Two-Dimensional Difference Gel Electrophoresis Analysis of Streptococcus uberis in Response to Mutagenesis-Inducing Ciprofloxacin Challenge Marjo Poutanen,† Emilia Varhimo,‡ Nisse Kalkkinen,† Antti Sukura,‡ Pekka Varmanen,‡ and Kirsi Savijoki*,† Institute of Biotechnology, and Department of Basic Veterinary Sciences, University of Helsinki, Finland Received May 27, 2008
In Streptococcus uberis, the fluoroquinolone antibiotic ciprofloxacin induces a mutagenic response that is distinct from the SOS paradigm. Two-dimensional differential gel electrophoresis was employed to investigate the effect of ciprofloxacin exposure on the proteome of S. uberis. Twenty-four protein spots exhibiting differential expression (p < 0.05) were identified as enzymes with potential role in oxidative stress, NADH generation and nucleotide biosynthesis. We suggest that these metabolic changes provide S. uberis means to stimulate mutagenesis and adaptation. Keywords: 2-D DIGE • Streptococcus uberis • ciprofloxacin • mutagenesis • antibiotic resistance
Introduction In recent decades, antibiotics have been extensively used in human and veterinary medicine as well as in industrial farming. As a consequence, pathogenic bacteria are repeatedly exposed to antibiotics and such assaults are likely to induce a variety of survival strategies to enhance viability and successful virulence. One of the most concerning outcomes is the evolution of antibiotic resistance during antibiotic therapy. The use of fluoroquinolones (FQ) such as ciprofloxacin (CF) has gained much attention since exposure to these antibiotics has been shown to increase genetic variation, the evolution of resistance by altering metabolism and transiently increasing the mutation rate in a growing number of Gram-negative and Gram-positive bacteria.1-11 FQs are important therapeutic agents in veterinary medicine, and CF is the main metabolite of enrofloxacin used for the treatment of respiratory tract diseases in cattle.12,13 Furthermore, antibiotics are sometimes released into the environment due to incomplete wastewater treatment, potentially leading to a long-term persistence of highly active compounds.14 For example, FQs appear to be particularly stable in environmental settings since as much as 90% of these drugs stored in water under sunlight for 2 months have been shown to remain unaltered.15 FQs are broad-spectrum antibiotics that inhibit the replication of DNA by maintaining DNA topoisomerase IV (coded by parC gene) and gyrase (coded by gyrA) on the DNA and blocking the movement of the replication fork.16 This process is also known to induce mutations via the SOS response system that, according to the current bacterial paradigm, is controlled * To whom correspondence should be addressed. Kirsi Savijoki, University of Helsinki, Institute of Biotechnology, P.O. Box 65, FIN-00014 University of Helsinki, Finland. Phone: (+358) 9 19 15 99 38. Fax: (+358) 9 19 15 93 66. E-mail:
[email protected]. † Institute of Biotechnology, University of Helsinki. ‡ Department of Basic Veterinary Sciences, University of Helsinki.
246 Journal of Proteome Research 2009, 8, 246–255 Published on Web 11/25/2008
by the coprotease RecA and the negative regulator LexA.17 The SOS response is activated when LexA undergoes a self-cleavage reaction in response to DNA damage, and this process relieves the expression of the genes (i.e., LexA regulon) involved in DNA repair, replication restart, and cell-division control.17 Interestingly, induction of the SOS response has been shown to play a remarkable role in promoting CF resistance in Escherichia coli.6,8 Recently, CF treatment was also shown to promote homologous recombination through an SOS-independent mechanism in E. coli, and this is also likely to contribute to the acquisition, evolution and spread of antibiotic resistance determinants in bacteria.18 To combat the emergence of FQ resistance in bacteria, studies aimed at unraveling transcriptome level changes in response to these drugs have been conducted for pathogens such as E. coli, Haemophilus influenzae, Staphylococcus aureus, Pseudomonas aeruginosa and Streptococcus pneumoniae.7,9,19-22 A common finding of these studies was that the expression of several genes involved in DNA replication and repair was induced in response to FQ. Considering the role of FQs as potential resistance promoters, relatively little is known about the FQ-induced proteome changes in pathogens. To our knowledge, such studies have thus far been conducted for Salmonella enterica serovar Typhimurium, Bacillus subtilis and H. influenzae.19,23,24 The genus Streptococcus comprises species that are part of the normal microbiota of animals and humans, although several members of this genus are important pathogens. Streptococcus uberis is a member of the pyogenic group of streptococci and an important environmental mastitis pathogen. Emerging studies suggest that S. uberis species are able to adapt to antibiotic treatments,25 although the mechanisms underlying adaptive mutagenesis in this species, as well as in other Streptococcus species, remain largely unexplored. Intriguingly, streptococci lack the classical LexA-regulated SOS response.26,27 Instead, several Streptococcus species including 10.1021/pr800384j CCC: $40.75
2009 American Chemical Society
research articles
2D DIGE of S. uberis in Response to Ciprofloxacin Challenge S. uberis are equipped with a small gene cassette, hdiR-umuCorf3-orf4 that has been shown in S. uberis to increase UVinducible mutagenesis and antibiotic resistance.27 We recently reported that CF exposure can also induce mutagenesis and antibiotic resistance in S. uberis and that this species, in contrast to the current paradigm established in E. coli, appears to employ distinct mechanisms for CF- and UV-induced mutagenesis.28 In the present study, we have applied a twodimensional difference gel electrophoresis (2-D DIGE) technique coupled with matrix-assisted laser desorption/ionizationtime-of-flight mass-spectrometric (MALDI-TOF MS) peptide mass fingerprinting (PMF) to show that S. uberis responds to CF by controlling synthesis of enzymes with potential role in oxidative damage response and in nucleotide biosynthesis. The obtained data suggest that S. uberis shifts its metabolism into a state enabling increased mutagenesis and development of resistance.
Materials and Methods Bacterial Strains, Medium and Culture Conditions. S. uberis ATCC BAA-854 (0140J) was routinely grown at 37 °C using TSYE agar (3% [w/v] trypticase soy broth, 0.3% [w/v] yeast extract, 1.5% [w/v] Bacto agar) or THY broth (Todd Hewitt broth with 1% [w/v] yeast extract) without shaking. The effect of two concentrations of CF (purchased from MP Biomedicals LLC, Germany) on the growth rate of S. uberis in THY broth was first investigated using triplicate cell cultures. To this end, overnight cultures were diluted 1:100 in THY broth and allowed to grow at 37 °C until OD600 ) 0.2. At this point, the cultures were divided into three aliquots of 15 mL that were supplemented with 0 (control sample), 0.5, or 1.0 µg/mL of CF, and the cell densities at 600 nm were followed until the cultures reached stationary phase. For 2-D DIGE analyses, quadruplicate cultures of S. uberis at OD600 ) 0.2 were treated with 0, 0.5, or 1.0 µg/mL CF. Cells were allowed to grow until OD600 ) 0.5 at which point aliquots of 10 mL were withdrawn and the cells were harvested by centrifugation (4500g, 15 min, 4 °C). Cells were washed once with ice-cold buffer (10 mM Tris-HCl, pH 8.0) containing 30% ethanol. Protein Extraction and CyDye Labeling. Cell disruption and protein extraction in 7 M Urea, 2 M Thiourea, 4.0% CHAPS and 30 mM Trizma-Base was performed as previously described by Suokko et al.29 Proteins were purified using the 2- D Clean-Up Kit (GE Healthcare, Umeå, Sweden) and solubilized in 20 µL of 7 M Urea, 2 M Thiourea, 4.0% CHAPS and 30 mM TrizmaBase. The protein concentration was determined using the 2-D Quant kit (GE Healthcare) according to the manufacturer’s protocol. Samples were labeled with CyDye Fluor minimal cyanine dyes (GE Healthcare) according to the manufacturer’s instructions. Briefly, 25 µg of protein from each of the control and CF-treated cells was labeled with 200 pmol of the Cy3 and Cy5 dyes. As an internal standard, aliquots from each sample were combined and labeled with Cy2 dye. To exclude dye-specific effects, Cy3 and Cy5 were used interchangeably according to a dye-swapping approach (Table 1). The labeling mixtures were incubated on ice in the dark for 30 min and the reactions were quenched with 1 mM lysine followed by incubation for 10 min. The labeled samples were pooled and separated by 2-DE as detailed below. 2-DE. Rehydration and isoelectric focusing (IEF) was performed in a Protean IEF Cell (Bio-Rad, Hercules. CA) as follows. For rehydration, 24 cm ReadyStrip immobilized pH gradient
Table 1. Setup of a DIGE Experiment Using Four Biological Repeats of Samples, And a Dye Swap between Cy3 and Cy5a gel number
Cy3
Cy5
Cy2
1 2 3 4
SuCtr1 SuCtr2 SuCF3 SuCF4
SuCF1 SuCF2 SuCtr3 SuCtr4
Mix Mix Mix Mix
a SuCtr and SuCF refer to samples extracted from untreated (control) and CF-treated S. uberis cells, respectively. Mix refers to a mixture of all SuCtr and SuCF samples of all four repeats.
(IPG) strips spanning pH 4-7 were treated overnight with 500 µL of rehydration buffer (7 M Urea, 2 M Thiourea 4.0% CHAPS, 30 mM Trizma-Base, 1% Biolyte 3/10 Ampholyte, 50 mM DTT and 4 mM Tributylphosphine). For IEF, the pooled CyDyelabeled protein samples were supplemented with 1% (v/w) Biolyte 3-10, 50 mM DTT and 4 mM Tributylphosphine to yield a final volume of 25 µL. Protein samples (each containing 75 µg of protein) were applied to rehydrated IPG-strips by anodic cup-loading. IEF was performed with a gradual increase in voltage (250 V for 15 min, followed by 10 000 V until total of 40 000 Vh) at a constant temperature of 20 °C and maximum current setting of 50 µA per strip. After IEF, strips were first equilibrated for 25 min in 50 mM Tris-HCl (pH 6.8), 6 M urea and 2% SDS (w/v) supplemented with 2% DTT (w/v), followed by a 25 min equilibration in the same solution in which DTT was replaced with 2.5% (w/v) iodoacetamide. For the second dimension, strips were applied to 12% SDS PAGE gels and overlaid with 0.5% molten agarose in 1× SDS running buffer [250 mM glycine, 25 mM Tris-HCl and 0.1% SDS (w/v)] supplemented with a trace of bromophenol blue. Electrophoresis was performed in an Ettan DALTsix Large Vertical System (GE Healthcare) at 80 V for ca. 30 min and at 400 V for ca. 180 min. The 2-D gels were calibrated using 2-D SDS-PAGE Standards (Bio-Rad). Image Analysis. Gels were imaged using the FLA 5100 scanner (Fuji) for each of the three dyes immediately upon completion of the second dimension of electrophoresis. The three fluors were imaged at excitation wavelengths of Cy3/532 nm, Cy5/635 nm, and Cy2/473 nm, and all Cy-dye images were scanned at 100 µm resolution. Images were exported as 16-bit tagged image file format (TIFF) files for analysis. After imaging, the low fluorescence glass plates were removed and the gels were further stained with silver. Cy-dye images were cropped to remove excess area with aid of the ImageQuant TL software version 5.2 (GE Healthcare). The cropped gel image pairs were processed using DeCyder 5.02 software (GE Healthcare) for simultaneous comparison of abundance changes across all four sample pairs. The DeCyder differential in-gel (DIA; performs Cy5/Cy3:Cy2 normalization) module was used for in-gel normalization and pairwise comparisons of protein abundance in untreated and CF-treated samples. The BVA (biological variation analysis) module of DeCyder was then used to quantify differences in volume ratios of spot pairs across all gel images. Protein spots appearing in less than 9 of all 12 valid 2-D DIGE images were excluded from the DeCyder analyses. Spots (with at least a 1.2-fold spot volume ratio change and p < 0.05) were picked from the same gels poststained with silver for further identification. Protein Identification. For in-gel digestion, the silver-stained spots were reduced with DTT and alkylated with iodoacetamide before digestion with trypsin (Sequencing grade Modified Trypsin, Promega Corporation, Madison, WI) at 37 °C overJournal of Proteome Research • Vol. 8, No. 1, 2009 247
research articles
Poutanen et al.
30
night. The peptides were extracted once with 25 mM ammonium bicarbonate and twice with 5% formic acid for 15 min at room temperature, and the extracts were pooled and desalted (ZipTip µ-C18, Millipore Corporation, Billerica, MA). Peptides were eluted directly from the tips onto the sample plate with saturated CHCA (Aldrich, Dorset, U.K.) in 0.1% TFA and 60% ACN. The PMFs were acquired using an Ultraflex TOF/ TOF mass spectrometer (Bruker Daltonik GmbH, Bremen, Germany) equipped with a nitrogen laser operating at 337 nm in positive ion reflectron mode. Spectra were externally calibrated with a calibration standard mixture (P/N 206195, Bruker Daltonik, Bremen, Germany). The resulting peak lists were generated by the FexAnalysis software Biotools 3.0 (Bruker Daltonik). The PMF data were interpreted using a local MASCOT (MASCOT 2.2, Matrix Science, London, U.K.) server running on a Quad-Core Xeon 2.33 GHz processor. The protonated molecular ion “MH+” and “monoisotopic” were defined for the peak mass data input. To conduct homology searches, the S. uberis 0140J protein database was downloaded from the homepage of the genome sequencing project via the Sanger Centre ftp server (ftp://ftp.sanger.ac.uk/pub/pathogens/ su/). Annotation of the identified S. uberis proteins was retrieved from the Sanger Centre at ftp://ftp.sanger.ac.uk/pub/ pathogens/bf/. Database searches were performed using a mass accuracy of 50 ppm, fixed cysteine modification with carbamidomethylation and variable modification due to methionine oxidation. One missed cleavage site was allowed. The protein-protein BLAST search programs (http://www. ncbi.nlm.nih.gov/BLAST/) were used for homology searches of the identified proteins against all protein sequences in the NCBI database. RNA Extraction and Northern Blotting. For total RNA isolation from S. uberis, cells were grown in THY broth at 37 °C to an optical density OD600 ) 0.2 after which CF was added to final concentration of 0, 0.5, or 1.0 µg/mL. Cell samples were taken 60 min after addition of CF. Harvested cells were disrupted with glass beads (106 µm and less in diameter; Sigma) in a homogenizer (Fastprep FB 120; Savant). Total RNA was subsequently purified with an RNeasy mini kit (Qiagen) according to the instructions of the supplier. DNA probes specific for nrdA, ahpF, prsA, and deoC were amplified from ATCC BAA-854 strain by PCR using primer pairs 5′-CAATATCGATACTGCCAACAAAG-3′/5′-GATTCCACTAGGGTCCAATAATTC3′, 5′-GAAGTGACCGAAAAAGGAATTATG-3′/5′-CCTAAAGCTAGAATGGCTGTTTTTG-3′, 5′-TCAATTTTCAGATGGTGAGATAC3′/5′-ATTGGAGTATGGAGGAATTGTGC-3′, and 5′-CTGCAACTGATAACTGACATGC-3′/5′-CCTTATTAAAAGCCGATAGCGTTC-3′, respectively. For Northern analysis, separation and transfer of RNA were carried out using a Latitude precast gel (1.25% Seakem Gold gel, Cambrex, CA) and a Hybond-XL (Amersham Pharmacia Biotech, CA) uncharged nylon membrane following the instructions provided by the manufacturer. The RNA molecular weight marker (0.2-6.0-kb) was obtained from Fermentas. Probe DNAs were labeled with [R-33P]ATP (>92.5 TBq mmol-1) using the DNA Megaprime labeling kit (Amersham Biosciences) following the manufacturer’s instructions. Northern hybridization was carried out as described elsewhere.31 The membrane was scanned and transcripts were quantified using the Fujifilm FLA-5100 scanner and AIDA software version 4.03.031 (Raytest Isotopenmessgeraete Gmbh, Germany). The total amount of RNA present on the membrane was evaluated by hybridizing with a probe specific for S. uberis 248
Journal of Proteome Research • Vol. 8, No. 1, 2009
Figure 1. Growth curves of S. uberis in the absence or presence of CF at final concentrations of 0.5 and 1.0 µg/mL. Briefly, overnight cultures were diluted 1:100 in THY broth and allowed to grow at 37 °C until OD600 ) 0.2, at which time each of the three cultures was further subdivided into three cultures and supplemented with 0 (white square), 0.5 (black diamond), or 1.0 µg/mL of CF (gray circle). The cell density at 600 nm was followed until cells reached stationary phase. The error bars represent the standard error of the mean. The time point of sample withdrawal for 2-D DIGE analyses is indicated by an arrow.
16S rRNA obtained by PCR using primers 5′-GTTTGATCCTGGCTCAGGA-3′ and 5′-GGTGTTACAAACTCTCGTGGT-3′.
Results and Discussion The Effects of CF on Growth of S. uberis in Liquid Cultures. We have previously demonstrated that S. uberis ATCC BAA-854 responds to DNA damaging UV light exposure by inducing the expression of the umuC gene that encodes for the polymerase subunit of the PolV error-prone polymerase.27 The DNA damage response was shown to be accompanied by increased mutagenesis and resistance to both rifampin and CF. Furthermore, it was found that UV induces mainly transition type mutations and UmuC is essential for this process.27 Intriguingly, S. uberis was recently shown to also induce UmuCindependent mutagenesis when exposed to CF.28 The mutagenic activity in S. uberis could be induced by CF at concentrations as low as 0.3 µg/mL, and it was shown to result in a complex pattern of point mutations including transitions, transversions, deletions, and insertions.28 To investigate the consequences of the CF-induced mutagenesis at the proteome level, we first searched for an appropriate concentration of CF and time point of sample withdrawal by examining the effects of CF on the growth of S. uberis in THY broth. To this end, two concentrations of CF were tested: 1.0 µg/mL which was previously determined using E-test strips and TSYE agar plates, as the minimum inhibitory concentration (MIC) for S. uberis ATCC BAA-85427 and 0.5 µg/mL which has been shown to induce mutations in S. uberis.28 As shown in Figure 1, the addition of CF into S. uberis cultures at a cell density of 0.2 at 600 nm did not significantly affect growth during exponential phase. Therefore, to minimize the effect of growth arrest on protein synthesis, the cell samples were withdrawn for pro-
2D DIGE of S. uberis in Response to Ciprofloxacin Challenge teome analyses 1 h after the addition of CF, when cells were still in exponential growth phase (OD600 ) 0.5). It is known that inhibition of replication by quinolone topoisomerase IV (Topo IV)-DNA complexes occurs slowly, consistent with the enzyme being located behind the replication forks.32 It has been shown that slow killing of E. coli cells via Topo IV-mediated functions coincides with the slow inhibition of DNA synthesis requiring eight generations to kill 99% of the cells.33 This could explain why, in the present study, 1.0 µg/mL of CF, equal to the previously determined MIC,28 had no immediate effect on the growth rate of S. uberis when added to an exponentially growing culture. 2-D DIGE Analysis of the CF-Induced Response of S. uberis. Proteomes of untreated and CF-treated (0.5 or 1.0 µg/ mL) S. uberis cells were compared by applying 2-D DIGE and DeCyder analyses to indicate statistically significant differences in relative protein abundance. For this purpose, protein samples extracted from quadruplicate cultures were differentially labeled with CyDye labels for 2-D DIGE using the experimental setup illustrated in Table 1. Figure 2 shows an example of an overlay of one 2-D DIGE gel-triplet representing the S. uberis proteome in pH range from 4 to 7 following challenge with 1.0 µg/mL of CF. S. uberis has a relatively small genome with a coding capacity of 1870 proteins (at ftp:// ftp.sanger.ac.uk/pub/pathogens/bf/). In the present study, codetection of all 2-D gel images using DeCyder software enabled detection of ∼400-500 protein spots in the proteomes of untreated S. uberis cultures (data not shown). The number of protein spots detected in the S. uberis proteomes following CF treatment at concentrations of 0.5 or 1.0 µg/mL did not affect the number of protein spots detected (data not shown). For pairwise comparisons, protein-spots displaying at least a 1.2-fold spot volume ratio change (p < 0.05) were defined as up- or downregulated proteins. Comparative analyses of the S. uberis proteome following CF treatment at 1.0 µg/mL resulted in a total of 24 protein spots that were shown to match these criteria and are illustrated in Figure 2. Profiles of eight individual protein spots exhibiting statistically significant changes in expression levels are shown in Figure 3. All 24 protein spots were excised from the same 2-D gels poststained with silver for MALDI TOF PMF analyses and are specified in Table 2 (for mass spectrometry data see Supplementary Figure 1 in Supporting Information). In one of the spots, two different proteins were identified (Table 2, spot 16), and without further studies, it is impossible to say which of these two proteins was specifically induced by CF. Among the protein spots identified, 15 were upregulated (1.2- to 3.3-fold) and 9 protein spots were downregulated (1.2- to 2.4-fold) in response to CF. These proteins were associated with a variety of functions including nucleotide and amino acid biosynthesis, translation, carbohydrate metabolism and stress-related functions (Table 2). The most upregulated proteins were identified as the F subunit of the alkyl hydroperoxide reductase AhpF (3.3-fold) and the R-chain of the ribonucleoside-diphosphate reductase NrdA (2.2-fold). In addition, NrdA was identified in three adjacent protein spots (spots 2, 20, 21), all of which exhibited increased expression upon CF exposure. This implies that NrdA underwent a charge modification (Figure 2, Table 2). Four other proteins upregulated 1.5- to 2.0-fold were identified as ribose phosphate pyrophosphokinase (PrsA), deoxyribose-phosphate aldolase (DeoC), adenylosuccinate synthetase (AdsS), and inositol-5-monophosphate dehydrogenase (ImpDH). The most profoundly downregulated proteins were cysteine synthase (2.4-
research articles
fold), phosphoglycerate kinase (PKG, 2.1-fold), and sorbitol-6phosphate 2-dehydrogenase (S-6-PDH, 2.5- to 1.7-fold). S-6PDH was identified in two adjacent spots (spots 13 and 23), implying that this protein is post-translationally processed, possibly by phosphorylation, during exponential phase of growth. When we performed 2-D DIGE analysis of S. uberis cells treated with a lower concentration of CF (0.5 µg/mL), only five proteins showed differential expression: NrdA (upregulated by 2.3-fold), ATP synthase A (upregulated by 1.2-fold), S-6-PDH (downregulated by 1.8-fold), threonine kinase (ThrK) (downregulated by 1.4-fold), and PGK (downregulated by 1.8-fold). The volume ratio changes of these proteins were parallel, but uniformly smaller compared to those detected with CF at 1.0 µg/mL (data not shown). To complement the protein expression data, expression analysis of selected genes was performed using Northern blotting with probes specific for genes encoding SUB1225 (NrdA), SUB1753 (AhpF), SUB0020 (PrsA), and SUB0952 (DeoC) (Figure 4). Northern analysis revealed two nrdA specific transcripts with sizes of approximately 4.0-kb and 2.7-kb. In samples treated with CF at 0.5 and 1.0 µg/mL for 60 min, the expression of 4.0-kb transcript was induced by 2.7-fold and 3.4fold, respectively (Figure 4). On the contrary, the shorter nrdAspecific transcript was constitutively expressed under the conditions used (Figure 4). The size of the CF-inducible nrdAspecific transcript (approximately 4.0-kb) indicates that the 2160-bp nrdA gene is part of a polycistronic operon in S. uberis. Northern blotting with ahpF-specific probe revealed a single transcript of approximately 2.5-kb and the amount of this transcript was increased by 2.8-fold and 3.6-fold in the samples treated with CF at 0.5 and 1.0 µg/mL, respectively (Figure 4). Also, the amount of prsA transcript was increased by 1.8- to 1.9 -fold by the presence of CF (Figure 4). The size of the prsAspecific transcript (1.0-kb) is consistent with the predicted size of the prsA gene (975 bp), thus, indicating that it forms a monocistronic transcriptional unit in S. uberis. The deoCspecific probe detected two transcripts of approximately 2.7and 1.0-kb which were constitutively expressed under the conditions used (Figure 4). Thus, the induction of NrdA, AhpF and PrsA expression could also be demonstrated by the transcriptional analyses, whereas in case of DeoC, there is discrepancy. Possible explanations for this discrepancy include the effect of mRNA lability or posttranslational modifications. CF Exposure Induces an Oxidative Damage Response in S. uberis. CF exposure has been reported to cause oxidative stress to pathogens like S. aureus.34 It was recently shown that cellular death induced by all classes of bactericidal antibiotics occurs by promoting hydroxyl radical formation which is mediated by metabolism-related NADH depletion.35 Bacteria adapt to the presence of hydroxyl radicals and other reactive oxygen species (ROS) by increasing the expression of detoxification enzymes such as superoxide dismutase, catalase, and peroxidase in order to decrease the level of ROS.36 Streptococci, including S. uberis, do not express catalase, and therefore, they must rely on other strategies to prevent formation of ROS. In the present study, the upregulation of potential detoxification enzymes such as alkyl hydroperoxide reductase F (AhpF) by 3.3-fold upon CF exposure may play a role in protecting S. uberis from a hyperoxidative environment. In bacteria, alkyl hydroperoxide reductase protein (Ahp) consists of the hydrogen peroxide scavenging component, AhpC, and the disulfide reductase subunit, AhpF, which is required for regeneration Journal of Proteome Research • Vol. 8, No. 1, 2009 249
research articles
Poutanen et al.
Figure 2. 2-D DIGE analysis of S. uberis cells cultured in the absence and presence of CF (1.0 µg/mL). In each gel, 25 µg of one protein sample labeled with Cy3 was loaded together with 25 µg of second protein sample labeled with Cy5 and 25 µg of the standard labeled with Cy2. Images of gel 1. (A) Protein sample isolated from nontreated cells was labeled with Cy3 (corresponding to purple color) and protein sample from cells treated with CF was labeled with Cy5 (corresponding to green color). Overlay of both channels using the above color code, white indicates similarly abundant proteins at the same spot. (B) The same 2-D gel after Silver staining. Cytosolic proteins were fractionated in the first dimension by IEF in a 4-7 linear pH gradient (pI) and in the second dimension by a 12% SDSPAGE (molecular weight, kDa). The image was acquired on a FLA 5100 (Fuji) scanner using the excitation wavelengths as described in Materials and Methods. Following DeCyder analyses, the gels were subjected to silver-staining for protein identification. The numbered protein spots marked with arrows are differentially regulated between control and CF-treated S. uberis cells and are listed in Table 2.
of AhpC.37 The ahpC gene of S. uberis encodes a protein (SUB1752) with predicted molecular weight and pI values of 20.9 kDa and 4.5, respectively (data not shown). However, in the present study, no protein matching these criteria and showing differential expression could be detected or identified in the S. uberis proteome following CF challenge. The AhpC 250
Journal of Proteome Research • Vol. 8, No. 1, 2009
protein of S. pyogenes has been shown to be required for scavenging of endogenous hydrogen peroxide and for virulence in a murine model of infection.38 In S. pyogenes, the genes encoding Ahp (ahpCF) are organized in a two-gene operon structure,39 and this gene organization seems to be conserved also in S. uberis ATCC BAA-854 (Figure 4). Furthermore, the
2D DIGE of S. uberis in Response to Ciprofloxacin Challenge
research articles
region upstream of ahpCF in S. uberis ATCC BAA-854 for the presence of inverted or direct repeat structures representing potential operator sites for DNA binding proteins (data not shown). Intriguingly, a 26-bp imperfect inverted repeat (IR) structure (TTTAGTAAAGTTATAACTTTACTAAA) was located 60 bp upstream of the -35 box of a putative ahpCF promoter (Figure 5). We have previously shown that the transcription of hdiR-umuC-orf3-orf4 operon is induced in response to CF treatment and that the binding site for HdiR regulator is a 26bp IR structure (ATTGTTTAGAATTATTCTAAATAAA) located in the promoter region of the hdiR operon.27 Since HdiR is a regulator that responds to CF exposure and its known target sequence is 54% identical to the IR located in the upstream region of ahpCF (Figure 5B), one of our future goals is to elucidate the role of the IR and its possible interaction with HdiR protein in the expression of ahpCF. It has been shown that inactivation of NADH-producing steps in the tricarboxylic acid (TCA) cycle reduces the available pool of NADH, which decreases the formation of ROS and leads to increased survival of E. coli cells after FQ exposure.35 Enzymes involved in the generation of NADH could be potential mediators of cells’ response to oxidative damage also in S. uberis since enzymes such as S-6-PDH, fructose-6phosphate amidotransferase (GFA), G-3-PDH, and PGK were all downregulated during CF treatment (Table 2). In oral streptococci, sorbitol metabolism has also been shown to be reduced upon oxidative stress.41 In that study, air-exposed cells exhibited a low capacity to regenerate NAD from reduced NADH following inactivation of pyruvate formate-lyase by oxygen, and these changes were accompanied with decreased levels of glycolytic intermediates such as sorbitol 6- phosphate, fructose-6-phosphate and glyceraldehyde 3-phosphate.41 Thus, our results suggest that metabolic pathways leading to NADH depletion and to increase in synthesis of detoxifying enzymes provides S. uberis with increased resistance to oxidative damage.
Figure 3. Three-dimensional (3D) image (A) and statistical analysis (B) of selected protein spots exhibiting differential expression between untreated and CF-treated (1.0 µg/mL) S. uberis. 3D images and statistics were generated using the BVA module of the DeCyder software. Fold-changes are indicated in panel B; positive and negative values indicate protein up- and downregulation in CF-treated cells, respectively.
size of the 2.5 kb transcript detected with ahpF probe (Figure 4) is in good agreement with the predicted size for a dicistronic transcript including ahpC and ahpF. In B. subtilis, PerR regulates the expression of ahpCF by binding to the Per box, a highly conserved operator sequence located in the target promoters.40 Interestingly, regulation of ahpCF expression in S. pyogenes is independent of PerR38 and appears to involve another DNA binding protein, Rgg.38 We searched the DNA
Enzymes Controlling the Deoxynucleotide Pool in S. uberis Were Affected by CF. A fundamental feature of aerotolerant anaerobic bacteria such as streptococci is the ability to synthesize DNA both in the presence or absence of oxygen. This can be accomplished by different ribonucleotide reductases (RNRs) that catalyze the reduction of ribonucleotides to the corresponding deoxyribonucleotides (dNTPs), thereby providing the building blocks for DNA synthesis.42 RNRs are strictly regulated both by cell cycle and environmental signals to maintain sufficient pool of balanced dNTPs for DNA replication and repair.42 In the present study, S. uberis cells treated with CF at 1.0 µg/mL demonstrated increased synthesis of an NrdA (1.6- to 2.2-fold), which is an alpha subunit of NrdAB. NrdAB belongs to class I RNRs, which require molecular oxygen for catalysis and function only under aerobic conditions.42 The genes encoding NrdA and NrdB form a dicistronic operon structure (nrdAB) in E. coli, P. aeruginosa and S. aureus, in which their expression can be induced by DNA damage.7,9,43-45 In the genome of S. uberis, these two genes are separated by a DNA region of 560 bp (data not shown). Northern analyses with nrdA-specific probe revealed a CF induced transcript with size of approximately 4.0 kb, (Figure 5), which could comprise nrdA and nrdB in the same mRNA. However, further transcriptional analyses are needed to elucidate the putative linkage of nrdA and nrdB expression in S. uberis. The potential NrdB is expected to migrate with pI and MW values of 4.4 and 37 kDa, respectively, but no protein matching these criteria was identiJournal of Proteome Research • Vol. 8, No. 1, 2009 251
252
Journal of Proteome Research • Vol. 8, No. 1, 2009 SUB1225 SUB1225
Ribose phosphate pyrophosphokinase (PrsA)
Deoxyribose-phosphate aldolase (DeoC)
Adenylosuccinate synthetase (AdsS)
Inositol-5-monophosphate dehydrogenase (ImpDH)
Ribonucleoside-diphosphate reductase R-chain (NrdA)
Ribonucleoside-diphosphate reductase R-chain (NrdA)
Inositol-5-monophosphate dehydrogenase (ImpDH)
Tryptophanyl -tRNA synthetase (TrpRS)
Elongation factor Ts (EfTS)
Cysteine synthase K/M (CysKM)
3
5
8
10
20
21
22
4
6
14
Threonine kinase (ThK)
D-fructose-6-phosphate
Sorbitol-6-phosphate 2-dehydrogenase (S-6-PDH)
Alkyl hydroperoxide reductase. subunit F (AhpF)
NADH-dependent oxidoreductase
GroEL chaperone
Putative C3-degrading proteinase
ATP synthase R-chain
19
23
1
7
9
11
12
12(12)
12(12)
12(12)
12(12)
12(12)
9(12)
12(12)
12(12)
appear.d
Carbohydrate Metabolism NP_720765 S. mutans UA159 AAL85687.1 S. agalactiae AAM73771 S. agalactiae 2603V/R NP_269618.1 S. pyogenes M1 GAS AAQ05210.1 S. equi ssp. zooepidermicus YP_060290.1 S. pyogenes MGAS10394 NP_720765 S. mutans UA159 12(12)
12(12)
12(12)
12(12)
12(12)
12(12)
12(12)
Stress and Other Metabolic Functions SUB1753 ZP_00785164 9(12) S. agalactiae COH1 SUB0173 YP_001035598 12(12) S. sanquinis SK36 SUB1741 YP_061078.1 12(12) S. pyogenes MGAS10394 SUB1571 NP_269848.1 12(12) S. pyogenes M1 GAS SUB0670 YP598243 12(12) S. pyogenes MGAS10270
SUB1705
SUB0998
SUB1625
SUB1328
SUB1630
SUB1629
SUB1705
SUB1863
Amino Acid and Protein Synthesis YP_597600 12(12) S. pyogenes MGAS9429 SUB1755 YP_061098.1 12(12) S. pyogenes MGAS10394 SUB1379 ZP_00875431.1 12(12) S. suis 89/1591 SUB1327 YP_330713.1 12(12) S. agalactiae A909
SUB1862
SUB0152
SUB0952
Nucleotide Synthesis YP_602720.1 S pyogenes MGAS10750 YP_059336 S. pyogenes MGAS10394 ZP_00875069.1 S. suis 89/1591 YP_279603 S. pyogenes MGAS6180 NP_270113.1 S pyogenes M1 GAS YP_602720.1 S pyogenes MGAS10750 YP_602720.1 S pyogenes MGAS10750 NP_270113.1 S pyogenes M1 GAS
closest homologuec access. no./ strain
-6
-6
46.4 60.3 65.5 28.5
-1.8 -1.5 -1.5 -1.7
1.2 1.3
0.0016
1.4
1.5
54.6
28.4
57.0
42.7
55.1
37.9
-1.8
3.3
42.3
-2.1
38.0
-1.8
28.5
32.6
-2.4
-2.5
37.5
38.5
52.9
81.8
81.8
52.9
47.6
23.3
35.6
81.8
Mw
5.1
4.8
4.7
5.6
5.1
5.9
4.9
7.5
4.9
5.6
4.9
5.9
5.2
5.3
4.8
6.0
5.6
5.3
5.3
5.6
5.3
5.0
5.5
5.3
pIg
theor.
1.6
1.7
1.7
1.5
2.2
2.0
1.5
1.6
1.7
2.2
1.3 × 10-5
3.4 × 10
0.011
0.015
0.0015
0.0031
0.00023
0.0001
0.0056
0.0068
0.00012
0.0056
0.0056
0.0071
0.0061
0.0017
0.011
0.0074
0.0017
9.2 × 10
0.037
0.014
0.00014
p-valuee
av. vol. ratiof
16
42
51
20
32
76
31
43
39
37
83
36
33
66
67
62
65
26
22
33
62
59
43
33
seq. coverage (%)h
10/18
13/63
34/55
6/19
17/28
20/44
20/39
24/37
25/42
13/49
32/100
11/14
33/49
6/18
24/68
24/74
43/84
15/42
11/37
15/32
30/61
11/41
15/95
26/77
no. peaks matchedi/ totalj
a Spot numbers correspond to those in Figure 2. b Annotations for the identified S. uberis proteins were retrieved from the Sanger Centre at ftp://ftp.sanger.ac.uk/pub/pathogens/bf/. c Accession number of the closest homologue obtained from the BLAST homology search against all protein sequences in the NCBI database using the identified S. uberis protein as the query sequence. d Number of times spot was detected from a total of 12 images. e Calculated from t-test. f The average volume value ratio based on the normalized spot volume standardized against the intragel standard provided by DeCyder software analysis. g Theoretical MW (kDa) and pI values were obtained from MASCOT search results. h Percentage of sequence coverage based on the peptides identified. i Number of peaks presenting peptides matched to the identified protein. j Number of mass values used in search. k Two proteins were identified in this spot; therefore, the average volume ratio corresponds to the combination of both proteins.
amidotransferase (GFA)
Arginine deiminase (ArD)
Glyseraldehyde-3-phosphate dehydrogenase (G-3-PDH)
18
k
Sorbitol-6-phosphate 2-dehydrogenase (S-6-PDH) Phosphoglycerate kinase (PGK)
17
16
15
13
16
Ornithine carbamyoltransferase (OTC)
SUB1862
Ribonucleoside-diphosphate reductase R-chain (NrdA)
2
k
SUB1225
name of protein
spot no.a
SUB0020
S. uberis proteinb
Table 2. Proteins Identified from S. uberis following CF Challenge at 1.0 µg/mL
research articles Poutanen et al.
2D DIGE of S. uberis in Response to Ciprofloxacin Challenge
Figure 4. Northern blot analyses of nrdA (SUB1225), ahpF (SUB1753), prsA (SUB0020) and deoC (SUB0952) expression in S. uberis ATCC BAA-854 cells without addition of CF (lane 1) and 60 min after the addition of CF at 0.5 µg/mL (lane 2) and 1.0 µg/ mL (lane 3). The bar diagrams show the relative mRNA induction ratios calculated by dividing the signal from RNA sample by the signal from RNA sample isolated from culture without CF addition. RNA amounts were corrected after rRNA hybridization (data not shown), and results represent the mean values of two independent experiments with standard errors. The numbers on the left indicate the sizes of RNA molecular mass markers used (RiboRuler High Range RNA ladder, Fermentas). Detected transcripts are marked by black triangles.
Figure 5. (A) Schematic presentation of the genetic organization of the ahpCF operon (SUB1752, SUB1753) flanked by the potential promoter region in S. uberis. The predicted -10/-35 hexanucleotides are in gray, the potential translation start codon is marked with a pended arrow and the potential ribosomebinding site (RBS) is underlined. (B) Sequence alignment of the 26-bp inverted repeat (IR) sequence identified upstream of S. uberis ahpCF with the only known target sequence of HdiR, previously identified upstream of the operon hdiR-umuC-orf3orf-4.27 A black background indicates identical nucleotides.
fied among the CF-induced proteins. The gene encoding NrdB has been shown to be expressed at a ∼2-fold lower level compared to that of nrdA in P. aeruginosa and S. aureus upon CF treatment.7,9 Thus, if the nrdAB genes are similarly regulated after CF challenge in S. uberis, the lower level in expression of nrdB is a likely reason for lack of its detection at the proteome level. Other conditions capable of inducing the nrdAB genes have been shown to involve transient depletion of dNTPs and
research articles
exposure to oxygen in P. aeruginosa and S. aureus.44,45 Our present findings suggest that metabolic pathways are altered under those conditions in such a way so as to enable S. uberis to cope with oxidative damage by reducing the available pool of NADH. This might have forced S. uberis to consume dNTPs as an alternative energy source, supported by the finding that a protein spot corresponding to a potential deoxyribophosphate aldolase (DeoC) was upregulated by ∼1.6-fold (Figure 3, Table 2) during the CF challenge. This enzyme is known to play a role in the catabolism of dNTPs arising from dead cells,46 and an ability to utilize exogenous dNTPs as a carbon and energy source may confer a growth advantage to bacteria, as evidenced by previous studies of Streptococcus mutans.47 Hence, transient depletion of dNTPs upon CF challenge in S. uberis could result in the induction of RNRs to correct for imbalances in the dNTP pool. On the other hand, this enzyme may also contribute to increased mutagenesis as overexpression of the NrdAB enzyme, for example, in E. coli, has been shown to result in a balanced increase in dNTP pools, with a concomitant increase in mutagenesis of ∼40-fold.48 Besides NrdA and DeoC, enzymes playing an important role in purine biosynthesis, such as AdsS and ImpDH, were also upregulated in S. uberis following CF exposure (Table 2). There is in vitro evidence that a biased dNTP pool can increase the frequency of base additions and deletions produced by replicative DNA polymerases.49 Intriguingly, sequencing of the rpoB gene of rifampin-resistant S. uberis clones for determination of the CF-induced mutation spectrum has previously revealed a high frequency (21%) of insertions and deletions.28 Furthermore, as the mutant screening did not allow for detection of frame-shift mutations, the observed frequency of deletions and insertions was likely underestimated, if anything.28 The trancriptome studies on CFchallenged P. aeruginosa PAO1, S. aureus 8325, and S. pneumoniae NCTC 7465 as well as its FQ-resistant derivative strain, have demonstrated that pathways contributing to increased mutagenesis were commonly induced.7,9,22 Other metabolic changes associated with CF-challenge were suggested to provide S. aureus and P. aeruginosa time to persist and evolve resistance.7,9 In case of S. pneumoniae, the acquisition of CFresistance was shown to lead to a metabolic state in which the error-prone DNA repair pathways are altered to correct the potential effects of CF.22 On the other hand, previous studies on S. uberis 27,28 and S. pneumoniae10 suggest a minor role for error-prone polymerases in CF induced mutagenesis in Streptococcus. We have previously indicated that CF challenge of S. uberis induces the expression of umuC coding for an errorprone PolV.28 However, the inactivation of umuC did not affect the CF-induced mutagenesis, implying that alternative, yet unknown, mechanisms that contribute to induced mutations exist in S. uberis. Other components capable of error-prone DNA synthesis include DNA polymerases such as DinP and DnaE. However, we have previously demonstrated that the genes encoding these enzymes were not induced by CF.27 In the present study, the increased expression of several proteins involved in de novo nucleotide synthesis and salvage during CF challenge suggests disturbances in the cellular pool of dNTPs, which can reduce the fidelity of the replicative DNA polymerases providing possible mechanism for CF induced mutagenesis.
Conclusions In this study, we have used 2-D DIGE coupled with MALDITOF PMF to analyze the proteome of S. uberis following CF Journal of Proteome Research • Vol. 8, No. 1, 2009 253
research articles challenge at 0.5 and 1.0 µg/mL. In total, 24 protein spots corresponding to 20 distinct proteins were shown to be differentially expressed in S. uberis treated with CF at 1.0 µg/ mL. Of the identified CF induced changes in the proteome, the upregulation of AhpF NrdA and DeoC, and the downregulation of S-6-PDH, G-3-PDH, and PGK could indicate that CF induces oxidative damage response in S. uberis, and that metabolic changes involving downregulation of NADH-producing pathways and imbalanced synthesis of dNTPs enable this species to stimulate mutagenesis eventually leading to development of resistance. In E. coli, the effect of unbalanced or increased dNTP pools is known to be mutagenic and possibly involves SOS regulated proteins like error-prone polymerases. To further investigate the mechanisms behind CF-induced mutagenesis in S. uberis, we are currently constructing a transposon-based mutant library in order to screen for clones exhibiting decreased ability for adaptive mutagenesis.
Acknowledgment. This work was financially supported by grants from the Academy of Finland (decision No. 211165, 209136, 126493 and 114529), Walter Ehrstro¨m Foundation and Mercedes Zachariassen Foundation. Supporting Information Available: Supplementary Figure 1, annotated MS-spectra of protein identifications from comparison of untreated S. uberis versus S. uberis challenged with CF at 1.0 µg/mL. This material is available free of charge via the Internet at http://pubs.acs.org. References (1) Power, E. G. M.; Phillips, I. Induction of the SOS gene (umuC) by 4-quinolone antibacterial drugs. J. Med. Microbiol. 1992, 36, 78– 82. (2) Bla´zquez, J.; Oliver, A.; Go´mez-Go´mez, J. M. Mutation and evolution of antibiotic resistance: Antibiotics as promoters of antibiotic resistance. Curr. Drug Targets 2002, 3, 345–349. (3) Beaber, J. W.; Hochhut, B.; Waldor, M. K. SOS response promotes horizontal dissemination of antibiotic resistance genes. Nature 2004, 427, 72–74. (4) Ubeda, C.; Maiques, E.; Knecht, E.; Lasa, I.; Novick, R. P.; Penade´s, J. R. Antibiotic-induced SOS response promotes horizontal dissemination of pathogenicity island-encoded virulence factors in staphylococci. Mol. Microbiol. 2005, 56, 836–844. (5) Prudhomme, M.; Attaiech, L.; Sanchez, G.; Martin, B.; Claverys, J. P. Antibiotic stress induces genetic transformability in the human pathogen Streptococcus pneumoniae. Science 2006, 313, 89–92. (6) Cirz, R. T.; Chin, J. K.; Andes, D. R.; de Crecy-Lagard, V.; Craig, W. A.; Romesberg, F. E. Inhibition of mutation and combating the evolution of antibiotic resistance. PLoS Biol. 2005, 3, 1024–1033. (7) Cirz, R. T.; Jones, M. B.; Gingles, N. A.; Minogue, T. D.; Jarrahi, B.; Peterson, S. N.; Romesberg, F. E. Complete and SOS-mediated response of Staphylococcus aureus to the antibiotic ciprofloxacin. J. Bacteriol. 2007, 189, 531–539. (8) Cirz, R. T.; Romesberg, F. E. Induction and inhibition of ciprofloxacin resistance-conferring mutations in hypermutator bacteria. Antimicrob. Agents Chemother. 2006, 50, 220–225. (9) Cirz, R. T.; O’Neill, B. M.; Hammond, J. A.; Head, S. R.; Romesberg, F. E. Defining the Pseudomonas aeruginosa SOS response and its role in the global response to the antibiotic ciprofloxacin. J. Bacteriol. 2006, 188, 7101–7110. (10) Henderson-Begg, S. K.; Livermore, D. M.; Hall, L. M. C. Effect of subinhibitory concentrations of antibiotics on mutation frequency in Streptococcus pneumoniae. J. Antimicrob. Chemother. 2006, 57, 849–854. (11) Ysern, P.; Clerch, B.; Castano, M.; Gibert, I.; Barbe, J.; Llagostera, M. Induction of SOS genes in Escherichia coli and mutagenesis in Salmonella typhimurium by fluoroquinolones. Mutagenesis 1990, 5, 63–66. (12) McKellar, Q.; Gibson, I.; Monteiro, A.; Bregante, M. Pharmacokinetics of enrofloxacin and danofloxacin in plasma, inflammatory exudate, and bronchial secretions of calves following subcutaneous administration. Antimicrob. Agents Chemother. 1999, 43, 1988– 1992.
254
Journal of Proteome Research • Vol. 8, No. 1, 2009
Poutanen et al. (13) Grobbel, M.; Lu ¨ bke-Becker, A.; Wieler, J. H.; Froyman, R.; Firederichs, S.; Filios, S. Comparative quantification of the in vitro activity of veterinary fluoroquinolones. Vet. Microbiol. 2007, 124, 73–81. (14) Batt, A. L.; Bruce, I. B.; Aga, D. S. Evaluating the vulnerability of surface waters to antibiotic contamination from varying wastewater treatment plant discharges. Environ. Pollut. 2006, 142, 295– 302. (15) Turiel, E.; Bordin, G.; Rodrı´guez, A. R. Study of the evolution and degradation products of ciprofloxacin and oxolinic acid in river water samples by HPLC-UV/MS/MS-MS. J. Environ. Monit. 2005, 7, 189–195. (16) Drlica, K. Mechanism of fluoroquinolone action. Curr. Opin. Microbiol. 1999, 2, 504–508. (17) DNA Repair and Mutagenesis; Friedberg, E. C., Walker, G. C., Seide, W., Wood, R. D., Schultz, R. A., Ellenberger, T., Eds.; ASM Press: Washington, DC, 2006. (18) Lo´pez, E.; Elez, M.; Matic, I.; Bla´zquez, J. Antibiotic-mediated recombination: ciprofloxacin stimulates SOS-independent recombination of divergent sequences in Escherichia coli. Mol. Microbiol. 2007, 64, 83–93. (19) Gmuender, H.; Kuratli, K.; Di Padova, K.; Gray, C. P.; Keck, W.; Evers, S. Gene expression changes triggered by exposure of Haemophilus influenzae to novobiocin or ciprofloxacin: combined transcription and translation analysis. Genome Res. 2001, 11, 28– 42. (20) Shaw, K. J.; Miller, N.; Liu, X. J.; Lerner, D.; Wan, J.; Bittner, A.; Morrow, B. J. Comparison of the changes in global gene expression of Escherichia coli induced by four bactericidal agents. J. Mol. Microbiol. Biotechnol. 2003, 5, 105–122. (21) Kaldalu, M.; Mei, R.; Lewis, K. Killing by ampicillin and ofloxacin induces overlapping changes in Escherichia coli transcription profile. Antimicrob. Agents Chemother. 2004, 48, 890–896. (22) Marrer, E.; Satoh, A. T.; Johnson, M. M.; Piddock, L. J. V.; Page, M. G. P. Global transcriptome analysis of the responses of a fluoroquinolone-resistant Streptococcus pneumoniae mutant and its parent to ciprofloxacin. Antimicrob. Agents Chemother. 2006, 50, 269–278. (23) Bandow, J. E.; Brotz, H.; Leichert, L. I. O.; Labischinski, H.; Hecker, M. Proteomic approach to understanding antibiotic action. Antimicrob. Agents Chemother. 2003, 47, 948–955. (24) Coldham, N. G.; Randall, L. P.; Piddock, L. J. V.; Woodward, M. J. Effect of fluoroquinolone exposure on the proteome of Salmonella enterica serovar Typhimurium. J. Antimicrob. Chemother. 2006, 58, 1145–1153. (25) Milne, M. H.; Biggs, A. M.; Barrett, D. C.; Young, F. J.; Doherty, S.; Innocent, G. T.; Fitzpatrick, J. L. Treatment of persistent intramammary infections with Streptococcus uberis in dairy cows. Vet. Rec. 2005, 157, 245–250. (26) Gasc, A. M.; Sicard, N.; Claverys, J. P.; Sicard, A. M. Lack of SOS repair in Streptococcus pneumoniae. Mutat. Res. 1980, 70, 157– 165. (27) Varhimo, E.; Savijoki, K.; Jalava, J.; Kuipers, O. P.; Varmanen, P. Identification of a novel streptococcal gene cassette mediating SOS mutagenesis in Streptococcus uberis. J. Bacteriol. 2007, 189, 5210– 5222. (28) Varhimo, E.; Savijoki, K.; Jefremoff, H.; Jalava, J.; Sukura, A.; Varmanen, P. Ciprofloxacin induces mutagenesis to antibiotic resistance independent of UmuC in Streptococcus uberis. Environ. Microbiol. 2008, 10 (8), 2179–2183. (29) Suokko, A.; Poutanen, M.; Savijoki, K.; Kalkkinen, N.; Varmanen, P. ClpL is essential for induction of thermotolerance and is potentially part of the HrcA regulon in Lactobacillus gasseri. Proteomics 2008, 8, 1029–1041. (30) Poutanen, M.; Salusjarvi, L.; Ruohonen, L.; Penttila, M.; Kalkkinen, N. Use of matrix-assisted laser desorption/ionization time-of-flight mass mapping and nanospray liquid chromatography/electrospray ionization tandem mass spectrometry sequence tag analysis for high sensitivity identification of yeast proteins separated by twodimensional gel electrophoresis. Rapid Commun. Mass Spectrom. 2001, 15, 1685–1692. (31) Varmanen, P.; Ingmer, H.; Vogensen, F. K. ctsR of Lactococcus lactis encodes a negative regulator of clp gene expression. microbiology 2000, 146, 1447–1455. (32) Khodursky, A. B.; Cozzarelli, N. R. The mechanism of inhibition of topoisomerase IV by quinolone antibacterials. J. Biol. Chem. 1998, 273, 27668–27677. (33) Khodursky, A. B.; Zechiedrich, E. L.; Cozzarelli, N. R. Topoisomerase IV is a target of quinolones in Escherichia coli. Proc. Nat. Acad. Sci. U.S.A. 1995, 92, 11801–11805.
research articles
2D DIGE of S. uberis in Response to Ciprofloxacin Challenge (34) Becerra, M. C.; Albesa, I. Oxidative stress induced by ciprofloxacin in Staphylococcus aureus. Biochem. Biophys. Res. Commun. 2002, 297, 1003–1007. (35) Kohanski, M. A.; Dwyer, D. J.; Hayete, B.; Lawrence, C. A.; Collins, J. J. A common mechanism of cellular death induced by bactericidal antibiotics. Cell 2007, 130, 797–810. (36) Storz, G.; Imlay, J. A. Oxidative stress. Curr. Opin. Microbiol. 1999, 2, 188–194. (37) Jo¨nsson, T. J.; Ellis, H. R.; Poole, L. B. Cysteine reactivity and thioldisulfide interchange pathways in AhpF and AhpC of the bacterial alkyl hydroperoxide reductase system. Biochemistry 2007, 46, 5709– 5721. (38) Brenot, A.; King, K. Y.; Caparon, M. G. The PerR regulon in peroxide resistance and virulence of Streptococcus pyogenes. Mol. Microbiol. 2005, 55, 221–234. (39) Pulliainen, A. T.; Hytonen, J.; Haataja, S.; Finne, J. Deficiency of the Rgg regulator promotes H2O2 resistance, AhpCF-mediated H2O2 decomposition, and virulence in Streptococcus pyogenes. J. Bacteriol. 2008, 190, 3225–3235. (40) Herbig, A. F.; Helmann, J. D. Roles of metal ions and hydrogen peroxide in modulating the interaction of the Bacillus subtilis PerR peroxide regulon repressor with operator DNA. Mol. Microbiol. 2001, 41, 849–859. (41) Iwami, Y.; Takahashi-Abbe, S.; Takahashi, N.; Abbe, K.; Yamada, T. Rate-limiting steps of glucose and sorbitol metabolism in Streptococcus mutans cells exposed to air. Oral Microbiol. Immunol. 2000, 15, 325–328.
(42) Nordlund, N.; Reichard, P. Ribonucleotide reductases. Annu. Rev. Biochem. 2006, 75, 681–706. (43) Sun, L.; Fuchs, J. A. Escherichia coli ribonucleotide reductase expression is cell cycle regulated. Mol. Biol. Cell. 1992, 3, 1095– 1105. (44) Jordan, A.; Torrents, E.; Sala, I.; Hellman, U.; Gibert, I.; Reichard, P. Ribonucleotide reduction in Pseudomonas species: simultaneous presence of active enzymes from different classes. J. Bacteriol. 1999, 181, 3974–3980. (45) Masalha, M.; Borovok, I.; Schreiber, R.; Aharonowitz, Y.; Cohen, G. Analysis of transcription of the Staphylococcus aureus aerobic class Ib and anaerobic class III ribonucleotide reductase genes in response to oxygen. J. Bacteriol. 2001, 183, 7260–7272. (46) Sgarrella, F.; Poddie, F. P. A.; Meloni, M. A.; Sciola, L.; Pippia, P.; Tozzi, M. G. Channelling of deoxyribose moiety of exogenous DNA into carbohydrate metabolism: Role of deoxyriboaldolase. Comp. Biochem. 1997, 117, 253–257. (47) Han, T. K.; Zhu, Z. W.; Dao, M. L. Identification, molecular cloning, and sequence analysis of a deoxyribose aldolase in Streptococcus mutans GS-5. Curr. Microbiol. 2004, 48, 230–236. (48) Wheeler, L. J.; Rajagopal, I.; Mathews, C. K. Stimulation of mutagenesis by proportional deoxyribonucleoside triphosphate accumulation in Escherichia coli. DNA Repair 2005, 4, 1450–1456. (49) Bebenek, K.; Roberts, J. D.; Kunkel, T. A. The effects of dNTP pool imbalances on frameshift fidelity during DNA-replication. J. Biol. Chem. 1992, 267, 3589–3596.
PR800384J
Journal of Proteome Research • Vol. 8, No. 1, 2009 255
