Ubiquitin Profiling in Liver Using a Transgenic Mouse with Biotinylated

Article pubs.acs.org/jpr

Ubiquitin Profiling in Liver Using a Transgenic Mouse with Biotinylated Ubiquitin Benoît Lectez,† Rebekka Migotti,‡ So Young Lee,† Juanma Ramirez,† Naiara Beraza,† Bill Mansfield,§ James D. Sutherland,† Maria L. Martinez-Chantar,†,∥ Gunnar Dittmar,‡ and Ugo Mayor*,†,⊥ †

CIC bioGUNE, Bizkaia Teknologia Parkea, Building 801-A, 48160 Derio, Basque Country, Spain Max Delbrück Center for Molecular Medicine, Robert-Rössle-Strasse 10, 13125 Berlin, Germany § Wellcome TrustMedical Research Council Stem Cell Institute, University of Cambridge, Tennis Court Road, Cambridge CB2 1QR, United Kingdom ∥ Biochemistry and Molecular Biology Department, University of the Basque Country (UPV/EHU), 48080 Bilbao, Spain ⊥ Ikerbasque, Basque Foundation for Science, Alameda Urquijo, 36-5 Plaza Bizkaia, 48011 Bilbao, Spain ‡

S Supporting Information *

ABSTRACT: Ubiquitination is behind most cellular processes, with ubiquitin substrates being regulated variously according to the number of covalently conjugated ubiquitin molecules and type of chain formed. Here we report the first mammalian system for ubiquitin proteomics allowing direct validation of the MSidentified proteins. We created a transgenic mouse expressing biotinylated ubiquitin and demonstrate its use for the isolation of ubiquitinated proteins from liver and other tissues. The specificity and strength of the biotin−avidin interaction allow very stringent washes, so only proteins conjugated to ubiquitin are isolated. In contrast with recently available antibody-based approaches, our strategy allows direct validation by immunoblotting, therefore revealing the type of ubiquitin chains (mono or poly) formed in vivo. We also identify the conjugating E2 enzymes that are ubiquitin-loaded in the mouse tissue. Furthermore, our strategy allows the identification of candidate cysteine-ubiquitinated proteins, providing a strategy to identify those on a proteomic scale. The novel in vivo system described here allows broad access to tissue-specific ubiquitomes and can be combined with established mouse disease models to investigate ubiquitin-dependent therapeutical approaches. KEYWORDS: ubiquitin, in vivo biotinylation, proteomics, liver, mouse model

■

described,5 but no ubiquitin proteomic data have yet been published. Following trypsin digestion, a remnant from the ubiquitin chain is left at the ubiquitination site on its targets, the diglycinelysine (diGly) signature. In recent years, diGly-specific monoclonal antibodies have been used for the isolation and identification of thousands of putative ubiquitination sites in a number of systems,6−9 including rodents.10,11 However, the diGly signature can also be produced by other less abundant ubiquitinlike proteins such as Nedd8, whose concentration increases dramatically under stress conditions.12 While there is a clear advantage to the identification of the lysines at which ubiquitin (or Nedd8/ISG15) are attached, ubiquitinated proteins can only be isolated after being trypsin-cleaved. This precludes the possibility of immunoblotting on the purified material to validate the ubiquitination of the identified proteins, making it therefore impossible to identify the type of ubiquitin chains

INTRODUCTION Despite its involvement in many physiological and diseaserelated processes, ubiquitination usually targets just a small fraction of any given protein. Even if MS sensitivity has improved dramatically because of the use of innovative techniques,1 it is still challenging to identify this post-translational modification from a whole-protein mixture. The first successful proteomic approach to protein ubiquitination was based on His-tagged ubiquitin and performed in budding yeast.2 However, a His-Ub transgenic mouse3 has yet to yield any results in terms of ubiquitin proteomics. One simple reason for this could be the presence of far too many endogenous 6xHis-containing proteins in mammals. A BLAST search for this motif in mice results in over 100 hits, and many more proteins with nonconsecutive His sequences will also bind to the affinity beads, resulting in excessive background for MS approaches. A doubletagging strategy was deployed more successfully for another ubiquitin-like molecule with His-HA-SUMO1,4 but the background proteins present in the controls for this knock-in mice were not reported. Also, a HA-Ub transgenic mouse has been © 2014 American Chemical Society

Received: February 26, 2014 Published: April 15, 2014 3016

dx.doi.org/10.1021/pr5001913 | J. Proteome Res. 2014, 13, 3016−3026

Journal of Proteome Research

Article

(mono or poly) formed in vivo. The over-reliance on one single method could also result in a significant presence of false positives,13 with 65% or more of the isolated peptides showing no diGly signatures on them10,11 despite the antibodies specifically enriching for this motif. Additionally, anti-diglycine antibodies display substrate specificity, introducing potential bias.10 One last caveat is that diGly antibodies cannot identify proteins ubiquitinated at other residues (like cysteines) in place of the canonical lysine.14−16 The lack of a mammalian system for both in vivo identification and validation of ubiquitination targets, has meant that many candidate ubiquitin substrates reported during the past decade were validated only in vitro,17−19 while later in vivo studies contradicted their conclusions.20 We previously demonstrated the reliability of tagging ubiquitin with a 15 amino acid long biotin-accepting peptide21 for the isolation of ubiquitinated proteins from tissues of Drosophila melanogaster.22 The high affinity between biotin and neutravidin allows the removal of interacting partners of ubiquitinated proteins, which could predominate if milder washing conditions were used,23,24 and favors the isolation of ubiquitinconjugated proteins only. With the aim to understand better the many roles of the ubiquitin proteasome system in vertebrate models of disease, we have now generated a bioUb (biotinylated ubiquitin) transgenic mouse. This is the first mammalian system for ubiquitin proteomics allowing direct validation of the MSidentified proteins by immunoblotting. Having confirmed that the ectopic ubiquitin is efficiently biotinylated within several mouse tissues such as liver, heart, brain, kidney, muscle, and pancreas, we used MS to perform a ubiquitin proteomic analysis in adult liver, a tissue already reported to contain a high amount of ubiquitinated proteins.10 Here we have determined the ubiquitin landscape under physiological conditions using a system that allows additional validation on the same sample and which provides details not available by other existing technologies.

■

EXPERIMENTAL PROCEDURES

Generation of the Transgenic

bio

Figure 1. In vivo biotinylation of ubiquitin conjugates in mouse liver. Schematic illustration of the transgenic constructs for both bioUb (A) and BirA (B) mice. Both transgenes contain the CAG promotor (CMV, ß actin, and globin), the open reading frame, and the SV40 polyadenylation signal. Restriction sites used for construct insertion and transgene excision and the PCR primers used for genotyping are indicated. The control BirA mouse expresses the bacterial BirA enzyme only, while the bioUb mice express a single polypeptide encoding three tagged ubiquitin chains fused to BirA. (C) This precursor is fully digested by endogenous deubiquitinating enzymes (DUBs) as confirmed by a Western to BirA on liver samples from wild type (WT), control (BirA), and bioUb mice. In the bioUb mice the BirA enzyme mediates the biotinylation of ubiquitin with the biotinaccepting tag (A), the sequence of which is shown underlined and with the biotin-accepting lysine in bold. A flexible linker incorporated into the tag is indicated with italics. (D) Biotinylated ubiquitin is then incorporated into conjugates, revealing a typical ubiquitin smear if monitored using an antibiotin antibody.

Ub and BirA Mice bio

BirA was amplified from E. coli cultures, and the ( Ub)3-BirA construct was prepared as previously described.22 Both were subcloned into pCAG564 vector (which includes the CAG promoter, composed of the CMV immediate enhancer, β-actin and β-globin promoter sequences) between EcoRI and ClaI sites using the oligos BirAf (GACGAATTCACCATGAAGGATAACACCGTGC), BirAr (GCCATCGATCTATTATTTTTCTGCACTACG), bioUbf (CGTTAACAGATCTGCTCTTCACCATGGGTTTGAATGAC), and bioUbr (GTCATTCAAACCCATGGTGAAGAGCAGATCTGTTAACG). (C57Bl6xCBA)F1 x(C57Bl6xCBA)F1 pronuclear zygotes were injected with ∼2 ng/μL of each purified plasmid by Qiagen PCR column. Positive founders of each line were identified by PCR using the previous primers. All animal experimentation was done under Scientific Procedures Act 1986 regulations, with Home Office and University of Cambridge Ethical Review process approval.

were sacrificed by CO2 inhalation, after which tissues were removed, directly frozen in liquid-nitrogen, and stocked at −80 °C until use. Animal procedures were approved by the CIC bioGUNE ethical committee, in accordance with the guidelines of European Research Council for animal care and use.

Tissue Collection

Three month old males of bioUb and BirA mice were obtained from the animal unit of CIC bioGUNE, which is an AAALACaccredited facility (Association for Assessment and Accreditation of Laboratory Animal Care). Mice were housed at 22 °C with a 12 h light−dark cycle and allowed food (Teklad Global 18% Protein Rodent Diet 2018S) and water ad libitum. Animals

Extract Preparation and Pulldowns

For each of the biological replicates, ∼300 mg of liver expressing the (bioUb)3-BirA construct (or just BirA) was 3017



Article

Figure 2. Expression and conjugation of bioUb in adult (A) and embryonic (B) bioUb mice as determined by Western blotting to biotin. Free bioUb can be detected around 10 kDa in some of the samples but not all. Incorporation of bioUb into conjugates can be seen in heart, muscle, pancreas, liver, and brain. In the BirA control samples only endogenous biotin-carrier proteins are detected, which show different patterns in different tissues. (C) No differences were detected between the liver tissues of BirA and bioUb samples using different histological stainings. Hematoxylin and eosin (H&E) was used to monitor morphological changes. Sirius Red was used for observation of collagen fibers. Liver tissue was stained with F4/80 antibody, a marker for mature mouse macrophages. Sudan III Red was used to detect triglycerides, lipids, and lipoproteins. Antiubiquitin antibody revealed very similar intensities in both the control BirA and the bioUb liver.

homogenized under denaturing conditions by mixing it with 2.5 mL of lysis buffer. After clarification, the supernatant was applied to a binding buffer-equilibrated PD10 column (GE Healthcare), and the eluate (3.5 mL) was collected (total extract contained typically 52−56 mg protein) into 250 μL of 25× protease inhibitor mixture from Roche Applied Science and incubated with 250 μL of NeutrAvidin-agarose beads (ThermoScientific) suspension (125 μL beads) for 40 min at room temperature and a further 2 h and 20 min at 4 °C. The amount of unbound biotinylated material was typically 5−10%. The beads were then washed in 10−15 mL of Washing Buffers WB1 (twice), WB2 (thrice), WB3 (once), WB4 (thrice), WB1 (once), WB5 (once), and 3× WB6 (thrice). Beads were then transferred to a 1.5 mL tube, mixed with 100 μL of elution buffer, and placed for 5 min on a hot plate at 95 °C. The eluted sample was separated from the beads using a Vivaclear Mini 0.8 μm PES microcentrifuge filter unit. The recovered volume for each sample was ∼130 μL. The isolated biotinylated proteins that eluted from the beads after boiling gave a typical recovery yield of 20−40%. Buffer compositions are listed as follows: Lysis buffer contained 8 M urea, 1% SDS, and 50 mM N-ethylmaleimide in PBS, including a protease inhibitor mixture (Roche Applied Science); binding buffer contained 3 M urea, 1 M NaCl, 0.25% SDS, and 50 mM N-ethylmaleimide in PBS; WB1 contained 8 M urea and 0.25% SDS in PBS; WB2 contained 6 M guanidine HCl in PBS; WB3 contained 6.4 M urea, 1 M NaCl, and 0.2% SDS in PBS; WB4 contained 4 M urea, 1 M NaCl, 10% isopropanol, 10% ethanol, and 0.2% SDS

in PBS; WB5 contained 8 M urea and 1% SDS in PBS; WB6 contained 2% SDS in PBS; and elution buffer contained 4× Laemmli buffer and 100 mM DTT. For the DTT elution experiments, the beads were prewashed with binding buffer containing 25 mM DTT, and elution was performed by incubating beads during 30 min at room temperature with 90 μL of WB6 supplemented with 25 mM DTT. The recovered volume of the eluted sample, separated from the beads as in the standard elution, was 110 μL. Western Blotting and Silver Staining

We used HRP-linked antibiotin antibody from Cell Signaling Technology at 1:100, rabbit polyclonal anti-Ub from Sigma at 1:50, mouse FK1 antipoly-Ub from EnzoLifeSciences at 1:1000, chicken polyclonal anti-BirA from Sigma at 1:2000, rabbit polyclonal anti-UBE1 from Abcam at 1:100, rabbit polyclonal anti-CDC34 from Boston Biochem at 1:100, rabbit polyclonal anti-UBE2H from Boston Biochem at 1:100, rabbit polyclonal anti-UBE2K and -UBE2G1 from Boston Biochem at 1:200, mouse polyclonal anti-UBE2G2 from Boston Biochem at 1:300, rabbit polyclonal anti-Spartin from Evan Reid at 1:200, mouse monoclonal anti-PSMC5 from Euromedex at 1:500, mouse polyclonal anti-ATP1A1 from DSHB at 1:100, mouse monoclonal anti-HSC70 from Sigma at 1:100, rabbit monoclonal anti-EGFR from Cell Signaling at 1:500, goat polyclonal anti-HSP70 from Santa Cruz Biotechnology at 1:200, rabbit polyclonal anti-HSP90 from Cell Signaling at 1:200, rabbit polyclonal anti-MATI/III and -MATII from Santa Cruz 3018



Article

Figure 3. Isolation of ubiquitin conjugates from mouse liver. Following a single-step enrichment strategy (A), silver staining (B) reveals a massive enrichment of ubiquitinated material on the bioUb samples, while the control BirA samples are only enriched for known endogenous biotinylated proteins as well as neutravidin molecules breaking from the agarose beads. Four independent pulldowns from each BirA and bioUb samples, which were later used for MS and Western Blotting validation, are shown. (C) Immunoblotting to ubiquitin reveals no significant difference on global ubiquitin levels between the two input samples and confirms that the isolated proteins are indeed ubiquitin conjugates, including chains as recognized by FK1 antibody (D) to polyubiquitin.

system (DAKO, K4003 anti-Rabbit Envision system). Staining was achieved by incubation with purple Vector Vip substrate (Vector SK4600). Serum activity of aspartate aminotransferase (AST) and alanine aminotransferase (ALT) and concentration of glucose, total cholesterol, and total proteins were determined using a Selectra Junior Spinlab 100 analyzer (Vital Scientific, Dieren, Netherlands; Spinreact, Girona, Spain), according to the protocol provided by the apparatus manufacturers. Standard controls (Spinreact, Girona, Spain) were run before each determination, and the values obtained for the different biochemical parameters were always within the expected ranges provided by the manufacturer.

Biotechnology at 1:500, and rabbit monoclonal anti-GNMT from Santa Cruz Biotechnology at 1:1000. HRP-conjugated secondary antibodies from Jackson ImmunoResearch Laboratories were used at dilutions between 1:2000 and 1:5000. Depending on the antibody, we loaded between 0.003 and 0.3% of the input samples and 5−10% of the elution samples and generally used 4−12% gradient gels (Invitrogen). Transfers were performed using the iBlot system (Invitrogen) with PVDF membranes. Silver staining was performed with a SilverQuest kit (Invitrogen) following the manufacturer’s instructions. Quantification of the fraction of a protein is ubiquitinated was performed by comparing the amount of sample loaded in both input and elution samples required to result in similar band intensities in Western blotting experiments.

Mass Spectrometry

Histological, Immunohistochemical, and Metabolic Profile Analysis

Pull-down experiments were performed from three independent biological replicates, and eluted proteins were run on a SDS-PAGE for ∼4 mm into the separating gel. The gel containing the separated proteins was cut in two slices, separating the avidin band from the rest of the proteins. The proteins were converted to peptides using an in-gel digestion protocol.27 The extracted peptides were separated on a 15 cm reverse-phase column (packed in house, with 3 μm Reprosil beads, Dr. Maisch) using a 5 to 50% acetonitrile gradient (Proxeon nano nLC). The peptides were ionized on a proxeon ion source and sprayed directly into the mass spectometer (Q-Exactive or Velos-Orbitrap, Thermo Scientific). The recorded spectra were analyzed using the MaxQuant software package (version 1.3.0.5) with top 10 MS/MS peaks per 100 Da and a 1% FDR for both peptides and proteins.28 Searches were performed

Sections from formalin-fixed liver tissue from one littermate for each of the transgenic lines were stained with Hematoxylin and eosin (H&E), Sirius red for collagen visualization, and F4/80 for macrophages detection.25 For Sudan red staining, frozen liver tissue sections were used. Immunohistochemistry was carried out as previously described26 on 5 μm sections of formalinfixed, paraffin-embedded livers. Following deparaffinization and rehydration, antigen retrieval was performed at 97 °C for 20 min with Tris-EDTA buffer, pH 9.0 in a PT link module (Dako). Endogenous peroxidase was blocked with 3% peroxide for 10 min. Antiubiquitin primary antibody (Sigma, U5379) was applied at 1:200 dilution for 1 h at room temperature. Primary antibody detection was carried out using a polymer 3019



Article

Figure 4. Identification and bioinformatic analysis of ubiquitin conjugates from mouse liver. (A) A total of 393 nonbackground proteins were identified from the bioUb liver, 20 of which are known ubiquitin-carrying enzymes. Only 38 background proteins were identified in the control samples, most of them appeared in the experimental samples. (B) All possible ubiquitin chain linkages were observed. Raw intensities from two independent sets of experiments were averaged to calculate the apparent fraction of each linkage. (C) Pie charts represent the liver ubiquitome GO term distribution for subcellular localization, molecular function, and biological process. GO terms with appearance below 5% were included within “Others”. (D) Identified proteins known to be involved in a range of liver-related diseases (liver choleostasis, steatosis, hyperplasia, necrosis, cirrhosis, inflammation and hepatitis, as well as hepatocellular carcinoma) and with an MS identification PEP Score lower than 10−10 were analyzed further to define the main biological processes and molecular functions in which they are involved.

Bioinformatic Analysis

using the Andromeda search engine against an IPI mouse database (version 3.84 consisting of 60 012 proteins in addition to 248 common contaminants). Cysteine carbamidomethylation was selected as a fixed modification, and methionine oxidation and protein N-terminal acetylation were variable modifications. Two missed trypsin (full specificity) cleavages were allowed. Mass tolerance of precursor ions was set to 6 ppm and for fragment ions to 20 ppm. The identified ubiquitylation sites were checked using in-house programmed software tools.

The proteins identified by MS were analyzed for functional interpretation with g:Cocoa, a tool integrated in the g:Profiler web server to perform comparative analysis of multiple gene lists.29 Proteins known to be involved in liver-related diseases (liver choleostasis, steatosis, hyperplasia, necrosis, cirrhosis, inflammation, and hepatitis as well as hepatocellular carcinoma) with an MS identification PEP score lower than 10−10 were analyzed independently to define the main Biological Processes 3020


Journal of Proteome Research Table 1. Ubiquitin Carriers Isolated in the

Article bio

Ub Pulldowns standard elution

IPI reference IPI00123313 IPI00226815 IPI00850217 IPI00420771 IPI00128760 IPI00322440 IPI00310850 IPI00311591 IPI00133595 IPI00130521 IPI00153094 IPI00125481 IPI00125135 IPI00229310 IPI00874750 IPI00321895 IPI00875550 IPI01008188 IPI00453903 IPI00130236 IPI00123354 IPI00169767 IPI00762434 IPI00462445 IPI00154004 a

enzyme UBA1 UBA6 UBE2N UBE2R2 UBE2l3 UBE2K UBE2G1 UBE2Z UBE2B UBE2A UBE2G2 UBE2H UBE2D2 UBE2R1/CDC34 UBE2L6 UBE2J1 UBE2O UBE3A HERC4 ARI KPC2 UHRF2 HECTD1 NEDD4 OTUB1

mass (kDa)

DTT elution

TPa

intensityb

19

1.3 × 10

118 118 23 27 18 22 20 38 17 17 33 21 17 27 18 35 141 103 118 64 46 90 290 103 31

9

8 4 7 7 4 5 1 1 1 2 1 2

7.7 4.1 3.2 2.6 1.6 1.5 5.3 3.8 3.4 1.1 7.7 3.9

× × × × × × × × × × × ×

108 108 108 108 108 108 107 107 107 107 106 106

11 2 1 1 1 1

5.0 1.3 7.8 4.1 3.4 8.0

× × × × × ×

108 107 106 106 106 105

TPa

intensityb

type of enzyme

25 2 6 7 6 6 6 6 2 2 2 1 1 5 1 2 4 24 2

× × × × × × × × × × × × × × × × × × ×

E1 E1 E2 E2 E2 E2 E2 E2 E2 E2 E2 E2 E2 E2 E2 E2 E2 E3 E3 E3 E3 E3 E3 E3 DUB

6 3

1.7 1.0 1.3 3.9 1.2 6.4 6.2 3.6 1.3 3.5 2.5 1.8 8.3 5.1 6.4 1.1 2.2 1.1 7.3

9

10 107 109 108 109 108 108 108 108 107 108 107 107 108 106 107 107 109 106

3.4 × 107 3.6 × 107

Total peptides. bIntensities are averaged over three independent runs for each the standard and the DTT-based elution.

morphology and function. Specific stainings for collagen and glycogen deposits as well as assays for inflammation and hepatic activity assays were performed in hemizygous mice (Figure 2C and Supplementary Table 1 in the Supporting Information). Hematoxylin and eosin (H&E) staining revealed that the hepatic tissue from bioUb mice showed normal histological features, and no detectable changes were observed in the bioUb mice versus BirA control animals using Sirius Red, Sudan Red, and F4/80 stainings (Figure 2C). Levels of total ubiquitin were also unaltered. Ectopically expressed bioUb must account for a minor fraction of total ubiquitin, as a quantification of ubiquitin immunohistochemistry gave indistinguisible values for both BirA and bioUb samples (9.5 ± 2.0 and 8.9 ± 2.3, respectively), in agreement with immunoblotting observations (Figure 3). Finally, ALT and AST levels were similar in bioUb and BirA mice as well as glucose, cholesterol, and total proteins (Supplementary Table 1 in the Supporting Information). Importantly, these standard assays of liver morphology and function confirmed that the ectopic expression of the bioUb precursor does not cause any detectable liver phenotype, which is essential for studying the ubiquitome under both physiological as well as pathological conditions. Biotinylated ubiquitin conjugates from the liver of hemizygous bioUb mice were isolated using a single-step protocol after lysis in highly denaturing buffer (Figure 3A). This lysis procedure prevents deubiquitination as well as any other protease activity. Stringent washes containing denaturants, detergents, and salts were possible due to the high affinity between biotinylated ubiquitin and the neutravidin beads. A highly significant enrichment of ubiquitinated material resulted from this strategy. According to the silver stain (Figure 3B), the main contaminants observed in the control preparation are four

and Molecular Functions in which they are involved, as displayed in Figure 3C. A global analysis of significantly enriched Biological Processes and Molecular Functions (with a p value lower than 10−2) that are overrepresented in the 393 identified ubiquitinated liver proteins is displayed in Supplementary Tables 4 and 5 in the Supporting Information.

■

RESULTS AND DISCUSSION

bio

Ub Strategy for Ubiquitin Proteomics in Mice

We cloned both the bioUb and BirA constructs (Figure 1A,B) into a vector with the CAG promoter30,31 and generated transgenic mice lines by pronuclear injection. This driver for nearubiquitous expression of the transgene can give higher levels of expression than the CMV and β-actin promoters alone.32,33 Control mice express just the BirA enzyme, while the bioUb mice express a precursor containing three ubiquitin chains tagged with the biotin-accepting peptide and the E. coli biotinylating enzyme, BirA, all from a single reading frame. In the bioUb mice, the polyubiquitin-BirA precursor is recognized and digested by endogenous DUB enzymes, as confirmed by immunoblotting for BirA (Figure 1C). Biotinylation and incorporation of ubiquitin into conjugates was confirmed by immunoblotting for biotin (Figure 1D), which displayed at high molecular weights the trademark smear of ubiquitin conjugates. Efficient biotinylation of ubiquitin was observed within several tissues (including brain, liver, heart, muscle, and pancreas) in both embryonic and adult mice (Figure 2A,B), while reduced amounts were detected in testis, prostate, spinal cord, adrenal gland, and spleen (data not shown). Although both heterozygous and homozygous bioUb mice appear normal and fertile, we made a closer examination of liver 3021



Article

Figure 5. Validation of identified proteins was performed by Western blotting, both for ubiquitin-carrying enzymes (A), including the E1 UBA1 and five E2 enzymes, and ten ubiquitinated substrates (B), half of which are conjugated with several ubiquitin chains (e.g., Spartin, PSMC5, GNMT, MATI/III, and MATII) while the other half are monoubiquitinated (HSC70, HSP70, HSP90, EGFR, and ATP1A1). Additional bands corresponding to lysine-ubiquitinated E2 enzymes are indicated with arrows. Nonspecific bands also detected in the BirA control sample are indicated with asterisks.

least one of the BirA control samples were assigned as experimental background, except for 10 proteins whose bioUb/ BirA intensity ratio was >10 and which were assigned as being ubiquitinated. By combining the three biological bioUb replicas, MS revealed the presence of a total of 393 ubiquitin-conjugated mouse liver proteins (Figure 4A and Supplementary Table 2 in the Supporting Information), including ubiquitin itself and 19 further proteins known to be ubiquitin carrier E1, E2, and E3 enzymes (Table 1). Ubiquitin-carrying enzymes, such as ubiquitin-activating UBA1, -conjugating E2 enzymes, or the HECT-type ligating E3 enzymes are known to be loaded with ubiquitin through a thioester bond at their active site cysteine. Only 38 mouse liver proteins appeared in the BirA control samples (Supplementary Table 3 in the Supporting Information), a mere 1/10 of total identifications, as expected from the highly stringent washes allowed by the biotin−avidin interaction. Despite identifying several hundred ubiquitin-conjugated proteins, MS experiments revealed just 40 ubiquitination sites on the bioUb samples (Supplementary Table 4 in the Supporting Information). In terms of ubiquitin chain linkage statistics, the most abundant ubiquitin chain topology observed was K48, in agreement with observations in a number of other systems,35

carboxylases present in most organisms and long known to be biotinylated proteins34 as well as neutravidin derived from the resin. Immunoblotting for ubiquitin confirmed the presence of free bioUb at ∼10 kDa, slightly larger than endogenous 8 kDa ubiquitin (Figure 3C), while polyubiquitin-specific FK1 antibody confirmed the presence of chains in the purified material (Figure 3D). Liver Ubiquitome: MS-Based Identification and Orthogonal Validation by Immunoblotting

Liver tissue was extracted from 3 month old mice for both BirA and bioUb, and extracts were prepared under denaturing conditions. Using neutravidin beads to capture the biotinylated material, we performed for both bioUb and BirA three biologically independent pulldowns (using three different animals) for MS analysis, while a fourth pulldown was performed for immunoblotting validation. All four pulldowns showed identical profiles by silver staining (Figure 3B) and Western blotting to biotin (not shown). After LC−MS/MS analysis of purified material on an LTQ-Orbitrap mass spectrometer, output from bio Ub and BirA samples was searched against the IPI mouse database for peptides with up to three missed cleavages and modifications including ubiquitination. Proteins identified in at 3022



Article

followed by K63, K11, K27, and K29, while K33 and K6 chains were barely detected (Figure 4B). The liver ubiquitome identified in this report (393 proteins) was analyzed using g:Profiler29 (Figure 4C). Further details of the enriched GO terms can be found in Supplementary Tables 5 and 6 in the Supporting Information. We next examined the biological processes and molecular functions of 45 liver disease-related proteins with PEP scores smaller than 10−10 (Figure 4D). PEP scores illustrate the probability that identification is a chance event, with those identifications with low values being unequivocal. Our analysis indicated that ubiquitinated proteins known to have a role in liver disease are mostly involved in metabolic processes, particularly lipid metabolism and redox processes, also resulting in an overlap with both oxidoreductase and transferase activities. One major advantage in using our bioUb mouse compared with diGly antibody-based approaches is the compatibility of the isolated ubiquitinated material with both MS analysis and immunoblotting for validation of the ubiquitination status of those proteins. Having specifically enriched for the ubiquitinated fraction of each protein, a simple immunoblot on the isolated material can reveal both the enzymes of the ubiquitin system present in the sample (Figure 5A) and its substrates (Figure 5B). Those validations allowed us to discern the type of ubiquitination, that is, whether the identified substrates are mono- or polyubiquitinated, by looking at the molecular shift gained upon ubiquitin conjugation. Ten out of ten proteins monitored by immunoblotting were validated to be ubiquitinated, half of them being monoubiquitinated, while the other half showed different multi/polyubiquitinated patterns. Using those blots, we estimated the average molecular fraction that is ubiquitinated to be ≤1%, in agreement with the lack of visibility of ubiquitinated bands in the total extract sample. Therefore, although fewer ubiquitination sites are identified by our approach compared with diGly proteomics, due to not enriching for the modified peptides, other relevant information is retrieved, and we believe both approaches will become highly complementary in the future. Liver pathophysiology has been related to a misregulation in the ubiquitination machinery,36,37 so after unraveling the liver ubiquitome map, the bioUb mice open up a promising new field, providing multiple strategies to understand the behavior of this post-translational modification in different pathological situations like cirrhosis and hepatocellular carcinoma, where ubiquitination plays an essential role.38 Interestingly, we show that the key enzymes of the methionine cycle are ubiquitinated in vivo. It is known that MATI/III and GNMT expression levels are modulated during liver injury,25,39 so we predict that ubiquitination may underly these changes. Additionally, we have been able to detect ubiquitination of a number of known ubiquitinated events that can be linked to physiologically important biological processes as EGFR, PCNA, HNRNKP, and MAVS ubiquitination,40−43 among others.

Figure 6. Isolation of thioester-linked ubiquitin conjugates from mouse liver. (A) Several DTT concentrations were tested to optimize the DTT elution protocol. On the basis of the high yield detected with the antibody to the E2 enzyme CDC34 and the low background reported by antibiotin and silver staining, the protocol was established for elution with 25 mM DTT at room temperature. (B) Validation of cysteine-ubiquitination for PEX5 was obtained by comparing its molecular shift in the input and standard elution samples. A minor fraction of PEX5 also appears to be lysine-ubiquitinated (minor band indicated with arrow), which is resistant to the DTT present in the loading buffer.

Thioester Conjugated Ubiquitination Can Also Be Identified Using the bioUb Mice

because DTT treatment causes the thioester-linked ubiquitin to be removed. In addition to the predominant nonshifted band observed for the E2 ubiquitin-conjugating enzymes on the immunoblots, we could also detect in the elution a weaker band corresponding to the addition of one ubiquitin chain on enzymes CDC34 and UBE2H. In those cases, we interpret that the E2 enzymes are also lysine-ubiquitinated because DTT is not capable of breaking this isopeptide linkage. Similar observations have been reported in previous studies.22,44

As expected for ubiquitin-loaded ubiquitin carriers, we validated by immunoblotting that the ubiquitin-activating E1 enzyme UBA1 as well as the ubiquitin-conjugating E2 enzymes CDC34, UBE2H, UBE2G1, UBE2K, and UBE2G2 were isolated in our bio Ub pulldown after being captured via a thioester-bonded ubiquitin. The molecular size at which those enzymes migrate in the gel is identical in both eluted and input samples (Figure 5A), 3023



Article

Table 2. Candidate Cysteine-Ubiquitinated Proteins Identified Using the DTT-Based

bio

Ub Pulldown DTT elutiona

standard elution b

IPI reference

protein

mass (kDa)

TP

IPI00130081 IPI00381178 IPI00121788 IPI00553576 IPI00323908 IPI00230319 IPI00346073 IPI00405227 IPI00874741 IPI00555069 IPI00857226 IPI00130985 IPI00555036 IPI00553419 IPI00330094 IPI00918617 IPI00228630 IPI00404551 IPI00117910 IPI00759878 IPI00828796 IPI00987205 IPI00309035 IPI00468691

PEX5 ES31 PRDX1 ABCD3 CYP2D SLCO1B2 HCP70.1 VCL H2-K PGK1 ACSL1 CRAD2 ASGR1 DSP CPT1 Gm16253 FBP CTSD PRDX2 C3 IDE RPN2 RPN1 ABCG2

67 63 22 75 57 79 70 117 41 45 78 36 33 333 88 6.5 37 48 22 186 118 39 69 73

15 1 2 1 6 4 5 4 3 3 2 1 1 2 2 1 1

c

intensity

n

× × × × × × × × × × × × × × × × ×

3 3 2 2 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2

1.9 3.7 5.4 1.3 6.6 3.9 1.8 5.9 4.9 4.4 3.8 2.1 2.0 1.7 1.6 1.5 6.4

109 106 107 106 108 108 108 107 107 107 107 107 107 107 107 107 105

TPb 28 2 2 1 5 3 4 2 2 1 1 1 1 4 2 1 1 1 1 5 3 3 3 2

intensityd 4.1 2.0 5.2 5.4 2.0 8.2 8.4 1.9 2.5 1.6 1.9 3.4 1.9 1.3 3.2 2.4 1.2 1.0 9.0 3.4 1.9 1.7 1.4 6.9

× × × × × × × × × × × × × × × × × × × × × × × ×

109 107 107 106 108 107 107 107 107 107 107 106 107 107 107 108 106 108 107 107 107 107 107 106

a

Proteins isolated in the DTT elution with intensities whose magnitudes were significantly smaller than in the standard elution are excluded from this table but are given in Supplementary Table 7 in the Supporting Information. Proteins isolated in the DTT elution but not found in the standard elution (performed by triplicate) were considered only if they were identified in at least two separate experiments. bTotal peptides. cNumber of independent identifications, out of three data sets. dIntensities are averaged over n runs for the DTT elution.

homologue of this peroxisomal import protein, Pex5p, had already been reported to be ubiquitinated at a conserved cysteine side chain after several failed attempts by mutagenesis to identify its ubiquitinated lysine.14 Cysteine-ubiquitination of Pex5p is necessary for its recycling in and out of peroxisomes,45 which is in turn required for its functional role in peroxisomal protein transport. A minor fraction of PEX5 also appears to be ubiquitinated with a canonical isopeptide bond, as a minor band is detected in the standard elution that is resistant to DTT (Figure 6B, arrow). Our novel proteomic approach identified several more peroxisome-associated proteins as candidates to be cysteineubiquitinated (Table 2), including the peroxisomal transporters ABCD3 and ABCG2, the peroxiredoxins PRDX1 and PRDX2, as well as IDE and ACSL1. We also noticed a highly significant enrichment of proteins involved on fatty acid transport and oxidation of lipids in this list (p values of 2 × 10−8 and 2 × 10−10, respectively, compared with 10−4 and 4 × 10−4 in the total list of ubiquitinated proteins). Several identifications in the DTT elution had not been detected in the standard elution, for example, the ABCG2 transporter, the receptor binding C3, or the ribophorins RPN1 and RPN2 (Table 2), but were also included as candidates for being ubiquitinated at cysteine residues because they appeared in at least two separate data sets. The detection of those proteins could have been prevented in the standard elution by other more abundant peptides of similar MS properties. In summary, we identified likely cysteine ubiquitination of several organelle membrane-based small molecule transporters, with a highly significant enrichment of proteins involved on

To further confirm that the ubiquitin-carrying enzymes were loaded with ubiquitin on their way to a target protein, we developed a new protocol for isolating thioester-linked proteins, with the elution being achieved by simply incubating the beads with DTT at room temperature (Figure 6A). Using this method, MS identification of the same E2 enzymes detected in the normal elution confirmed our hypothesis that E2 enzymes are indeed being isolated because of their active status in the liver. Six further enzymes were also identified (Table 1). MSdetermined intensities for the ubiquitin-carrying enzymes were of the same order in the DTT elution experiments as those seen in MS runs using samples from the standard elution, in which the ubiquitinated material had been eluted by boiling the beads. This suggests that a similar amount of material was eluted by both approaches. Strikingly, not only carrier enzymes of the ubiquitin system were identified upon DTT elution (also performed in triplicate; Supplementary Table 7 in the Supporting Information). A number of proteins not related to the ubiquitin system appeared in the DTT elution with intensities of similar range to the standard elution (Table 2), suggesting that those proteins are eluted as efficiently by DTT incubation as they were by boiling the beads. Ubiquitin carrier enzymes are loaded with ubiquitin on cysteines within their active sites, so this would be expected if the identified noncarrier proteins were ubiquitinated at cysteine residues too. Immunoblotting to PEX5, one of those candidate cysteine-ubiquitinated proteins, revealed an identical molecular weight in both the standard elution and the input samples (Figure 6B), as expected for a protein conjugated to ubiquitin through a thioester bond on a cysteine. Interestingly, the yeast 3024



Article

fatty acid transport and oxidation (Table 2). The implications of those findings will need to be addressed in the future. It can be expected that ubiquitination at cysteine residues might have a distinct biological role or at least be regulated differently, as compared with canonical lysine-based ubiquitination. For example, deubiquitination could be regulated by the chemical redox environment, for example, in an organelle-wide manner, independently of deubiquitinating enzymes. Not many proteins are known to be cysteine-ubiquitinated, and its identification has required exhaustive mutagenesis of all possible lysine residues. With the proteomic approach presented here, the identification as well as validation of candidate cysteine-ubiquitinated proteins will be achieved with much less effort. The identification of proteins that are modified with specific polyubiquitin chains (K11, K63, etc.) on a proteomic scale would open a wide range of opportunities. Using a similar approach to the DTT elution presented here might thus allow for the use of chain-type specific deubiquitinating enzymes to elute such ubiquitinated material, allowing characterization of the various chain-specific ubiquitomes by MS.

Notes

CONCLUSIONS We have developed a transgenic mouse expressing in vivo biotinylated ubiquitin, which offers a unique advantage that identified proteins can be validated directly by immunoblotting using the same material. Because of the strength and specificity of the biotin−avidin interaction, stringent washes ensure that only proteins conjugated directly to ubiquitin are isolated. With this mouse model, we have characterized the ubiquitin landscape of a physiologically healthy liver in vivo. Future experiments will be performed in a variety of different models of liver disease, and the mice will allow analysis of the ubiquitination landscape in other tissues. The bioUb transgenic mouse presented here will allow changes in the ubiquitination profile to be identified under different conditions, such as drug treatments, genetic backgrounds and disease models, stress and environmental stimuli, and aging. It promises to shed light on how different diseases related to protein homeostasis act at the molecular level within the organism. Finally, we envision that similar transgenic mice based on this in vivo biotinylation strategy could be developed for other ubiquitin-like molecules.

■

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We thank Catherine Lindon for sharing unpublished results revealing that the bioUb system can efficiently work in mammalian cell culture, Sylvie Urbe for suggestions to test a DTT elution, the personnel at the Animal House of the CIC bioGUNE for all of their support, Arkaitz Carracedo and Ana M. Aransay for help establishing the qPCR genotyping of mice, Juanma Falcon, Catherine Lindon, Evan Reid, Sylvie Urbe, and The Developmental Studies Hybridoma Bank - DSHB (University of Iowa) for antibodies, Maribel Franco for continuous contributions during the development of the project, and David Gubb for helpful advice and support. We would also like to thank Michael Clague, Catherine Lindon, and Rosa Barrio for critical reading and comments on the manuscript. This work was supported by Educación (2011) and Sanidad (2013) Gobierno Vasco, FIS PI11/01588, and ETORTEK-2011 grants to M.L.M.-C, FIS PI12/00402 and Ramon y Cajal contract to N.B. and an ETORTEK-2010 grant to U.M.

■

■

ABBREVIATIONS: MS, mass spectrometry; BLAST, basic local alignment search tool; diGly, diglycine-lysine; Ub, ubiquitin; bioUb, biotintagged ubiquitin; CMV, cytomegalovirus; CAG, CMV enhancer fused to the chicken beta-actin promoter; HECT, homologous to the E6-AP carboxyl terminus; GO, gene ontology; PEP, posterior error probability; DTT, dithiothreitol; H&E, hematoxylin and eosin; AST, aspartate aminotransferase; ALT, alanine aminotransferase; PBS, phosphate-buffered saline; IPI, international protein index; FDR, false discovery rate

■

(1) Sylvestersen, K. B.; Young, C.; Nielsen, M. L. Advances in characterizing ubiquitylation sites by mass spectrometry. Curr. Opin. Chem. Biol. 2013, 17 (1), 49−58. (2) Peng, J.; Schwartz, D.; Elias, J. E.; Thoreen, C. C.; Cheng, D.; Marsischky, G.; Roelofs, J.; Finley, D.; Gygi, S. P. A proteomics approach to understanding protein ubiquitination. Nat. Biotechnol. 2003, 21 (8), 921−926. (3) Tsirigotis, M.; Thurig, S.; Dubé, M.; Vanderhyden, B. C.; Zhang, M.; Gray, D. A. Analysis of Ubiquitination In Vivo Using a Transgenic Mouse Model. Biotechniques 2001, 31 (1), 120−126. (4) Tirard, M.; Hsiao, H. H.; Nikolov, M.; Urlaub, H.; Melchior, F.; Brose, N. In vivo localization and identification of SUMOylated proteins in the brain of His6-HA-SUMO1 knock-in mice. Proc. Natl. Acad. Sci. U. S. A. 2012, 109 (51), 21122−21127. (5) Ryu, K. Y.; Maehr, R.; Gilchrist, C. A.; Long, M. A.; Bouley, D. M.; Mueller, B.; Ploegh, H. L.; Kopito, R. R. The mouse polyubiquitin gene UbC is essential for fetal liver development, cell-cycle progression and stress tolerance. EMBO J. 2007, 26 (11), 2693−2706. (6) Kim, W.; Bennett, E. J.; Huttlin, E. L.; Guo, A.; Li, J.; Possemato, A.; Sowa, M. E.; Rad, R.; Rush, J.; Comb, M. J.; Harper, J. W.; Gygi, S. P. Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol. Cell 2011, 44 (2), 325−340. (7) Wagner, S. A.; Beli, P.; Weinert, B. T.; Nielsen, M. L.; Cox, J.; Mann, M.; Choudhary, C. A proteome-wide, quantitative survey of in vivo ubiquitylation sites reveals widespread regulatory roles. Mol. Cell Proteomics 2011, 10 (10), M111.013284. (8) Xu, G.; Paige, J. S.; Jaffrey, S. R. Global analysis of lysine ubiquitination by ubiquitin remnant immunoaffinity profiling. Nat. Biotechnol. 2010, 28 (8), 868−873. (9) Sarraf, S. A.; Raman, M.; Guarani-Pereira, V.; Sowa, M. E.; Huttlin, E. L.; Gygi, S. P.; Harper, J. W. Landscape of the PARKIN-dependent

ASSOCIATED CONTENT

* Supporting Information S

Comparison of serum parameters analysis between BirA and bio Ub mice. Listing of all 393 identified proteins as ubiquitinconjugated, including the 20 known ubiquitin carrying enzymes. Listing of the 38 proteins identified in at least one of the birA control samples. Ubiquitin-modified peptides identified in bioUb pulldowns from mouse liver. G:Profiler analysis by Molecular Function of all identified ubiquitinated proteins in liver. G:Profiler analysis by Biological Process of all identified ubiquitinated proteins in liver. MS identification of proteins eluted by DTT. Annotated spectral data for the GG-peptides. This material is available free of charge via the Internet at http://pubs.acs.org.

■

REFERENCES

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Phone: +34 944 061312. Fax: +34 944 061301. 3025



Article

ubiquitylome in response to mitochondrial depolarization. Nature 2013, 496 (7445), 372−376. (10) Wagner, S. A.; Beli, P.; Weinert, B. T.; Schölz, C.; Kelstrup, C. D.; Young, C.; Nielsen, M. L.; Olsen, J. V.; Brakebusch, C.; Choudhary, C. Proteomic analyses reveal divergent ubiquitylation site patterns in murine tissues. Mol. Cell. Proteomics, 2012, 11 (12), 1578−1585. (11) Na, C. H.; Jones, D. R.; Yang, Y.; Wang, X.; Xu, Y.; Peng, J. Synaptic protein ubiquitination in rat brain revealed by antibody-based ubiquitome analysis. J. Proteome Res. 2012, 11 (9), 4722−4732. (12) Leidecker, O.; Matic, I.; Mahata, B.; Pion, E.; Xirodimas, D. P. The ubiquitin E1 enzyme Ube1 mediates NEDD8 activation under diverse stress conditions. Cell Cycle 2012, 11 (6), 1142−1150. (13) Shi, Y.; Xu, P.; Qin, J. Ubiquitinated proteome ready for global? Mol. Cell. Proteomics 2011, 10 (5), R110 006882. (14) Williams, C.; van den Berg, M.; Sprenger, R. R.; Distel, B. A conserved cysteine is essential for Pex4p-dependent ubiquitination of the peroxisomal import receptor Pex5p. J. Biol. Chem. 2007, 282 (31), 22534−22543. (15) Hensel, A.; Beck, S.; El Magraoui, F.; Platta, H. W.; Girzalsky, W.; Erdmann, R. Cysteine-dependent ubiquitination of Pex18p is linked to cargo translocation across the peroxisomal membrane. J. Biol. Chem. 2011, 286 (50), 43495−43505. (16) Wang, X.; Herr, R. A.; Hansen, T. H. Ubiquitination of substrates by esterification. Traffic 2012, 13 (1), 19−24. (17) Greer, P. L.; Hanayama, R.; Bloodgood, B. L.; Mardinly, A. R.; Lipton, D. M.; Flavell, S. W.; Kim, T. K.; Griffith, E. C.; Waldon, Z.; Maehr, R.; Ploegh, H. L.; Chowdhury, S.; Worley, P. F.; Steen, J.; Greenberg, M. E. The Angelman Syndrome protein Ube3A regulates synapse development by ubiquitinating arc. Cell 2010, 140 (5), 704− 716. (18) Margolis, S. S.; Salogiannis, J.; Lipton, D. M.; Mandel-Brehm, C.; Wills, Z. P.; Mardinly, A. R.; Hu, L.; Greer, P. L.; Bikoff, J. B.; Ho, H. Y.; Soskis, M. J.; Sahin, M.; Greenberg, M. E. EphB-mediated degradation of the RhoA GEF Ephexin5 relieves a developmental brake on excitatory synapse formation. Cell 2010, 143 (3), 442−455. (19) Tsai, N. P.; Wilkerson, J. R.; Guo, W.; Maksimova, M. A.; DeMartino, G. N.; Cowan, C. W.; Huber, K. M. Multiple AutismLinked Genes Mediate Synapse Elimination via Proteasomal Degradation of a Synaptic Scaffold PSD-95. Cell 2012, 151 (7), 1581−1594. (20) Kuhnle, S.; Mothes, B.; Matentzoglu, K.; Scheffner, M. Role of the ubiquitin ligase E6AP/UBE3A in controlling levels of the synaptic protein Arc. Proc. Natl. Acad. Sci. U.S.A. 2013, 110 (22), 8888−8893. (21) Beckett, D.; Kovaleva, E.; Schatz, P. J. A minimal peptide substrate in biotin holoenzyme synthetase-catalyzed biotinylation. Protein Sci. 1999, 8 (4), 921−929. (22) Franco, M.; Seyfried, N. T.; Brand, A. H.; Peng, J.; Mayor, U. A novel strategy to isolate ubiquitin conjugates reveals wide role for ubiquitination during neural development. Mol. Cell. Proteomics 2011, 10 (5), M110 00218. (23) Lopitz-Otsoa, F.; Rodriguez-Suarez, E.; Aillet, F.; Casado-Vela, J.; Lang, V.; Matthiesen, R.; Elortza, F.; Rodriguez, M. S. Integrative analysis of the ubiquitin proteome isolated using Tandem Ubiquitin Binding Entities (TUBEs). J. Proteomics, 2012, 75 (10), 2998−23014. (24) Matsumoto, M.; Hatakeyama, S.; Oyamada, K.; Oda, Y.; Nishimura, T.; Nakayama, K. I. Large-scale analysis of the human ubiquitin-related proteome. Proteomics 2005, 5 (16), 4145−4151. (25) Martinez-Chantar, M. L.; Vázquez-Chantada, M.; Ariz, U.; Martínez, N.; Varela, M.; Luka, Z.; Capdevila, A.; Rodríguez, J.; Aransay, A. M.; Matthiesen, R.; Yang, H.; Calvisi, D. F.; Esteller, M.; Fraga, M.; Lu, S. C.; Wagner, C.; Mato, J. M. Loss of the glycine Nmethyltransferase gene leads to steatosis and hepatocellular carcinoma in mice. Hepatology 2008, 47 (4), 1191−1199. (26) Martinez-Lopez, N.; Varela-Rey, M.; Fernández-Ramos, D.; Woodhoo, A.; Vázquez-Chantada, M.; Embade, N.; Espinosa-Hevia, L.; Bustamante, F. J.; Parada, L. A.; Rodriguez, M. S.; Lu, S. C.; Mato, J. M.; Martínez-Chantar, M. L. Activation of LKB1-Akt pathway independent of phosphoinositide 3-kinase plays a critical role in the

proliferation of hepatocellular carcinoma from nonalcoholic steatohepatitis. Hepatology 2010, 52 (5), 1621−1631. (27) Shevchenko, A.; Tomas, H.; Havlis, J.; Olsen, J. V.; Mann, M. In-gel digestion for mass spectrometric characterization of proteins and proteomes. Nat. Protoc. 2006, 1 (6), 2856−2860. (28) Cox, J.; Mann, M. MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat. Biotechnol. 2008, 26 (12), 1367−1372. (29) Reimand, J.; Arak, T.; Vilo, J. g:Profiler–a web server for functional interpretation of gene lists (2011 update). Nucleic Acids Res. 2011, 39 (Web Server issue), W307−W315. (30) Liew, C. G.; Draper, J. S.; Walsh, J.; Moore, H.; Andrews, P. W. Transient and stable transgene expression in human embryonic stem cells. Stem Cells 2007, 25 (6), 1521−1528. (31) Tchorz, J. S.; Suply, T.; Ksiazek, I.; Giachino, C.; Cloëtta, D.; Danzer, C. P.; Doll, T.; Isken, A.; Lemaistre, M.; Taylor, V.; Bettler, B.; Kinzel, B.; Mueller, M. A modified RMCE-compatible Rosa26 locus for the expression of transgenes from exogenous promoters. PLoS One 2012, 7 (1), e30011. (32) Niwa, H.; Yamamura, K.; Miyazaki, J. Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 1991, 108 (2), 193−199. (33) Okabe, M.; Ikawa, M.; Kominami, K.; Nakanishi, T.; Nishimune, Y. ’Green mice’ as a source of ubiquitous green cells. FEBS Lett. 1997, 407 (3), 313−319. (34) Chandler, C. S.; Ballard, F. J. Multiple biotin-containing proteins in 3T3-L1 cells. Biochem. J. 1986, 237 (1), 123−130. (35) Ziv, I.; Matiuhin, Y.; Kirkpatrick, D. S.; Erpapazoglou, Z.; Leon, S.; Pantazopoulou, M.; Kim, W.; Gygi, S. P.; Haguenauer-Tsapis, R.; Reis, N.; Glickman, M. H.; Kleifeld, O. A perturbed ubiquitin landscape distinguishes between ubiquitin in trafficking and in proteolysis. Mol. Cell. Proteomics 2011, 10 (5), M111.009753. (36) Zhong, S.; Xu, J.; Li, P.; Tsukamoto, H. Caveosomal oxidative stress causes Src-p21ras activation and lysine 63 TRAF6 protein polyubiquitination in iron-induced M1 hepatic macrophage activation. J. Biol. Chem. 2012, 287 (38), 32078−32084. (37) Dong, L.; Liu, Y.; Qiu, Y.; Peng, B.; Yin, J.; Liu, W.; He, X. Identification of Pirh2E and Pirh2F, two additional novel isoforms of Pirh2 ubiquitin ligase from human hepatocellular liver carcinoma cell line. Biomed. Mater. Eng. 2012, 22 (1−3), 89−95. (38) Shirahashi, H.; Sakaida, I.; Terai, S.; Hironaka, K.; Kusano, N.; Okita, K. Ubiquitin is a possible new predictive marker for the recurrence of human hepatocellular carcinoma. Liver 2002, 22 (5), 413−418. (39) Mato, J. M.; Martínez-Chantar, M. L.; Lu, S. C. Sadenosylmethionine metabolism and liver disease. Ann. Hepatol. 2013, 12 (2), 183−189. (40) Haglund, K.; Dikic, I. The role of ubiquitylation in receptor endocytosis and endosomal sorting. J. Cell. Sci. 2012, 125 (Pt 2), 265− 275. (41) Fox, J. T.; Lee, K. Y.; Myung, K. Dynamic regulation of PCNA ubiquitylation/deubiquitylation. FEBS Lett. 2011, 585 (18), 2780− 2785. (42) Moumen, A.; Masterson, P.; O’Connor, M. J.; Jackson, S. P. hnRNP K an HDM2 target and transcriptional coactivator of p53 in response to DNA damage. Cell 2005, 123 (6), 1065−1078. (43) Castanier, C.; Zemirli, N.; Portier, A.; Garcin, D.; Bidère, N.; Vazquez, A.; Arnoult, D. MAVS ubiquitination by the E3 ligase TRIM25 and degradation by the proteasome is involved in type I interferon production after activation of the antiviral RIG-I-like receptors. BMC Biol. 2012, 10, 44. (44) David, Y.; Ziv, T.; Admon, A.; Navon, A. The E2 ubiquitinconjugating enzymes direct polyubiquitination to preferred lysines. J. Biol. Chem. 2010, 285 (12), 8595−8604. (45) Okumoto, K.; Misono, S.; Miyata, N.; Matsumoto, Y.; Mukai, S.; Fujiki, Y. Cysteine ubiquitination of PTS1 receptor Pex5p regulates Pex5p recycling. Traffic 2011, 12 (8), 1067−1083.

3026


Ubiquitin Profiling in Liver Using a Transgenic Mouse with Biotinylated

Recommend Documents