Ultra-sensitive fluorescence monitoring and in vivo live imaging of

3 days ago - Circulating tumor cells (CTCs) have considerable clinical significance in cancer progression and prognosis. In this context, CTC-derived ...
0 downloads 0 Views 1MB Size
Download PDF
Subscriber access provided by Kaohsiung Medical University

Article

Ultra-sensitive fluorescence monitoring and in vivo live imaging of circulating tumor cell-derived miRNAs using molecular beacon system Ji Yeon Hwang, Sang Tae Kim, Junyoung Kwon, Jaebeom Lee, Young-Ok Chun, Jin Soo Han, and Ho-Seong Han ACS Sens., Just Accepted Manuscript • DOI: 10.1021/acssensors.8b01095 • Publication Date (Web): 14 Nov 2018 Downloaded from http://pubs.acs.org on November 17, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

Ultra-sensitive fluorescence monitoring and in vivo live imaging of circulating tumor cell-derived miRNAs using molecular beacon system Ji Yeon Hwang 1,2,† Sang Tae Kim3,4, Junyoung Kwon5,†, Jaebeom Lee6,*, Young-Ok Chun 4,7, Jin Soo Han2, HoSeong Han3,* 1Preclinical

Research Center, Biomedical Research Institute, Seoul National University Bundang Hospital,

Gyeonggi-do 13620, Republic of Korea 2The

Institute for the 3Rs, College of Veterinary Medicine, Konkuk University, Seoul 05029, Republic of Korea

3Department

of Surgery, Seoul National University Bundang Hospital, Gyeonggi-do 13620, Republic of Korea

4Biomedical

Research Institute, Seoul National University Bundang Hospital, Gyeonggi-do 13605, Republic of

Korea 5Department

of Cogno-Mechatronics Engineering, Pusan National University, Busan 46240, Republic of Korea

6Department

of Chemistry, Chungnam National University, Daejeon 34134, Republic of Korea

7Department

of Molecular Biology, DanKook University, Gyeonggi-do 16890, Republic of Korea

†Both contribute

equally.

ABSTRACT Circulating tumor cells (CTCs) have considerable clinical significance in cancer progression and prognosis. In this context, CTC-derived microRNAs (miRs) in blood and tissues have been proposed as the novel non-invasive biomarkers for monitoring tumor progression, especially, at the early stages. To monitor circulating miRs, a tool should have high sensitivity, be a simple procedure, and allow detection in very small volumes. Thus, we designed a sensing tool for sensitive monitoring of blood or tissue miRs using a fluorophore-quencher probe-based molecular beacon (MB). This MB-based tool displayed an ultrasensitive limit of detection (LOD) level of 6.7×10– 17

M, 8.7×10–17 for metastasis-derived miR-21a, miR-221, respectively. It also can discriminate miR-21a/221 from

both guide strand miRs and its precursor forms (pre-miR). Furthermore, the tool discriminated between blood or tissue-related miR-21a/221-expression and detected metastasis and epithelial-mesenchymal transition and also describe a noninvasive miR fluorescence imaging of CTCs in a mouse model, showing a potential for clinical diagnosis and prognosis.

ACS Paragon Plus Environment

ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

KEYWORDS: circulating tumor cell, miRNA, molecular beacon, metastasis, epithelial-mesenchymal transition, ultra-sensitive sensing

ACS Paragon Plus Environment

Page 2 of 19

Page 3 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

Cancer is the second most frequent fatal disease worldwide, with high mortality. Therefore, highly active and selective imaging techniques for opportune tumor diagnosis and prognosis have considerable clinical importance. Especially, circulating tumor cells (CTCs), which are spread from a primary tumor, are possible to seed metastatic locations and penetrate vessels, causing tumor metastasis and progression.1-2 Nevertheless, the mechanisms of CTC dissemination and vessel invasion have not yet been fully investigated owing to the absence of proper monitoring tools. CTCs in peripheral blood rarely exists with frequency of no more than 1 CTC/107 blood cells,3 and current blood CTC monitoring technologies are able to target CTCs by surface antigens or their physical size.4 Notwithstanding the possible morphological confirmation of CTCs by those methods, CTCs can exist as heterogeneous phenotypes.5 Once CTCs were separated, their detection is usually validated by immunocytochemistry, immunofluorescence, and fluorescence microscopy analyses.6-8 However, it has been difficult to monitor CTCs with high probability of detection because of its small number, and small amount in specimens. A recent approach for CTC detection involves microRNAs (miRs), and the main technologies for CTC-derived miR detection include northern blotting,9 microarrays,10 next-generation sequencing11 and a quantitative reverse transcription polymerase chain reaction (qRT-PCR).12 miRs have a crucial role in many important biological phenomena, including cell proliferation, differentiation, lipid metabolism, cell death and carcinogenesis.13-14 miRs are 18~24-nt non-coding small RNAs that are cleaved by the RNase III enzyme Drosha, resulting a ~60-80-nt precursor hairpin (pre-miR). miRs down-regulates gene expression in plant and animals by post-transcriptional mechanisms, either blocking mRNA translation or leading to mRNA degradation. To date, hundreds of miRs have been identified, and believed to regulate up to 30%-80% of all human genes.15 Therefore, aberrant miR expression in humans is considered a novel molecular mechanism of carcinogenesis. The underlying causes of alterations in miR expression nevertheless remain unclear. In vivo application of previous technologies based on CTC-specific miRs has been hindered by various factors, such as infrastructure cost, process complexity, and data analysis.16 Besides, most of these approaches possess limitations of low speed and CTC-monitoring yield.17 Nevertheless, it is indispensable to develop an accurate and sensitive detection of miRs as biomarkers to monitor tumor prognosis and metastasis. Recently, in vivo imaging of cancer- and neuron-specific miR biogenesis by optical reporter gene has been described.18 However, such reporter-based miR monitoring uses a signal-off system, in which miRs attach and destabilize their target mRNAs, hampering separation of signal-off data which are resulted by in vivo miR expression or cell death. Thus, it is necessary to develop a signal-on imaging system in order to detect intracellular target signatures such as miRs.19 Recent reports have described the isolation of stable miRs from serum, plasma, blood, cancer stem cells (CSCs) and CTCs.20 Circulating miRs from exosome, blood and CTC have the potentialanalytes to become novel signatures for cancer progression diagnosis and prognosis.21 In addition, up-regulated miR expression can be detected at an early stage in cancer progression.22 Thus, detection of CTC-derived miRs in bloods and other bodily fluids may be a novel tool for early monitoring of pancreatic cancer.23 For this, it is highly desired to design ultrasensitive simple monitoring system for the diagnosis in the clinic of CTC-derived circulating miRs in the very small volume of specimens. Herein, we propose a method that selectively discriminate target miRs or CTCs using miR-21a/221 as a molecular beacon (MB) for both related analogs and pre-miRs with a monitoring sensitivity as

ACS Paragon Plus Environment

ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

low as 0.1 fM. Moreover, the technology can distinguish between CTC and exosome-derived miRs in the bloods and also describe a noninvasive miR-targeted fluorescence imaging of CTCs in a living mouse model. Bioimaging of miR-21/221 reflecting CTC behavior has clinical and industrial significance because extracellular molecules in cancer cells significantly influence on tumor progression. It is probable that our experimental concept and results show that the signal-on MB system possess a substantial potential to be applied in the clinical tumor diagnosis.

EXPERIMENTAL SECTION Materials and Methods. Cy5.5 and quantum dot, i.e., QD525/595 were bought from Thermo Fisher Scientific Inc. (MA, USA). MB oligonucleotides for miR-21a/221 were obtained from Bioneer Inc. (Daejeon, Korea). The Panc02 cells were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). C57BL6 mice were purchased from the Oriental Bio Inc. (Seongnam, Korea). Whole blood samples were collected from Panc02-implanted and control C57BL6 mice in Vacutainer vials with ethylenediaminetetraacetic acid (EDTA) within 2 weeks after zymosan injection and were stored at -80 °C. The fluorescence spectra were analyzed by a Hitachi F-4500 spectrofluorometer (Tokyo, Japan). Gel electrophoresis was performed using a Mylab mini gel kit (Seolin Bioscience, Seoul, Korea) for the miR21a/221 MB probe. miR-21a/221 MB images were taken using an LSM 710 microscope (Carl Zeiss, Weimer, Germany). Preparation of the miR21a/221 Probe. QD565-COOH nanoparticles were purchased from Moelcular probe (ThermoFisher, Waltham, USA). To construct of QD-miR-21/221 MB, 69-NH2-modified molecular beacon, miR-21a

MB

(5’-TTCGCTGTATCGAATAGTCTGATCGAATAG-

TCTGCCTACAACTACAACTGCTTCCTGTCACATACA- GCG-3’) and 75-NH2-miR-221 oligos, (5′TTCGCTGTTCGATGTAACAGATCGATGAACAGACGCCCCAAACCGACCCAAAGGCTTCCTGTCACAGACACAGCG-3′) were synthesized by Bioneer Inc. (Daejeon, Korea). The miR-21 MB and miR-221 MB were formed as a partly double stranded oligonucleotide following previously report.24 The miR sequences were as follows: pre-miR-21a (5′-TGTACCACCTTGTCGGATAGCTTATCAGACTGATGTTGACTGTTGAATCTCATGGCAACAGCAGTCGATGG GCTGTCTGACATTTTGGTATC-3′), mature-miR-21a (5′- TTCGCTGTATCGAATAGTCTGATCGAATAG TCTGCCTACAACTACAACTGCTTCCTGTCACATACAGCG-3′), mature-miR-21a* (5′-TTCGCTGTATC GAATAGTCAACAGCAGTCGATGGGCTGTC-3′), pre-miR-221 (5′- ATCCAGGTCTGGGGATGAACC TGGCATACAATGTTAGATTTCTGTGTTTGTTAGGCAACAGCTACATTGTCTGCTGGGTTTCAGGCTA CCTGGAA-3′), mature-miR-221 (5′-TTCGCTGTTCGATGTAACAGATCGATGAACAGACGCCCCAAAC CGACCCAAAGGCTTCCTGTCACAGACACAGCG-3′), and mature-miR-221* (5′-TTCGCTGTATCGAATA GTACCTGGCATACAATGTAGATTTCTGT-3′). MBs with complementary sequences (miR-21a/21a* and miR-221/221*) were synthesized. The miR-21a-linked MB contains QD525 (excitation/emission wavelength: 460/525nm) and black hole quencher (BHQ) (Table 1). The designed miR-221-linked MB contains QD565 (excitation/emission wavelength: 520/625nm) and BHQ2. The MBs which have complementary sequences to

ACS Paragon Plus Environment

Page 4 of 19

Page 5 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

mature miR-21a or miR-221 were designed and synthesized as shown in Figure 1. Analysis of MB Construction. Electrophoretic gel were loaded to verify the formation of MBs using 1.5% agarose gel in nuclease-free 1x Tris base, acetic acid and EDTA (TAE) buffer. Briefly, 1 pmol of the fluorescence labeled or fluorescence-free miR MBs were analyzed on the gel. The gel separation pattern was assessed by ethidium bromide staining with gel documenter (Gel Doc EZ System, Bio-Rad Inc., Hercules, CA, USA). Analysis of Fluorescence Spectra. 10 μL of blood was mixed with 10 μL of miR-21a/221 MB probe and diluted with distilled water to make a final volume of 80 μL. The excitation wavelength was 595 nm, and the spectra were recorded covering from 525 to 625 nm with a fixed slit size and photomultiplier tube gain. The peak fluorescence emission was set at 595 nm. For blood samples, the background signal was defined as the fluorescence intensity of mixtures obtained in the miR MB probe without labeling of fluorescence. The (F – F0)/F0 value was used to calculate the concentration of miRs based on the obtained regression equation, in which F0 and F correspond to the fluorescence intensity at 595 nm with and without template miRs, tissues, or blood-derived miR with the background subtracted. Confocal Microscopy Analysis. Panc02 cells were cultured for 24 h on 35 mm confocal dishes (SPL Life Sciences Inc., Pocheon, Korea). Cells were treated with 30 μg/mL of zymosan in the presence of blood and miR MB was added just prior to fixation for 2 h. For simultaneous imaging of both miRs, one end of the hairpin loop of the MB containing the miR-21a or miR-221-binding sequence was labeled with QD525 (absorbance/emission wavelength: 460/525 nm) or QD565 (absorbance/emission wavelength: 520/625 nm), respectively. Upon binding of the mature miR-21a or miR-221 to the loop of each MB, a conformational change is expected to occur, resulting in greater separation between fluorophore and quencher and in the activation of a fluorescence signal-on system. Following two washes with phosphate buffered saline (PBS), cells were fixated in 4% p-formaldehyde.. Cell images were taken by LSM710 confocal microscopy (Carl Zeiss, Jena, Germany). Using this method, we could accurately and simultaneously monitor miR-21a and miR-221 levels in the progression of Panc02 cells both in vitro and in vivo. Monitoring of CTC-derived miR21/221 in Mouse Bloods. To check the likelihood of monitoring CTCderived miRs mouse whole blood samples (10 μL for each blood samples), miRs were injected in Panc02implanted or control mice within two weeks after zymosan injection. Signal-on from 1 picomole miR for hybridization monitoring of CTCs in the blood samples was observed at 25 °C. Separated mouse blood was added into 1 picomole miR MB probe for 1 min at 25 °C and with H33342 (Invitrogen, Eugene, OR, USA) for nuclear staining. The cell images were taken by LSM 710 microscope (Carl Zeiss LSM710, Weimer, Germany). Fluorescent Bio-Imaging of CTCs In Vivo. Typical animal experiments were performed as described previously.25 In short, C57BL6 mice were provided from Oriental Bio Inc. (Seongnam, Korea) and allowed to be adapted to the new environments for 7 days in a laboratory. Mice of the control group (n = 10) and the second group (n = 10) were anesthetized at 4 weeks and 2 weeks after Panc02 cell and 3 mg/kg of zymosan injection, respectively. None of them was injected for the mice for the normal group (n = 10, N group). Near-infrared (NIR)

ACS Paragon Plus Environment

ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 19

fluorescence image of the mice was performed using a Night OWL LB 983 system (Berthold Technologies, Bad Wildbad, Germany) for miR-21a/221 monitoring under CTC presence at week 2 post-inoculation. WinLight 32 software (Berthold Technologies, Berthold, ND, USA) was used to calculate the tumor area which was expressed as mm2. RESULTS AND DISCUSSION Concept of the miR MB system. The basic concept for CTC-derived miR monitoring on the basis of MBbased quenching signal on/off system is shown in Figure 1. To synthesize the fluorescent miR-21/221 MB, a partially double-stranded oligonucleotide was prepared using amine moieties attached at the 5’ end of the stem sequence for binding of the fluorophore dye, and the hairpin loop was a set of complementary site for the target miR-21a/221, which was attached at the 3’ end of the stem sequence linked with oligo-miR-21a/221 binding sequence pairs for a signal on/off system. The QD miR-21a/221 MB for in vitro experiments was prepared by designing a single-stranded oligonucleotide by existing an amine moiety, then linking it with beacon sequences. The miR-21a/221 MB was a slightly modified version of previously described molecule.24 The 3′-end with oligomiR21a/221 binding sequences was linked to the BHQ (Bioneer Inc., Daejeon, Korea). miR-21a/221 MB oligonucleotides were obtained from Bioneer Inc. (Daejeon, Korea). The miR-21a/221 MB was prepared as below: 71

nucleotides

of

miR-21a;

amine-

TCGCTGTATCGAATAGTCTGATCGAATAGTCTGCCTACAAACTACAACTGCTTCCTGTCACATACAGCG-BHQ2, 74 nucleotides of miR-221; amine-TTCGCTGTTCGATGTAACAGATCGATGCAACAGACGCCCCAAACCGACCCAAAGGCTTCCTGTCACAGACAGCG-BHQ2. miR-21* oligonucleotide with partly omitted sequences at the 5′-end of the short-sequence and a BHQ at the 3′-end (22nt; amineCAACAGCAGUCGAUGGGCUGUC-BHQ) and miR-221* oligonucleotide with partly eliminated sequences at the 5′-end of the short-sequence and a BHQ at the 3′-end (26nt; amine-ACCUGGCAUACAAUGUAGAUUUCUGU-BHQ). Underlined and bold sequences indicate targets for MB and target miR-21a/221 binding, respectively. For in vivo monitoring, NIR-miR-21a/221 MB probes were conjugated with the cy5.5 NIR probe instead of the QD. The amine-miR-21a/221 MB sequence was generated with a carboxy-terminal-cy5.5 probe at a molar ratio of 2:1 in 0.1M Tris-EDTA buffer with 78 mg/mL 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) at 25 °C. 10 pmol cy5.5-miR-21a or 10 pmol cy5.5 miR-221 MB probe was heated to 94 °C and 72 °C to accelerate the detection of the mature miR-21a/221 molecules in CTCs and to form a secondary structure with high affinity with the mature miR-21a/221 target molecules in the cell. Furthermore, MB signal turns on when target miR is hybridized with the hairpin loop probe, which results in the hairpin loop opening and the complementary part binding. The miR-MB probes only require small amount of single-stranded miRs with different miR analogs, which can be easily quantified with the miR MB probe, allowing the highly selective and sensitive monitoring of miRs. To evaluate the conjugation pattern between the QD and miR-21a/221 MB, gel electrophoresis was carried out in 1.5% agarose gels. A size variation between non-heated and heated miR21a/221 MB probes was observed, thus confirming a successful conjugation (Figure S1). Selectivity of miR monitoring. In the proposed cancer progression imaging using a QD-based miR-21a/221specific MB via a fluorescence switch on/off system, the MB probes and quenchers are closely located in the

ACS Paragon Plus Environment

Page 7 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

absence of miR-21a/221 molecules so that fluorescence would be observed by the quencher. On the contrary, mature miRs can bind with the miR binding sequence located inside the MB when abundant miR-21a/221 exists during CTC occurrence in cancer progression. The complementarity between the mature miR and the miR binding sequence generates a strong hybridization, which results in detachment of the quencher molecule from the MB probe and activation of the fluorescent signal (Figure 1, Figure 2A). According to miRBase version 21, mmu-miR-21a/miR-221 has a high sequence homology to all mouse miRs (Figure 2A). In this study, we used miR-21a/miR-221, miR-21a*/miR-221* and pre-miR-21a/miR-221. To further improve the monitoring specificity, the MB hairpin loop was modified to increase affinity for unstable hybridization between mature miR-21a/miR-221 and the hairpin MB probe. First, the selectivity of this tool was evaluated using the artificial miR-21a, miR-221 and its analogs. Figure 2B presents fluorescence spectra with different kinds of miRs target analogs. Notably, the (F-F0)/F0 values in the signal from miR-21a/221 were approximately 19/25-fold higher than that of template miR-21a/221, and (F-F0)/F0 was 0.5 in the signal from premiR21a/221. Figure 2C shows the suitable template/hairpin ratio miR-21a/221 MB probe as 20/1. Sequencespecificity is critical to miR monitoring because only a few base differences in sequence make entirely different miR. Furthermore, pre-miRs with an entire mature miR sequence may be secreted in exosomal form CTCs. Therefore, the proposed tool would the high selectivity to distinguish miR-21a/221 from both miR* and pre-miR. Sensitivity of miR monitoring. The sensitivity of this miR monitoring technique was determined using various concentrations of miR-21a or miR-221. Figure 2D, and E show the fluorescence spectra of with different concentrations of miR-21a or miR-221. The fluorescence intensity of mature miR-21a (Figure 2D) or miR-221 (Figure 2E) gradually increased, in a concentration-dependent manner from 0.1 fM to 10 pM. In a logarithmic scale, a linear correlation was observed between the (F-F0)/F0 value and the miR-21a or miR-221 in variouse concentrations (0.1 fM - 10 pM). The regression equations for miR-21a and miR-221 are (F-F0)/F0 = 2.335 × log10(C)–3.077 with a R square of 0.9923 and (F-F0)/F0 = 2.135 × log10(C)–2.590 with a R square of 0.9871, respectively, where C means the concentration of miR-21a or miR-221, and F and F0 are the fluorescence intensity with and without miR, respectively. The limit of detection (LOD), where a signal in certain concentration becomes 3.3 times of the standard deviation in the background signal, was estimated to be 6.7×10–17 M, 8.7×10–17 for miR21a, miR-221, respectively. The sensitivity of this technique can be attributed to both the distinctive structure of the hairpin in the MB probe and the extremely high affinity of MB. These results reveal the ultra-high sensitivity of the suggested tool to quantify miR-21a/221 from various concentrations of miR-21a and miR-221 and the miR21a/221 MB probe holds a great promise for rapid, simple cancer cell monitoring in clinical sample with high selectivity. Monitoring of miRs in blood and liver tissues. One of the activities of bioactive zymosan is to induce acute inflammation. Murine pancreatic Panc02 cancer cells was used in vitro to examine the effect of zymosan on CTCs, and then miR expression was analyzed in different cellular conditions. First the expression levels of miR-21a and miR-221 was compared in the presence of CTC in the blood after zymosan treatment. To assay zymosan activity in Panc02 cells with stem-like features, Panc02 cells were grown in the presence of 30 μg/mL zymosan in confocal

ACS Paragon Plus Environment

ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

dishes containing mouse whole blood to inhibit cell death. Parental Panc02 cells, which express no miR-21a or miR-221, were treated without blood in 30 μg/mL zymosan. However, competitive affinity of the cy5.5-miR-21a or miR-221 MB to endogenous mature miR-21a or miR-221 expression under mouse blood treatment significantly increased the fluorescence signal (Figure 3A). According to previous reports,26 VisuFect-conjugated beacon shows almost no toxicity to mammalian cells and the miR MB is negligible for targeting functionality for miR23. The cy5.5-miR-21a and miR-221 MB designed similarly consisted of the VisuFect-MB system in the current study. Therefore, cy5.5-miR-21a and miR-221 MB may not hamper miRNA expression in Panc02 cells, suggesting that the signal-on of the cy5.5-miR-21a or miR-221 MB reflected the specific affinity of endogenous miR-21a or miR-221 expression. To compare the binding efficiency of miR-21a MB and miR-221 MB for mature miR monitoring in whole blood of Panc02-implanted mice, cy5.5 was linked to the 5′-end of the miR-21a MB or miR-221 MB for the mature miR-21a or miR-221 in the blood. The resulting cy5.5-miR-21a or miR-221 MBs were added together in vitro with blood samples from Panc02-implanted mice, which shows that the fluorescence in the cy5.5-miR-21a MB or miR-221 MB was enhanced after zymosan treatment. Confocal microscopy images were captured during intracellular delivery of miR-221 MB with zymosan treatment or MB without zymosan treatment from 2 h to 12 h (Figure 3B, Video S1, S2). This images and video show that obvious green fluorescence appear in zymosan treated Panc02 cells after 2 h of miR-221 MB treatment. No fluorescence for the Cy5.5-MB probe was detected in mixed normal and Panc02 cells without zymosan treatment owing to miR-21a or miR-221 expression in the absence of CTC (Figure 3C, normal, zymosan only and Panc02 groups). Thus, zymosan treatment can induce an acute inflammation so that the cy5.5-miR-21a MB and miR-221 MB signal-on is highly efficient to detect CTC in mouse blood. Additionally, confocal microscopy analysis for liver tissue suggests that only zymosan treated Panc02 tissues have fluorescence response (Figure 3D). In vivo miR monitoring in a Panc02-implanted mouse model. To investigate the possibility of using the miR21a/221-MB probe for monitoring CTC occurrence in vivo, zymosan injection was performed in a Panc02implanted mouse model. Signal-on of cy5.5-miR-21a MB probe or cy5.5-miR-221 MB probe was identified for one-step high affinity monitoring of CTCs in mice. The sensitivity of the cy5.5-miR-21a/221 MB was analyzed in mice that possess large number of CTC after zymosan treatment. The cy5.5-miR-21a/221 MB was intravenously injected in Panc02-implanted mice with zymosan treatment. Intriguingly, Red fluorescence signals from CTCs were detected by miR-21a MB with cy5.5 provoked by zymosan (Figure 4A, right panel) when it was compared with fluorescence intensity in mouse without zymosan treatment (Figure 4A, middle panel). In contrast, no signal was detected in the control C57BL6 mice from the Panc02 group (Figure 4A, left panel). Similarly, red fluorescence signals of CTCs were detected from cy5.5 with miR-221 MB triggered by zymosan (Figure 4B, right panel), whereas no signal was detected in the control C57BL6 mice from the Panc02 group (Figure 4B, left panel). It should be noted that the fluorescence of CTCs in Panc02-implanted mice after zymosan injection can also be observed in the liver site. In order to confirm whether the fluorescence signal-on corresponded to the intracellular miR-21a/221 expression, we synthesized a mutant cy5.5 miR-21a/221 MB probe to detect miR21a/221 as a negative control (data not shown). As a result, CTCs were not observed in liver site of normal mouse by the miR-21a*/221* MB with cy5.5 but were detected by miR-21a/221 MB in the immunocytochemistry analysis (Figure 4C). We further determined the effect of zymosan and the resulting CTCs in a mice model that reproduced the systemic dissemination and generation of metastasis associated with CTCs. The extent of

ACS Paragon Plus Environment

Page 8 of 19

Page 9 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

metastasis was analyzed resulting from the intravenous injection of cy5.5-miR-21a/221 and intraperitoneal injection of zymosan. Figure 4 shows that the up-regulation of miR-21a and miR-221 and the consequent recapitulation of the plasticity phenotype of CTCs resulted in a more dramatic cell seeding and metastatic spread, both in the pattern of metastasis localization as well as CTCs behavior. In addition to reinforcing the role of zymosan during the initial events of dissemination in pancreatic cancer, these results indicate a plasticity genotype in CTC corresponding to their capacity to metastasize. Therefore, in this study, we present evidence for the presence of CTC in high-risk pancreatic cancers, and further characterize a genotype associated with CTC plasticity and stem cell nature. These results indicate that this tool is quite reliable to quantify miR in very small volumes of whole blood, so showing a high possibility for further applications in the clinic for monitoring pancreatic cancers. We conclude that miR-based fluorescence image monitoring associated with a MB system is a reliable tool to effectively monitor CTC from high-risk pancreatic cancer and to potentially distinguish highrisk from low-risk tumors. The advantage of combining CTC monitoring and MB system is that it can identify and characterize miRs specific of a particular subpopulation of metastatic cells. However, this approach cannot distinguish between augmented levels in miR expression from CTC monitoring resulting from an up-regulated expression or from a rise in the number of CTCs. Nevertheless, considering the potential for monitoring and follow-up of patients, these miRs provide a genotypic link to the biology of CTC that may be a key in the founding of novel therapeutic strategies to eliminate metastatic seeding in pancreatic ductal adenocarcinoma (PDAC). CONCLUSION This study shows a strategy for QD-based fluorescence imaging of CTC during tumor metastasis. miR-21a/221targeting oligonucleotides were bound to QDs, fluorescence monitoring made it possible to confirm the performance both of endogenous and exogenous miR-21a/221. Imaging of endogenous miR-21a/miR-221 expression was obtained with cy5.5-miR-21a/221 MB after zymosan treatment in Panc02-implanted mice. This signal-on system based on fluorophore is able to be utilized for monitoring of endogenous miR-21a or miR-221 in vitro and in vivo. In conclusion, we designed a monitoring system which could detect miR-mediated CTC in very small volumes of bloods and make the CTC-detection faster and efficient. This technique could also qualitatively distinguish different CTCs. This assay also suggests a great potential for monitoring miRs in cells and tissues, which possesses invaluable information for clinical prognosis as well as biomedical research. The CTC monitoring results described in this study demonstrate the high specificity of the technique derived from the recovered fluorescence signal, which results from the conformational change triggered by specific molecular binding of the designed MB. This tool provides a big possibility to use this QD-based MB system for in vivo quick monitoring of circulating miRs with high sensitivity and selectivity via a simple procedure. ASSOCIATED CONTENT Supporting Information Supporting Information Available: The following files are available free of charge. Gel electrophoresis of the MB probe, sequences for MB and target miRNA, detailed hybridization procedure,

ACS Paragon Plus Environment

ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

zymosan mediated downregulation in cells decreased miRNA levels, effects of transfection efficiency (Supporting information.pdf). Supplementary Movies Movie 1. miR-221 imaging in panc02 cells without Zymosan Real-time monitoring of intracellular delivery of miR-221 MB MB without zymosan treatment. Panc02 cells were incubated with 5 pM MB for 2 to 12 h, and images were taken from 2 h to 12 h after MB treatment using a fluorescent microscope. (Scale, 25 × 25 μm.) Movie 2. miR-221 imaging in panc02 cells with Zymosan Real-time monitoring of intracellular delivery of miR-221 MB with zymosan treatment. Panc02 cells were incubated with zymosan 100 μg/mL for 12 h and 5 pM MB for 2 to 12 h, and images were captured from 2 h to 12 h after MB treatment by using a fluorescent microscope. (Scale, 25 × 25 μm.)

AUTHOR INFORMATION *Corresponding Authors: J. Lee, [email protected]; H.S.Han, [email protected] Notes The authors declare no competing financial interest. ACKNOWLEDGMENTS This work was supported by the National Research Foundation (NRF) of Korea under the auspices of the Ministry of Science and ICT, Republic of Korea (Grant no. NRF-2017R1A4A1015627); the Korea Healthcare Technology R&D Project (Grant HI17C1260) of the Ministry for Health, Welfare & Family Affairs.

REFERENCE (1) Rhim, A. D.; Mirek, E. T.; Aiello, N. M.; Maitra, A.; Bailey, J. M.; McAllister, F.; Reichert, M.; Beatty, G. L.; Rustgi, A. K.; Vonderheide, R. H. EMT and dissemination precede pancreatic tumor formation.

Cell 2012, 148 (1), 349-361.

ACS Paragon Plus Environment

Page 10 of 19

Page 11 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

(2) Sieuwerts, A. M.; Kraan, J.; Bolt, J.; van der Spoel, P.; Elstrodt, F.; Schutte, M.; Martens, J. W.; Gratama, J.-W.; Sleijfer, S.; Foekens, J. A. Anti-epithelial cell adhesion molecule antibodies and the detection of circulating normal-like breast tumor cells. Journal of the National Cancer Institute 2009,

101 (1), 61-66. (3) Thege, F. I.; Lannin, T. B.; Saha, T. N.; Tsai, S.; Kochman, M. L.; Hollingsworth, M. A.; Rhim, A. D.; Kirby, B. J. Microfluidic immunocapture of circulating pancreatic cells using parallel EpCAM and MUC1 capture: characterization, optimization and downstream analysis. Lab on a Chip 2014, 14 (10), 1775-1784. (4) Pantel, K.; Alix-Panabières, C. Detection methods of circulating tumor cells. Journal of thoracic

disease 2012, 4 (5), 446-447. (5) Millner, L. M.; Linder, M. W.; Valdes, R. Circulating tumor cells: a review of present methods and the need to identify heterogeneous phenotypes. Annals of Clinical & Laboratory Science 2013, 43 (3), 295-304. (6) Škereňová, M.; Mikulová, V.; Čapoun, O.; Zima, T. The characterization of four gene expression analysis in circulating tumor cells made by Multiplex-PCR from the AdnaTest kit on the lab-on-achip Agilent DNA 1000 platform. Biochemia medica: Biochemia medica 2016, 26 (1), 103-113. (7) Chang, C.-L.; Huang, W.; Jalal, S. I.; Chan, B.-D.; Mahmood, A.; Shahda, S.; O'Neil, B. H.; Matei, D. E.; Savran, C. A. Circulating tumor cell detection using a parallel flow micro-aperture chip system.

Lab on a Chip 2015, 15 (7), 1677-1688. (8) Zeng, Z.; Tung, C.-H.; Zu, Y. A cancer cell-activatable aptamer-reporter system for one-step assay of circulating tumor cells. Molecular Therapy-Nucleic Acids 2014, 3, DOI: 10.1038/mtna.2014.36. (9) Koscianska, E.; Starega-Roslan, J.; Sznajder, L. J.; Olejniczak, M.; Galka-Marciniak, P.; Krzyzosiak, W. J. Northern blotting analysis of microRNAs, their precursors and RNA interference triggers. BMC

molecular biology 2011, 12 (1), 14, DOI: 10.1186/1471-2199-12-14. (10) Chen, X.; Guo, X.; Zhang, H.; Xiang, Y.; Chen, J.; Yin, Y.; Cai, X.; Wang, K.; Wang, G.; Ba, Y. Role of miR-143 targeting KRAS in colorectal tumorigenesis. Oncogene 2009, 28 (10), 1385–1392. (11) Bergman, P.; James, T.; Kular, L.; Ruhrmann, S.; Kramarova, T.; Kvist, A.; Supic, G.; Gillett, A.; Pivarcsi, A.; Jagodic, M. Next-generation sequencing identifies microRNAs that associate with pathogenic autoimmune neuroinflammation in rats. The Journal of Immunology 2013, 190 (8), 40664075. (12) Schmittgen, T. D.; Zakrajsek, B. A.; Mills, A. G.; Gorn, V.; Singer, M. J.; Reed, M. W. Quantitative reverse transcription–polymerase chain reaction to study mRNA decay: comparison of endpoint and real-time methods. Analytical biochemistry 2000, 285 (2), 194-204. (13) Urbich, C.; Kuehbacher, A.; Dimmeler, S. Role of microRNAs in vascular diseases, inflammation, and angiogenesis. Cardiovascular research 2008, 79 (4), 581-588. (14) Carrington, J. C.; Ambros, V. Role of microRNAs in plant and animal development. Science 2003,

301 (5631), 336-338. (15) Lu, J.; Clark, A. G. Impact of microRNA regulation on variation in human gene expression.

Genome research 2012, 22 (7), 1243-1254.

ACS Paragon Plus Environment

ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(16) De Albuquerque, A.; Kubisch, I.; Breier, G.; Stamminger, G.; Fersis, N.; Eichler, A.; Kaul, S.; Stölzel, U. Multimarker gene analysis of circulating tumor cells in pancreatic cancer patients: a feasibility study. Oncology 2012, 82 (1), 3-10. (17) Zhang, J.; Chen, K.; Fan, Z. Circulating tumor cell isolation and analysis. In Advances in clinical

chemistry; Elsevier: 2016; pp 1-31. (18) Ko, H. Y.; Lee, D. S.; Kim, S. A reporter gene imaging system for monitoring microRNA biogenesis.

Nature protocols 2009, 4 (11), 1663–1669. (19) Oh, S. W.; Do Won Hwang, D. S. L. In vivo monitoring of microRNA biogenesis using reporter gene imaging. Theranostics 2013, 3 (12), 1004–1011. (20) Rodia, M. T.; Ugolini, G.; Mattei, G.; Montroni, I.; Zattoni, D.; Ghignone, F.; Veronese, G.; Marisi, G.; Lauriola, M.; Strippoli, P. Systematic large-scale meta-analysis identifies a panel of two mRNAs as blood biomarkers for colorectal cancer detection. Oncotarget 2016, 7 (21), 30295–30306. (21) Kosaka, N.; Iguchi, H.; Ochiya, T. Circulating microRNA in body fluid: a new potential biomarker for cancer diagnosis and prognosis. Cancer science 2010, 101 (10), 2087-2092. (22) Huang, Z.; Huang, D.; Ni, S.; Peng, Z.; Sheng, W.; Du, X. Plasma microRNAs are promising novel biomarkers for early detection of colorectal cancer. International journal of cancer 2010, 127 (1), 118-126. (23) Sheng, W.; Ogunwobi, O. O.; Chen, T.; Zhang, J.; George, T. J.; Liu, C.; Fan, Z. H. Capture, release and culture of circulating tumor cells from pancreatic cancer patients using an enhanced mixing chip. Lab on a chip 2014, 14 (1), 89-98. (24) Hwang, D. W.; Song, I. C.; Lee, D. S.; Kim, S. Smart magnetic fluorescent nanoparticle imaging probes to monitor microRNAs. Small 2010, 6 (1), 81-88. (25) Hwang, J. Y.; Kim, S. T.; Han, H.-S.; Kim, K.; Han, J. S. Optical aptamer probes of fluorescent imaging to rapid monitoring of circulating tumor cell. Sensors 2016, 16 (11), DOI: 10.3390/s16111909. (26) Joo, J. Y.; Lee, J.; Ko, H. Y.; Lee, Y. S.; Lim, D.-H.; Kim, E.-Y.; Cho, S.; Hong, K.-S.; Ko, J. J.; Lee, S. Microinjection free delivery of miRNA inhibitor into zygotes. Scientific reports 2014, 4, DOI: 10.1038/srep05417.

List of Figures Figure 1.

ACS Paragon Plus Environment

Page 12 of 19

Page 13 of 19

ACS Sensors

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Paragon Plus Environment

ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 2.

ACS Paragon Plus Environment

Page 14 of 19

Page 15 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

Figure 3.

ACS Paragon Plus Environment

ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 4.

ACS Paragon Plus Environment

Page 16 of 19

Page 17 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

Legend of Figure Figure 1. Principle of assay. The complementary region for target miR is located in between 3’-end quencher and the stem loop region for signal-on/off. Schematic illustration of miR monitoring using MB was shown. Detailed

design

of

these

representations

was

introduced

on

the

online

(http://www.tbi.univie.ac.at/~ivo/RNA/alifoldcgi.html).

Figure 2. Selectivity of the MB probe against different target miRs including mature, mature* and pre-mature and fluorescence emission spectra of miR MB fluorescence quenching by the addition of miR-21a (A) and miR-221(B). (A) Sequence representation of miR-21a, miR-21a* and pre-miR21a (upper), miR-221, miR-221* and pre-miR221 (bottom). The mature bases are marked in yellow and mature* are marked in pink. (B) Fluorescence spectra of the MB prove against different target miRs including miR21a* (yellow green), miR-221* (blue), miR-21a (red), miR-221 (black), template miR-21a (magellan) and template miR-221 (pink). (C) The log-linear correlation between the value of (F-F0)/F0 regarding miR-21a* (blue), miR-21a (red), pre-miR21a (pink), miR-221* (magellan), miR-221 (yellow green) and pre-miR221 (yellow). Error bars indicate the standard deviation of triplicate experiments. (D) Fluorescence spectra depending on the concentration on miR-21a. The concentration of miR-21a is 0.1 fM, 1 fM, 10 fM, 100 fM, 1 pM, and 10 pM from bottom to top. (E) Fluorescence spectra depending on the concentration on miR-221. The concentration of miR-221 is 0.1 fM, 1 fM, 10 fM, 100 fM, 1 pM, and 10 pM. The log-linear plot of the (F-F0)/F0 as a function of the concentration of miR-21a (D, inset) and miR-221 (E, inset) was shown. (concentration; hairpin MB probe: 10 pM, template: 2 pM)

Figure 3. Confocal microscopy imaging of CTCs mixed without or with bloods and miR-21a/221 MB probes by zymosan treatment. (A) Fluorescence images from mouse blood with zymosan treatment without zymosan treatment in Panc02-implanted group. (B) Real-time monitoring of intracellular delivery of miR-221 MB with zymosan treatment or MB without zymosan treatment. Panc02 cells were incubated with zymosan 100 μg/mL for 12 h and 5 pM MB for 2 to 12 h, and images were captured from 2 h to 12 h after MB treatment by using a fluorescent microscope. (Scale bar, 15 μm.) (C) Either 1 pmol cy5.5-miR-21a or miR-221 MB was mixed with separated blood after two weeks with zymosan injection in Panc02-implanted mice. (D) Double immunofluorescence against mature miR-21a (green) and miR-221 (red) performed on frozen liver sections from C57BL6 mice implanted with Panc02 cells at pancreatic tissues and collected 2 weeks after zymosan injection. Nuclei were labeled with H33342 (blue). Figure 4. In vivo fluorescence imaging of the CTCs in a mouse model using the miR-21a/221 MB incorporated into Panc02 cells. (A) The miR-21a and (B) miR-221 MB were intravenously injected into the mouse tail. The Panc02 was implanted in mouse pancreatic tissues by injection after zymosan treatment to simulate CTC. The fluorescence from the CTC existing group (right) was enhanced compared to the PBStreated control group (left). Fluorescence images show that CTCs in the Panc02 cell-implanted liver had comparable (C) Quantitative ROI analysis result representing that the fluorescence in zymosan treated mouse

ACS Paragon Plus Environment

ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

is higher that than in a zymosan non-treated mouse (middle), ** p< 0.005. Dic: differential interference contrast.

Table 1. Sequences of the oligonucleotidesa

ACS Paragon Plus Environment

Page 18 of 19

Page 19 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

for TOC only

ACS Paragon Plus Environment