. The relative fluorescence intensities of the red-fluorescent (PI, λex 535 nm, λem 617 nm) dead cells versus the green-fluorescent (Calcein-AM, λex 490 nm, λem 515 nm) live cells in spheroids were used to evaluate activities. Quantification analysis of signal intensity was determined with ImageJ software (NIH). The spheroids volumes were estimated from the major (a) and minor (b) axes using the following formula: a × b2 × 0.5. Dox Transfer into Tumor Cells. One ×105 cells/well was seeded in a 12-well dish for 24 h prior to each experiment. M1-Dox, M0-Dox, or Lipo-Dox (equivalent to 16 μM of Dox) were added and further incubated for 0.5, 1, 2, 4, 8, 12, 24, or 48 h at 37 °C. Dox was used as a fluorescent marker. After incubation, cells were washed three times with PBS, trypsinized, and then analyzed via flow cytometry. Pharmacological inhibition of Dox transfer was performed by treating cells with GW4869 (20 μM) for 24 h, CytoB (350 nM) for 6 h, or M-Sec siRNA (50 nM) for 24 h followed by the addition of drugs for 4 h and analysis by flow cytometry. Twenty-four h prior to each experiment, 1 × 105 cells/well were plated onto 12 mm borosilicate glass coverslips. M1-Dox, M0-Dox, or Lipo-Dox (equivalent to 16 μM of Dox) drugs were added and incubated for 2, 4, or 24 h at 37 °C. After incubation, the cells were washed three times with PBS, fixed in PFA, stained with 4,6-diamidino2-phenylindole (DAPI) for 15 min, washed three times, and mounted on glass slides using Prolong Gold antifade reagent (Molecular Probes).

Cells were visualized by the laser scanning microscope (FV3000, Olympus, Japan). Image acquisition was performed by Olympus fluoview3000 software (FV31S-SW). Scanning Electron Microscopy. After 1 × 105 SKOV3 cells were attached on 20 mm glass coverslips, 1 × 104 M1-Dox was added to coculture for 2 h. Scanning electron microscopy was performed with samples of cells fixed with glutaraldehyde that were dehydrated, sputter coated with gold to 20 nm thickness in a Leica EM ACE200 highvacuum sputter coater, and dried in a Bal-Tec CPD030 critical point dryer (32 °C, 75 bar). Imaging was done with a scanning electron microscope (S-3400N, Hitachi, Japan) at 10 kV. Live-Cell Fluorescence Imaging. After 2 × 105 SKOV3 cells grew on a glass-bottomed Petri dish for 24 h, 2 × 104 M1-Dox was added to co-culture with tumor cells. Real-time videos of the samples were recorded under the laser scanning microscope (FV3000, Olympus, Japan). Image acquisition was performed by Olympus fluoview3000 software (FV31S-SW). Super-Resolution Total-Internal Reflection FluorescenceStructured Illumination Microscopy. All 3D-SIM imaging was performed on a DeltaVision OMX SR 3D-SIM Imaging System (GE) equipped with an Olympus 60×/1.42 NA objective using excitation at 488 nm for Dox and 640 nm for F-actin. Raw images were reconstructed using Softworx (Applied Precision). For 3D-SIM, a Weiner constant of 0.001 was used. Linear adjustments for contrast and brightness were made to images using ImageJ. M-Sec Knockdown. RAW264.7 cells or SKOV3 cells were transiently transfected with 50 nM of siRNA duplexes specific for MSec (Tnfaip2) using Lipofectamine RNAiMAX transfection reagent (Life Technologies, Germany). After 24 h post-transfection, SKOV3 cells were challenged to M1-Dox (equivalent to 4 μM of Dox) or siM1Dox that treated by M-Sec siRNA for 24 h. The Dox positive cells were determined by flow cytometry and CLSM as described above. Cellular apoptosis was measured by Annexin V/PI double staining, and cell viability was analyzed using MTT assay. Following small RNA sequences were used. Tnfaip2-Homo: 5′-CGGCUCUCGUCUUCAACAAtt-3′ (sense), 5′-AAAUUCAUUAAAGGCGCGCTT-3′ (antisense); Tnfaip2-Mus: 5′-GCUUCAAGGUGUCGGGCUUTT-3′ (sense), 5′-AAGCCCGACACCUUGAAGCTT-3′ (antisense). Transwell Assay. To assess the ability of Dox transfer after inhibiting the tunneling nanotubes, SKOV3 cells were seeded into the bottom wells of transwell plates with 0.4 μm pore-size (12-well, Corning), which allowed free diffusion of molecules between the two chambers but not cell translocation. Once the SKOV3 cells adhered, M1-Dox was then plated onto transwell inserts for incubation about 24 h. At the end of treatment, the number of surviving cells was determined by the crystal violet staining method. Briefly, surviving cells in six-well plates were washed twice with PBS, and then crystal violet solution (Sigma-Aldrich) was added to the cells. After washing with PBS, plates were left to dry overnight. On the following day, a solution of 10% acetic acid was added to each well, and the number of surviving cells was determined by measuring absorbance at 562 nm. A digital inverted microscope (EVOS, Fisher Scientific, USA) was applied to capture the live cells by the Calcein-AM. Tumor Tropism of M1-Dox in Vivo. The intraperitoneal metastatic xenograft mouse model of human epithelial ovarian cancer was established by injecting 1 × 107 SKOV3 cells (in 200 μL) into the abdomen of the BALB/c nude mice. After 2 weeks, tumor-bearing mice and healthy mice were intraperitoneal injected with DiD-labeled M1 (M1-DiD) and DiD-labeled liposomes (Lipo-DiD), respectively. The mice were killed 24 h after injection. Tumors and major organs (heart, lung, liver, spleen, kidneys, gastrointestinal tract, and uterine appendages) were collected for fluorescence imaging. Fluorescence imaging was performed using the Night OWLIILB983 (Berthold Technologies). All images were acquired with an exposure time of 5 s. The photographic and fluorescent images were individually acquired and then overlaid. Detection of DiD Fluorescence, Immunohistochemistry, and Confocal Imaging. DiD fluorescence was used to define levels of M1DiD or Lipo-DiD penetration throughout metastatic tumor tissues. Freshly isolated tumor samples were fixed overnight at 4 °C in 4% P


Article

ACS Nano ORCID

paraformaldehyde (PFA), embedded in 4% low-melting agarose, and cut by a vibrating microtome (HM650; Microm) to obtain 50 μm-thick serial sections. Sections were blocked with 2% normal donkey serum (Jackson Immuno Research) for 1 h at RT, permeabilized in PBS supplemented with 0.3% TritonX-100 overnight, and stained with the mouse anti-Ki67 (1:500; eBiosciences). Subsequently, sections were incubated with the corresponding secondary antibodies in blocking buffer containing DAPI (1:1000; Invitrogen) for 2 h at RT and embedded using AF1 (Citifluor Ltd.) or Vectashield (Vector Laboratories). Sections were imaged with Olympus fluoview3000 software (FV31S-SW) and processed using Photoshop CS3/CS5 and Fiji (ImageJ) software. In Vivo Therapeutic Efficacy. The intraperitoneal metastatic xenograft mouse model of human epithelial ovarian cancer was established using the same method described above at day 0. After 7 days, the mice were randomly assigned to 4 groups. M1-Dox, Lipo-Dox, and DoxHCl with the equivalent Dox concentration of 2 mg/kg were given to mice by i.p. every 3 days for 3 weeks. Another group was given vehicle solution 5% glucose as the control group. At day 28, 3 days after the last administration, mice were sacrificed, and organs were harvested, photographed, and weighed. Then, major organs were subjected to histopathological examination after being fixed in 10% neutral formalin and desiccated and embedded in paraffin. Statistical Analysis. All statistical analysis was performed using Prism 7.0 software (GraphPad Software) by an unpaired Student’s t test, one-way or two-way ANOVA with Bonferroni multiple comparisons post-test. Statistical significance for survival curve was calculated by the log-rank test. Data were approximately normally distributed, and variance was similar between the groups. Statistical significance is indicated as * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001.

Cuifeng Wang: 0000-0003-4198-909X Min Feng: 0000-0002-9062-8074 Author Contributions ∥

These authors contributed equally to this work. L.G. designed the experiments with the help from C.W. and M.F. L.G. and Y.Z. conducted the experiments. All authors performed the data analysis and interpreted the results. L.G. and M.F. wrote the manuscript. C.W. and M.F. conceived the project.

Notes

The authors declare no competing financial interest.

ACKNOWLEDGMENTS We thank Li Gong for the support on atomic force microscope measurement and Cui Liu for the help of tropism assays. Thanks to Qi Liu for reading the manuscript with great care and offering invaluable advice and informative suggestions. We also gratefully acknowledge the National Natural Science Foundation of China (project nos. 81872805, 81603040), Guangdong Natural Science Fund (project nos. 2016A030311008, 2017A030313819), Fundamental Research Funds for the Central Universities (project no. 16ykjc05), and Guangdong Provincial Key Laboratory of Construction Foundation (project no. 2017B030314030) for their financial support of this research. REFERENCES (1) Sapiezynski, J.; Taratula, O.; Rodriguez-Rodriguez, L.; Minko, T. Precision Targeted Therapy of Ovarian Cancer. J. Controlled Release 2016, 243, 250−268. (2) Labidi-Galy, S. I.; Papp, E.; Hallberg, D.; Niknafs, N.; Adleff, V.; Noe, M.; Bhattacharya, R.; Novak, M.; Jones, S.; Phallen, J.; Hruban, C. A.; Hirsch, M. S.; Lin, D. I.; Schwartz, L.; Maire, C. L.; Tille, J. C.; Bowden, M.; Ayhan, A.; Wood, L. D.; Scharpf, R. B.; et al. High Grade Serous Ovarian Carcinomas Originate in the Fallopian Tube. Nat. Commun. 2017, 8, 1093. (3) Park, C. S.; Kim, T. K.; Kim, H. G.; Kim, Y. J.; Jeoung, M. H.; Lee, W. R.; Go, N. K.; Heo, K.; Lee, S. Therapeutic Targeting of Tetraspanin8 in Epithelial Ovarian Cancer Invasion and Metastasis. Oncogene 2016, 35, 4540−4548. (4) Naora, H.; Montell, D. J. Ovarian Cancer Metastasis: Integrating Insights from Disparate Model Organisms. Nat. Rev. Cancer 2005, 5, 355−366. (5) Feng, M. Y.; Chen, J. Y.; Weissman-Tsukamoto, R.; Volkmer, J. P.; Ho, P. Y.; McKenna, K. M.; Cheshier, S.; Zhang, M.; Guo, N.; Gip, P.; Mitra, S. S.; Weissman, I. L. Macrophages Eat Cancer Cells Using Their Own Calreticulin as a Guide: Roles of TLR and Btk. Proc. Natl. Acad. Sci. U. S. A. 2015, 112, 2145−2150. (6) Nakatsumi, H.; Matsumoto, M.; Nakayama, K. I. Noncanonical Pathway for Regulation of CCL2 Expression by an mTORC1-FOXK1 Axis Promotes Recruitment of Tumor-Associated Macrophages. Cell Rep. 2017, 21, 2471−2486. (7) Hara, T.; Nakaoka, H. J.; Hayashi, T.; Mimura, K.; Hoshino, D.; Inoue, M.; Nagamura, F.; Murakami, Y.; Seiki, M.; Sakamoto, T. Control of Metastatic Niche Formation by Targeting APBA3/Mint3 in Inflammatory Monocytes. Proc. Natl. Acad. Sci. U. S. A. 2017, 114, E4416−E4424. (8) Miller, M. A.; Zheng, Y. R.; Gadde, S.; Pfirschke, C.; Zope, H.; Engblom, C.; Kohler, R. H.; Iwamoto, Y.; Yang, K. S.; Askevold, B.; Kolishetti, N.; Pittet, M.; Lippard, S. J.; Farokhzad, O. C.; Weissleder, R. Tumour-Associated Macrophages Act as a Slow-Release Reservoir of Nano-Therapeutic Pt(IV) Pro-Drug. Nat. Commun. 2015, 6, 8692. (9) Li, S.; Feng, S.; Ding, L.; Liu, Y.; Zhu, Q.; Qian, Z.; Gu, Y. Nanomedicine Engulfed by Macrophages for Targeted Tumor Therapy. Int. J. Nanomed. 2016, 11, 4107−4124.

ASSOCIATED CONTENT S Supporting Information *

The following files are available free of charge. The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acsnano.8b08872. Videos S1−S4 contain the following: (1) SKOV3 cells tethered to M1-Dox; (2) the process of tunneling nanotube formation between M1 macrophages and SKOV3; (3) the intercellular tunneling nanotube network between M1-Dox and two SKOV3 cells; (4) accumulation of Dox in the nucleus of a SKOV3 cell (ZIP) Figures S1−S12 depict additional information: (1) Characterization of M1-Dox and M0-Dox; (2) evaluation of natural tropism of Dox-loaded macrophages in vitro; (3) cytotoxicity and anti-invasion effects in vitro; (4) the cytotoxic effects on the 3D tumor-immune spheroids; (5) Dox transfer from M1-Dox to tumor cells; (6) other related genes of Akt signaling cascade; (7) Dox transfer from M1-Dox to SKOV3 cells via tunneling nanotubes; (8) images illustrated the nuclear accumulation of Dox via tunneling nanotubes; (9) inhibition of tunneling nanotube formation impede M1-Dox drug delivery; (10) biodistribution of M1-DiD in advanced ovarian carcinoma mouse model at 8 h; (11) in vivo therapeutic efficacy of M1-Dox against advanced ovarian carcinoma; (12) representative macroscopic appearance of peritoneal cavity (PDF)

AUTHOR INFORMATION Corresponding Authors

*E-mail: [email protected]. *E-mail: [email protected]. Q


Article

ACS Nano (10) Xie, Z.; Su, Y.; Kim, G. B.; Selvi, E.; Ma, C.; Aragon-Sanabria, V.; Hsieh, J. T.; Dong, C.; Yang, J. Immune Cell-Mediated Biodegradable Theranostic Nanoparticles for Melanoma Targeting and Drug Delivery. Small 2017, 13, 1603121. (11) Muthana, M.; Giannoudis, A.; Scott, S. D.; Fang, H. Y.; Coffelt, S. B.; Morrow, F. J.; Murdoch, C.; Burton, J.; Cross, N.; Burke, B.; Mistry, R.; Hamdy, F.; Brown, N. J.; Georgopoulos, L.; Hoskin, P.; Essand, M.; Lewis, C. E.; Maitland, N. J. Use of Macrophages to Target Therapeutic Adenovirus to Human Prostate Tumors. Cancer Res. 2011, 71, 1805− 1815. (12) Baek, S. K.; Makkouk, A. R.; Krasieva, T.; Sun, C. H.; Madsen, S. J.; Hirschberg, H. Photothermal Treatment of Glioma; an In Vitro Study of Macrophage-Mediated Delivery of Gold Nanoshells. J. NeuroOncol. 2011, 104, 439−448. (13) Galloway, N. L.; Doitsh, G.; Monroe, K. M.; Yang, Z.; MunozArias, I.; Levy, D. N.; Greene, W. C. Cell-to-Cell Transmission of HIV-1 Is Required to Trigger Pyroptotic Death of Lymphoid-Tissue-Derived CD4 T Cells. Cell Rep. 2015, 12, 1555−1563. (14) Carr, J. M.; Hocking, H.; Li, P.; Burrell, C. J. Rapid and Efficient Cell-to-Cell Transmission of Human Immunodeficiency Virus Infection from Monocyte-Derived Macrophages to Peripheral Blood Lymphocytes. Virology 1999, 265, 319−329. (15) Chauveau, A.; Aucher, A.; Eissmann, P.; Vivier, E.; Davis, D. M. Membrane Nanotubes Facilitate Long-Distance Interactions between Natural Killer Cells and Target Cells. Proc. Natl. Acad. Sci. U. S. A. 2010, 107, 5545−5550. (16) Rustom, A.; Saffrich, R.; Markovic, I.; Walther, P.; Gerdes, H. H. Nanotubular Highways for Intercellular Organelle Transport. Science 2004, 303, 1007−1010. (17) Gerdes, H. H. Prions Tunnel between Cells. Nat. Cell Biol. 2009, 11, 235−236. (18) Bittins, M.; Wang, X. TNT-Induced Phagocytosis: Tunneling Nanotubes Mediate the Transfer of Pro-Phagocytic Signals from Apoptotic to Viable Cells. J. Cell. Physiol. 2017, 232, 2271−2279. (19) Tardivel, M.; Begard, S.; Bousset, L.; Dujardin, S.; Coens, A.; Melki, R.; Buee, L.; Colin, M. Tunneling Nanotube (TNT)-Mediated Neuron-to Neuron Transfer of Pathological Tau Protein Assemblies. Acta Neuropathol. Commun. 2016, 4, 117. (20) Bracq, L.; Xie, M.; Benichou, S.; Bouchet, J. Mechanisms for Cellto-Cell Transmission of HIV-1. Front. Immunol. 2018, 9, 260. (21) Hashimoto, M.; Bhuyan, F.; Hiyoshi, M.; Noyori, O.; Nasser, H.; Miyazaki, M.; Saito, T.; Kondoh, Y.; Osada, H.; Kimura, S.; Hase, K.; Ohno, H.; Suzu, S. Potential Role of the Formation of Tunneling Nanotubes in HIV-1 Spread in Macrophages. J. Immunol. 2016, 196, 1832−1841. (22) Desir, S.; O’Hare, P.; Vogel, R. I.; Sperduto, W.; Sarkari, A.; Dickson, E. L.; Wong, P.; Nelson, A. C.; Fong, Y. M.; Steer, C. J.; Subramanian, S.; Lou, E. Chemotherapy-Induced Tunneling Nanotubes Mediate Intercellular Drug Efflux in Pancreatic Cancer. Sci. Rep. 2018, 8, 9484. (23) Condeelis, J.; Pollard, J. W. Macrophages: Obligate Partners for Tumor Cell Migration, Invasion, and Metastasis. Cell 2006, 124, 263− 266. (24) Tarique, A. A.; Logan, J.; Thomas, E.; Holt, P. G.; Sly, P. D.; Fantino, E. Phenotypic, Functional, and Plasticity Features of Classical and Alternatively Activated Human Macrophages. Am. J. Respir. Cell Mol. Biol. 2015, 53, 676−688. (25) Choi, S. R.; Britigan, B. E.; Moran, D. M.; Narayanasamy, P. Gallium Nanoparticles Facilitate Phagosome Maturation and Inhibit Growth of Virulent Mycobacterium Tuberculosis in Macrophages. PLoS One 2017, 12, No. e0177987. (26) Schiavone, M.; Formosa-Dague, C.; Elsztein, C.; Teste, M. A.; Martin-Yken, H.; De Morais, M. A.; Dague, E.; Francois, J. M. Evidence for a Role for the Plasma Membrane in the Nanomechanical Properties of the Cell Wall as Revealed by an Atomic Force Microscopy Study of the Response of Saccharomyces Cerevisiae to Ethanol Stress. Appl. Environ. Microbiol. 2016, 82, 4789−4801.

(27) Nagarsheth, N.; Wicha, M. S.; Zou, W. P. Chemokines in the Cancer Microenvironment and Their Relevance in Cancer Immunotherapy. Nat. Rev. Immunol. 2017, 17, 559−572. (28) Sierra-Filardi, E.; Nieto, C.; Dominguez-Soto, A.; Barroso, R.; Sanchez-Mateos, P.; Puig-Kroger, A.; Lopez-Bravo, M.; Joven, J.; Ardavin, C.; Rodriguez-Fernandez, J. L.; Sanchez-Torres, C.; Mellado, M.; Corbi, A. L. CCL2 Shapes Macrophage Polarization by GM-CSF and M-CSF: Identification of CCL2/CCR2-Dependent Gene Expression Profile. J. Immunol. 2014, 192, 3858−3867. (29) Ran, S. The Role of TLR4 in Chemotherapy-Driven Metastasis. Cancer Res. 2015, 75, 2405−2410. (30) Zhu, L.; Wang, T.; Perche, F.; Taigind, A.; Torchilin, V. P. Enhanced Anticancer Activity of Nanopreparation Containing an MMP2-Sensitive PEG-Drug Conjugate and Cell-Penetrating Moiety. Proc. Natl. Acad. Sci. U. S. A. 2013, 110, 17047−17052. (31) Sant, S.; Johnston, P. A. The Production of 3D Tumor Spheroids for Cancer Drug Discovery. Drug Discovery Today: Technol. 2017, 23, 27−36. (32) Hirt, C.; Papadimitropoulos, A.; Mele, V.; Muraro, M. G.; Mengus, C.; Iezzi, G.; Terracciano, L.; Martin, I.; Spagnoli, G. C. ″In Vitro″ 3D Models of Tumor-Immune System Interaction. Adv. Drug Delivery Rev. 2014, 79−80, 145−154. (33) Hanna, S. J.; McCoy-Simandle, K.; Miskolci, V.; Guo, P.; Cammer, M.; Hodgson, L.; Cox, D. The Role of Rho-GTPases and Actin Polymerization During Macrophage Tunneling Nanotube Biogenesis. Sci. Rep. 2017, 7, 8547. (34) Hase, K.; Kimura, S.; Takatsu, H.; Ohmae, M.; Kawano, S.; Kitamura, H.; Ito, M.; Watarai, H.; Hazelett, C. C.; Yeaman, C.; Ohno, H. M-Sec Promotes Membrane Nanotube Formation by Interacting with Ral and the Exocyst Complex. Nat. Cell Biol. 2009, 11, 1427−1432. (35) Abounit, S.; Zurzolo, C. Wiring through Tunneling Nanotubes from Electrical Signals to Organelle Transfer. J. Cell Sci. 2012, 125, 1089−1098. (36) Takahashi, A.; Kukita, A.; Li, Y. J.; Zhang, J. Q.; Nomiyama, H.; Yamaza, T.; Ayukawa, Y.; Koyano, K.; Kukita, T. Tunneling Nanotube Formation Is Essential for the Regulation of Osteoclastogenesis. J. Cell. Biochem. 2013, 114, 1238−1247. (37) Rustom, A.; Saffrich, R.; Markovic, I.; Walther, P.; Gerdes, H. H. Nanotubular Highways for Intercellular Organelle Transport. Science 2004, 303, 1007−1010. (38) Haimovich, G.; Ecker, C. M.; Dunagin, M. C.; Eggan, E.; Raj, A.; Gerst, J. E.; Singer, R. H. Intercellular mRNA Trafficking via Membrane Nanotube-Like Extensions in Mammalian Cells. Proc. Natl. Acad. Sci. U. S. A. 2017, 114, E9873−E9882. (39) Dupont, M.; Souriant, S.; Lugo-Villarino, G.; MaridonneauParini, I.; Verollet, C. Tunneling Nanotubes: Intimate Communication between Myeloid Cells. Front. Immunol. 2018, 9, 43. (40) Panasiuk, M.; Rychlowski, M.; Derewonko, N.; BienkowskaSzewczyk, K. Tunneling Nanotubes as a Novel Route of Cell-to-Cell Spread of Herpesviruses. J. Virol. 2018, 92, e00090. (41) Chauveau, A.; Aucher, A.; Eissmann, P.; Vivier, E.; Davis, D. M. Membrane Nanotubes Facilitate Long-Distance Interactions between Natural Killer Cells and Target Cells. Proc. Natl. Acad. Sci. U. S. A. 2010, 107, 5545−5550. (42) Lukinavicius, G.; Reymond, L.; D’Este, E.; Masharina, A.; Gutfert, F.; Ta, H.; Guether, A.; Fournier, M.; Rizzo, S.; Waldmann, H.; Blaukopf, C.; Sommer, C.; Gerlich, D. W.; Arndt, H.-D.; Hell, S. W.; Johnsson, K. Fluorogenic Probes for Live-Cell Imaging of the Cytoskeleton. Nat. Methods 2014, 11, 731−733. (43) Davis, D. M.; Sowinski, S. Membrane Nanotubes: Dynamic Long-Distance Connections between Animal Cells. Nat. Rev. Mol. Cell Biol. 2008, 9, 431−436. (44) Bukoreshtliev, N. V.; Wang, X.; Hodneland, E.; Gurke, S.; Barroso, J. F.; Gerdes, H. H. Selective Block of Tunneling Nanotube (TNT) Formation Inhibits Intercellular Organelle Transfer between PC12 Cells. FEBS Lett. 2009, 583, 1481−1488. (45) Ferrati, S.; Shamsudeen, S.; Summers, H. D.; Rees, P.; Abbey, J. V.; Schmulen, J.; Liu, X.; Wong, S. T.; Bean, A. J.; Ferrari, M.; Serda, R. R


Article

ACS Nano E. Inter-Endothelial Transport of Microvectors Using Cellular Shuttles and Tunneling Nanotubes. Small 2012, 8, 3151−3160. (46) Hase, K.; Kimura, S.; Takatsu, H.; Ohmae, M.; Kawano, S.; Kitamura, H.; Ito, M.; Watarai, H.; Hazelett, C. C.; Yeaman, C.; Ohno, H. M-Sec Promotes Membrane Nanotube Formation by Interacting with Ral and the Exocyst Complex. Nat. Cell Biol. 2009, 11, 1427−1432. (47) Takahashi, A.; Kukita, A.; Li, Y. J.; Zhang, J. Q.; Nomiyama, H.; Yamaza, T.; Ayukawa, Y.; Koyano, K.; Kukita, T. Tunneling Nanotube Formation Is Essential for the Regulation of Osteoclastogenesis. J. Cell. Biochem. 2013, 114, 1238−1247. (48) Simons, M.; Raposo, G. Exosomes - Vesicular Carriers for Intercellular Communication. Curr. Opin. Cell Biol. 2009, 21, 575−581. (49) Trajkovic, K.; Hsu, C.; Chiantia, S.; Rajendran, L.; Wenzel, D.; Wieland, F.; Schwille, P.; Brugger, B.; Simons, M. Ceramide Triggers Budding of Exosome Vesicles into Multivesicular Endosomes. Science 2008, 319, 1244−1247. (50) Choi, J.; Kim, H. Y.; Ju, E. J.; Jung, J.; Park, J.; Chung, H. K.; Lee, J. S.; Lee, J. S.; Park, H. J.; Song, S. Y.; Jeong, S. Y.; Choi, E. K. Use of Macrophages to Deliver Therapeutic and Imaging Contrast Agents to Tumors. Biomaterials 2012, 33, 4195−4203. (51) He, H. N.; Ye, J. X.; Wang, Y. S.; Liu, Q.; Chung, H. S.; Kwon, Y. M.; Shin, M. C.; Lee, K.; Yang, V. C. Cell-Penetrating Peptides Meditated Encapsulation of Protein Therapeutics into Intact Red Blood Cells and Its Application. J. Controlled Release 2014, 176, 123− 132. (52) Si, J.; Shao, S.; Shen, Y.; Wang, K. Macrophages as Active Nanocarriers for Targeted Early and Adjuvant Cancer Chemotherapy. Small 2016, 12, 5108−5119. (53) Malam, Y.; Loizidou, M.; Seifalian, A. M. Liposomes and Nanoparticles: Nanosized Vehicles for Drug Delivery in Cancer. Trends Pharmacol. Sci. 2009, 30, 592−599. (54) Agrahari, V.; Agrahari, V.; Mitra, A. K. Next Generation Drug Delivery: Circulatory Cells-Mediated Nanotherapeutic Approaches. Expert Opin. Drug Delivery 2017, 14, 285−289. (55) Chen, G.; Roy, I.; Yang, C.; Prasad, P. N. Nanochemistry and Nanomedicine for Nanoparticle-Based Diagnostics and Therapy. Chem. Rev. 2016, 116, 2826−2885. (56) Cleal, K.; He, L.; Watson, P. D.; Jones, A. T. Endocytosis, Intracellular Traffic and Fate of Cell Penetrating Peptide Based Conjugates and Nanoparticles. Curr. Pharm. Des. 2013, 19, 2878− 2894. (57) Vasir, J. K.; Labhasetwar, V. Biodegradable Nanoparticles for Cytosolic Delivery of Therapeutics. Adv. Drug Delivery Rev. 2007, 59, 718−728. (58) Khare, S.; Ratsimandresy, R. A.; de Almeida, L.; Cuda, C. M.; Rellick, S. L.; Misharin, A. V.; Wallin, M. C.; Gangopadhyay, A.; Forte, E.; Gottwein, E.; Perlman, H.; Reed, J. C.; Greaves, D. R.; Dorfleutner, A.; Stehlik, C. The PYRIN Domain-Only Protein POP3 Inhibits AIM2Like Receptor Inflammasomes and Regulates Responses to DNA Virus Infections. Nat. Immunol. 2014, 15, 343−353. (59) Khare, S.; Dorfleutner, A.; Bryan, N. B.; Yun, C.; Radian, A. D.; de Almeida, L.; Rojanasakul, Y.; Stehlik, C. An NLRP7-Containing Inflammasome Mediates Recognition of Microbial Lipopeptides in Human Macrophages. Immunity 2012, 36, 464−476.

S


Tunneling Nanotubular Expressways for Ultrafast ... - ACS Publications

Recommend Documents