Universal Aptameric System for Highly Sensitive ... - ACS Publications

A universal approach is proposed in this study for the development of an aptameric assay system for proteins based on aptamer structure-switching-trig...
0 downloads 5 Views 270KB Size
Download PDF
Anal. Chem. 2010, 82, 2221–2227

Universal Aptameric System for Highly Sensitive Detection of Protein Based on Structure-Switching-Triggered Rolling Circle Amplification Zai-Sheng Wu, Songbai Zhang, Hui Zhou, Guo-Li Shen,* and Ruqin Yu* State Key Laboratory for Chemo/Biosensing and Chemometrics, College of Chemistry and Chemical Engineering, Hunan University, Changsha 410082, P. R. China A universal approach is proposed in this study for the development of an aptameric assay system for proteins based on aptamer structure-switching-triggered ligationrolling circle amplification (L-RCA) upon target binding. The strategy chiefly depends on the competition for binding the aptamer probe between target protein and a complementary single-stranded DNA (CDNA) that can induce the circularization of the padlock probe. Introduction of target protein into the assay system inhibits the hybridization of the CDNA with the aptamer probe because of the formation of the target/aptamer duplex. The free CDNA can only hybridize with the padlock probe. With the assistance of DNA ligase, the padlock probe is circularized, and the subsequent RCA process can be accomplished by Phi 29 DNA polymerase. Each RCA product containing thousands of repeated sequences might hybridize with a large number of molecular beacons (detection probes), resulting in an enhanced fluorescence signal. In contrast, in the absence of target protein, no obvious change in the fluorescence intensity of the detection probe is observed. This signaling mode for target recognition and transduction events is based on the combination of aptamer recognition elements and L-RCA technology with high specificity and sensitivity. The proposed assay system not only exhibits excellent analytical characteristics (e.g., the detection limit on attomolar scale and a linear dynamic range of more than 3 orders of magnitude) but also possesses significant advantages over existing aptameric assays. The proposed strategy is universal since the sequences of aptamer probe, CDNA, and padlock probe could be easily designed to be compatible with the L-RCA based detection of other proteins without other conditions. Traditionally, nucleic acids are employed as molecular recognition elements for the detection of DNA and RNA targets through Watson-Crick base pairing. Over the past two decades, several landmark discoveries have extended the application of nucleic acid * To whom correspondence should be addressed. Phone: 86-731-8821355. Fax: (+86) 731-8821355. E-mail: [email protected]; [email protected]. 10.1021/ac901794w  2010 American Chemical Society Published on Web 02/12/2010

probes as unique biorecognition elements.1 This class of oligonucleotides (so-called aptamers) is synthetic DNA/RNA oligonucleotides obtained from random sequence nucleic acid libraries by an in vitro evolution process, named systematic evolution of ligands by exponential enrichment (SELEX). Aptamers typically assume characteristic and compact secondary or tertiary structures which are able to recognize their targets with high affinity and specificity.2,3 Compared with other recognition elements, such as antibodies, aptamers possess significant advantages,4,5 such as simple synthesis, easy labeling, good stability, and design flexibility. Thus, aptameric screening systems have gained considerable attention and are expected to dramatically facilitate new drug selection, disease diagnosis, protein analysis, etc.6,7 Nevertheless, compared with the bellwether antibody technology, aptamer research is still in its infancy.5,6 To improve the performance of aptameric screening systems, researchers should overcome or alleviate effects originating from the low association constants of some aptamers to their ligands8 or chemical modification-induced loss of binding activity.9 Development of aptameric screening tools for real-world applications still remains a considerable challenge.5,8 Several strategies for transducing aptamer/target interaction into an electrochemical, piezoelectric, colorimetric, or fluorescent signal have been reported.10-21 For most reported aptamer-based (1) Nutiu, R.; Li, Y. Chem.sEur. J. 2004, 10, 1868–1876. (2) Yang, L.; Fang, C. W.; Cho, E. J.; Ellington, A. D. Anal. Chem. 2007, 79, 3320–3329. (3) Zuo, X.; Song, S.; Zhang, J.; Pan, D.; Wang, L.; Fan, C. J. Am. Chem. Soc. 2007, 129, 1042–1043. (4) Jayasena, S. D. Clin. Chem. 1999, 45, 1628–1650. (5) Song, S.; Wang, L.; Li, J.; Zhao, J.; Fan, C. TrAC, Trends Anal. Chem. 2008, 27, 108–117. (6) Wang, X. L.; Li, F.; Su, Y. H.; Sun, X.; Li, X. B.; Schluesener, H. J.; Tang, F.; Xu, S. Q. Anal. Chem. 2004, 76, 5605–5610. (7) Fang, X.; Sen, A.; Vicens, M.; Tan, W. Chembiochem 2003, 4, 829–834. (8) Shlyahovsky, B.; Li, D.; Weizmann, Y.; Nowarski, R.; Kotler, M.; Willner, I. J. Am. Chem. Soc. 2007, 129, 3814–3815. (9) Hagihara, M.; Fukuda, M.; Hasegawa, T.; Morii, T. J. Am. Chem. Soc. 2006, 128, 12932–12940. (10) Radi, A. E.; Acero Sa´nchez, J. L.; Baldrich, E.; O’Sullivan, C. K. J. Am. Chem. Soc. 2006, 128, 117–124. (11) Ferapontova, E. E.; Olsen, E. M.; Gothelf, K. V. J. Am. Chem. Soc. 2008, 130, 4256–4258. (12) Wu, Z.-S.; Guo, M.-M.; Zhang, S.-B.; Chen, C.-R.; Jiang, J.-H.; Shen, G.-L.; Yu, R.-Q. Anal. Chem. 2007, 79, 2933–2939. (13) Yao, C.; Qi, Y.; Zhao, Y.; Xiang, Y.; Chen, Q.; Fu, W. Biosens. Bioelectron. 2009, 24, 2499–2503.

Analytical Chemistry, Vol. 82, No. 6, March 15, 2010

2221

Scheme 1. Schematic Illustration of Homogeneous Aptameric Assay System for Proteins Based on the Structure-Switching-Triggered L-RCAa

a (A) In the presence of nontarget proteins, the CDNAs hybridize preferentially with aptamer probe and the subsequent L-RCA reaction cannot occur. (B) Introduction of target protein into the assay system can inhibit the hybridization of CDNA with aptamer probe because of the formation of aptamer/target duplex. Thus, the CDNA can only hybridize with the padlock probe that would fold into a ringlike structure in a head-to-tail manner. As a result, the circularization of padlock probe by DNA ligase and RCA reaction by DNA polymerase are successively initiated. When the molecular beacons hybridize with the RCA product consisting of thousands of tandem repeats, the fluorophore and the quencher are moved away from each other, leading to the restoration of fluorescence and generating an amplified fluorescence signal. In the present signaling scheme, the CDNA is designed to serve as both the ligation template and extended primer. The assay performance is improved because of the combination of aptameric recognition functions with highly sensitive and specific L-RCA.

protein analyses, structure switching-induced conformational change is the starting point to signal the target binding event regardless of whether electrochemical or optical transducers are used.3,22 However, some electrochemical strategies are timeconsuming because of the multistep chemical modification process,23 the cumbersome target analysis procedure in a step-bystep fashion,24 and the decreased interfacial reaction rate. Although being convenient, optical assay systems, especially for the detection of large biomolecules, usually suffer from the low sensitivity. For signal amplification, the polymerase chain reaction (PCR) is commonly employed to gain an amount of detectable samples from genomic DNA. However, it is often difficult to adapt PCR to the measurement of protein, especially for real-time protein detection because of the intrinsic property of PCR, such as high-precision temperature cycling. As an alternative, rolling circle amplification (RCA), a different nucleic acid amplification technique carried out isothermally, can be suitably used for protein detection. In a typical RCA, a circular template is amplified isothermally by Phi29 DNA polymerase. The DNA amplification with a single primer proceeds in a linear fashion, resulting in a long single-stranded DNA product that contains thousands of tandem repeats complementary to the circular template and can serve as the detection sites. However, Liu, J.; Lu, Y. Angew. Chem. 2006, 118, 96–100. Nutiu, R.; Yu, J. M.; Li, Y. ChemBioChem 2004, 5, 1139–1144. Liu, J.; Lu, Y. Nat. Protoc. 2006, 1, 246–252. Liu, J.; Lu, Y. Adv. Mater 2006, 18, 1667–1671. Liu, J.; Lu, Y. Angew. Chem., Int. Ed. 2006, 45, 90–94. Nutiu, R.; Li, Y. J. Am. Chem. Soc. 2003, 125, 4771–4778. Nutiu, R.; Li, Y. Methods 2005, 37, 16–25. Nutiu, R.; Yingfu Li, Y. Angew. Chem., Int. Ed. 2005, 44, 5464–5467. Xiao, Y.; Piorek, B. D.; Plaxco, K. W.; Heeger, A. J. J. Am. Chem. Soc. 2005, 127, 17990–17991. (23) de-los-Santos-Alvarez, N.; Lobo-Castanon, M. J.; Miranda-Ordieres, A. J.; Tunon-Blanco, P. TrAC, Trends Anal. Chem. 2008, 27, 437–446. (24) Deng, C.; Chen, J.; Nie, Z.; Wang, M.; Chu, X.; Chen, X.; Xiao, X.; Lei, C; Yao, S. Anal. Chem. 2009, 81, 739–745.

(14) (15) (16) (17) (18) (19) (20) (21) (22)

2222

Analytical Chemistry, Vol. 82, No. 6, March 15, 2010

despite great potential for the highly sensitive detection of biomolecules, very few studies2 reported the RCA-based aptameric sensing system because for proteins it is considerably difficult to design a useful aptamer probe that can undergo a complex conformational change to initiate the RCA effect, and the analytical performance should be improved. In the present study, using platelet-derived growth factor BB (PDGF-BB) as the model analyte, we proposed a fluorescence aptameric assay system for the highly sensitive detection of proteins. The structure-switching of aptamer upon target binding was used to trigger RCA-mediated signal amplification. A complementary single-stranded DNA (CDNA) to the padlock probe serving as the ligation template was designed to preferably hybridize with the aptamer probe, resulting in the aptamer/CDNA duplex in the absence of target proteins. Introduction of target protein induced intramolecular folding of the aptamer sequence to specifically bind with the analyte, inhibiting the formation of the aptamer/CDNA hybrids. Making use of the DNA ligase and polymerase, CDNA could trigger the circularization of padlock probes and subsequent RCA reaction, substantially amplifying the target binding event in an isothermal fashion. Since the resultant product contained thousands of repeated sequences complementary to the sequences of signaling probes (molecular beacons), the present assay system could generate a significantly enhanced fluorescence signal. In contrast, nontarget proteins did not cause a detectable fluorescence change because they could not disturb the hybridization between aptamer and CDNA. The operation principle is shown in Scheme 1. Utilizing this signaling method, the convenient and sensitive quantification of target protein can be accomplished. Given the excellent analytical properties and distinct advantages, the proposed strategy indicates a promising screening platform for the analyses of a wide range of analytes.

Table 1. Oligonucleotides Used in the Present Study note

sequence (5′-3′)

padlock probe aptamer probe 1 aptamer probe 2 aptamer probe 3 aptamer probe 4 CDNA 1 CDNA 2 CDNA 3 CDNA 4 detection probe

(phosphate)TGTCTTCGCCTTCTTGTTTCCTTTCCTTGAAACTTCTTCCTTTCTTTCTTTCGACTAAGCACC TGTCTTCGCCCAGGCTACGGCACGTAGAGCATCACCATGATCCTG AAACTTCGCCCAGGCTACGGCACGTAGAGCATCACCATGATCCTG AAAAAACGCCCAGGCTACGGCACGTAGAGCATCACCATGATCCTG AAAAAAAAACCAGGCTACGGCACGTAGAGCATCACCATGATCCTG TACGTGCCGTAGCCTGGGCGAAGACAGGTGCTTAGT AAAATGCCGTAGCCTGGGCGAAGACAGGTGCTTAGT AAAAAAAAGTAGCCTGGGCGAAGACAGGTGCTTAGT AAAAAAAAAAAACCTGGGCGAAGACAGGTGCTTAGT (FAM)-AGCTAATCCTTGAAACTTCTTCTTAGCT-(DABCYL)

EXPERIMENTAL SECTION Chemicals. Oligonucleotides designed in this study were synthesized by Takara Biotechnology Co., Ltd. (Dalian, China), and the sequences of all oligonucleotides are listed in Table 1. For ligation, the 5′ end of the padlock probe was phosphorylated. The italicized portions in the 5′ and 3′ terminal of the padlock probe can match perfectly with the CDNA in a head-to-tail fashion. On the other hand, the CDNA was complementary to the aptamer probe. The underlined portion in the aptamer probe is the specific binding sequence for PDGF-BB. Unless stated otherwise, aptamer probe 3 and CDNA 2 were used. A molecular beacon was used as the detection probe, whose 5′ and 3′ ends were modified with FAM and DABCYL, respectively. PDGF-BB was purchased from Tiancheng Biotechnology Co., Ltd. (Shanghai, China). Human IgG and human serum albumin (HSA) were obtained from Dingguo Biochemical Reagents Company (Changsha, China). Fibronectin (Fn) and complement IV (C4) were purchased from the Health Department, Shanghai Institute of Biological Products (Shanghai, China). Escherichia coli DNA ligase set (including Escherichia coli DNA ligase, 10×Escherichia coli DNA ligase buffer, and 10×BSA (0.05%)) and deoxyribonucleoside 5′-triphosphate mixture (dNTPs) were obtained from Takara Biotechnology Co., Ltd. (Dalian, China) while Phi29 DNA polymerase was from Epicenter Technologies (Madison, WI). All other chemicals were of analytical-reagent grade and used as received. Deionized and sterilized water (resistance > 18 MΩ · cm) was used throughout the experiments. Several buffers were used in the present work: hybridization buffer contained 30 mM Tris-HCl (pH 7.8), 300 mM KCl, and 4 mM MgCl2; ligation-reaction buffer consisted of 30 mM TrisHCl (pH 7.8), 150 mM KCl, 4 mM MgCl2, 10 mM (NH4)2SO4, 1.2 mM EDTA, and 0.1 mM NAD+; RCA-reaction buffer was composed of 40 mM Tris-HCl (pH 7.5), 50 mM KCl, 10 mM MgCl2, 5 mM (NH4)2SO4, and 4 mM DTT. The pH was adjusted with either NaOH or HCl solution. Apparatus and Fluorescence Measurements. Fluorescence spectra were measured using a Hitachi F-4500 fluorescence spectrometer (Hitachi, Japan) with a personal computer data processing unit. The light is a 150 W Xe lamp and the detector is a R928F red-sensitive photomultiplier. Excitation and emission slits were all set for 5.0 nm band-pass. The fluorophore of FAM was excited at 497 nm, and the emission spectra from 508 to 600 nm were collected. The fluorescence intensity at 518 nm was used to evaluate the performance of the proposed assay strategy. All measurements were carried out at room temperature unless stated otherwise.

L-RCA and Protein Detection. The model analyte of protein PDGF was diluted by hybridization buffer. Then, different concentrations of PDGF were mixed with aptamer probe (37.9 nM) by equal volume. After incubation for 30 min, the same volume of CDNA (37.9 nM) was added into the resulting mixture and maintained for another 30 min. Then, padlock probe solution was introduced to hybridize with the free CDNA. The subsequent ligation-rolling circle amplification (L-RCA) reaction was carried out in homogeneous solution. Briefly, in a typical experiment, 4 µL of the resultant mixture was added to 20 µL of 1×Escherichia coli DNA ligase buffer (the ligation-reaction buffer) containing 3.6 U of Escherichia coli DNA ligase and 0.05% BSA. The ligation was allowed to proceed at 37 °C for 60 min. Then, 4 µL of the resulting solution was added to 20 µL of RCA-reaction buffer (namely the Phi29 reaction buffer) containing 625 µM dNTPs and 0.5 U/µL Phi29 polymerase. The polymerization reaction was carried out at 37 °C for 60 min. Subsequently, the resulting solution was incubated at 65 °C for 10 min to inactivate the Phi29 polymerase. After the resulting solution was cooled to ambient temperature, the detection probes were added and allowed to hybridize with the RCA products for about 40 min prior to the fluorescence measurement. RESULTS AND DISCUSSION Design for Structure-Switching-Triggered RCA. When binding with their targets, aptamers often undergo conformational changes which are typically created by manipulating their secondary structure. These conformational changes can usually be magnified by engineering. Several prominent reports25-27 focused on the signal amplification strategy for the sensitive detection of large biomolecules through the merger of aptameric recognition functions with the basic principles of DNA amplification technology such as PCR and RCA. However, for those signaling schemes, each target species is generally required to possess two and more binding sites in order to form a sandwich structure. Herein, we proposed a new interrogating strategy for protein detection based on structure switching-triggered RCA, circumventing the limitations of sandwich assays. The construction of the assay scheme was relatively straightforward, where the aptamer probe without any chemical modification was involved. The aptamer contained an extant DNA sequence (the underlined (25) Di Giusto, D. A.; Wlassoff, W. A.; Gooding, J. J.; Messerle, B. A.; King, G. C. Nucleic Acids Res. 2005, 33, e64. (26) Fredriksson, S.; Gullberg, M.; Jarvius, J.; Olsson, C.; Pietras, K.; Gustafsdottir, S. M.; Ostman, A.; Landegren, U. Nat. Biotechnol. 2002, 20, 473–477. (27) Fischer, N. O.; Tarasow, T. M.; Tok, J. B. H. Anal. Biochem. 2008, 373, 121–128.

Analytical Chemistry, Vol. 82, No. 6, March 15, 2010

2223

Figure 1. Fluorescence spectra of the detection probe in assay system in the absence (blank) and presence of target protein. Inset depicts the intensity of the fluorescence peak at 518 nm recorded for target sample and blank. The error bars indicate the standard deviation above and below the average of four separate experiments.

part as shown in Table 1) for binding target protein PDGF with high affinity.28 A 36-mer single-stranded DNA (CDNA) was used as the antisense sequence whose 5′ and 3′ half parts were complementary to the aptamer probe and the padlock probe, respectively. Moreover, its middle base segment matches both aptamer and padlock probe. In the absence of target protein, the CDNA tended to hybridize with the aptamer probe to form aptamer/DNA duplex since the aptamer probe was designed to compete with the padlock probe for hybridizing to the CDNA. Thus, no circularization template can be gained even with the assistance of ligase. On the other hand, in the presence of cognate analyte, the aptamer probe changed its conformation to bind with target protein and was incapable of hybridizing to the CDNA. Naturally, the free CDNA hybridized with the terminal regions (the italic parts as shown in Table 1) of the padlock probe, forming a ligation junction. Ligation of the adjacent ends by DNA ligase led to the circularization of the padlock probe. The circularized template was subsequently amplified by Phi29 DNA polymerase using directly the CDNA as the primer. The RCA products contained thousands of repeated sequences which made the molecular beacons restore their fluorescence because of the RCA product/molecular beacon hybridization. Utilizing the present homogeneous assay, the target protein can be sensitively detected with only submicroliter sample dosage. As shown in Figure 1, 8.4 nM PDGF induced a fluorescence intensity of about 353 au while a control experiment without PDGF only exhibited a fluorescence intensity of about 35 au that is equivalent to the background fluorescence of the detection probe. That is to say, when no target protein existed in the assay system, the CDNA would hybridize with the aptamer probe but not with the padlock probe since no amplified fluorescence signal was detected. It is noteworthy that the concentration of target protein involved herein is relatively low. For example, the analyte concentration, which is in the linear dynamic range afforded by an aptameric system for the detection of the same target protein, is much higher than (28) Yang, C. J.; Jockusch, S.; Vicens, M.; Turro, N. J.; Tan, W. H. Proc. Natl. Acad. Sci. U.S.A. 2005, 102, 17278–17283.

2224

Analytical Chemistry, Vol. 82, No. 6, March 15, 2010

8.4 nM.29 The measured data strongly demonstrated the success of our proposed strategy. More details on the assay design and their optimizations are provided below. Sequence Optimization of CDNA and Aptamer Probe. The key point of our proposed strategy is that the CDNA only hybridize with padlock probe in the presence of target protein, which is closely related to the sequences of DNA probes. Therefore, the DNA probe sequences were optimized in order to make sure that the aptamer probe binds preferentially to the target protein while the CDNA hybridized with the padlock probe only in the presence of target protein to specifically trigger the ligation-RCA reaction. Herein four aptamer probes (aptamer probe 1 to 4) and four CDNA probes (CDNA 1 to 4) were designed to regulate the stability of the aptamer probe/CDNA duplex and the padlock probe/CDNA duplex by altering the base-pair double-stranded regions, and orthogonal experiments were carried out to evaluate the effect of probe sequences on the analytical performance. Sixteen groups of data were collected for the orthogonal experiments as shown in Figure 2. Black columns represent the fluorescence signals upon addition of 4.2 nM PDGF while the gray columns are the fluorescence intensity of blank control experiments. The signal-to-background ratio was used to evaluate the assay performance. The highest signal-to-background ratio was observed for group 10. For this group, aptamer probe 3 perfectly matched with CNDA 2 with 16 base-pairs of which 12 bases belonged to the binding sequence for PDGF as shown in Table 1. Therefore, after the target protein bound specifically to the aptamer probe, only 4 bases of the aptamer probe could hybridize with the CDNA. The resultant hybrid is extremely unstable in room temperature, easily initiating the L-RCA reaction. On the other hand, a fluorescence intensity of about 38 au found for the blank of group 10 is nearly equal to that of the detection probe. The measured data indicated that, in group 10, the CDNA could hybridize with the padlock probe only in the presence of target protein, specifically generating a RCA-mediated amplified signal. Dependence of Fluorescence Signal on the Order of Addition of Reagents. In principle, the proposed strategy is dependent on the competition between the target protein and the CDNA for the aptamer probe. Therefore, the influence of the order of addition of reagents on the assay performance was evaluated. For this purpose, two assay procedures were proposed. In procedure 1, the aptmer probe was allowed to bind to target protein, and then the CDNA was added into the resulting solution. Oppositely, in procedure 2, the aptamer probe was allowed to prehybridize with the CDNA prior to the target addition. Two groups of target detections at 4.2 nM were performed under identical conditions. The fluorescence intensity observed for the assay procedure 1 was about 1.4 fold higher than the value afforded by the procedure 2. The relative standard deviation of about 6% for four repetitive measurements was obtained. It is wellknown that anti-PDGF-BB aptamer sequence binds specifically with its cognate target with high affinity. The aptamer/analyte complex is so stable that the CDNA cannot take the place of target protein. Therefore, the L-RCA proceeded well, and a strong fluorescence signal was acquired. When the aptamer/DNA duplex was prepared in advance, the subsequent addition of target protein (29) Huang, C.-C.; Huang, Y.-F.; Cao, Z.; Tan, W.; Chang, H.-T. Anal. Chem. 2005, 77, 5735–5741.

Figure 3. Effect of padlock probe concentration on the fluorescence signal of aptameric assay system. On the change curve, the ordinate is the fluorescence intensity while the abscissa is the molar ratio of the padlock probe to CDNA. The concentration of target protein was 4.2 nM.

Figure 2. Sequence dependence of the fluorescence signal upon target protein. (A) The comparison of fluorescence peaks. Black columns and gray columns represent the fluorescence peaks at 518 nm recorded for 4.2 nM target samples and blanks, respectively. (B) The corresponding signal-to-background ratio. The abscissa indicates the group number of assay systems containing different aptamer probes (AP) and CDNAs: 1-AP1/CDNA1, 2-AP1/CDNA2, 3-AP1/ CDNA3, 4-AP1/CDNA4, 5-AP2/CDNA1, 6-AP2/CDNA2, 7-AP2/ CDNA3, 8-AP2/CDNA4, 9-AP3/CDNA1, 10-AP3/CDNA2, 11-AP3/ CDNA3, 12-AP3/CDNA4, 13-AP4/CDNA1, 14-AP4/CDNA2, 15-AP4/ CDNA3, 16-AP4/CDNA4.

could also displace the CDNA that was demonstrated by the fluorescence signal. However, the presence of CDNA prehybridized with aptamer probe brought some resistance to the formation of aptamer/analyte complex, lowering the fluorescence response intensity. Therefore, assay procedure 1 was chosen in our work. Effect of Padlock Probe Concentration. In the present strategy, the binding of aptamer probe to the target protein promoted the hybridization of CDNA with padlock probe. Given a defined concentration (37.9 nM) of CDNA, the molar ratio of the padlock probe to the CDNA was investigated in order to achieve the optimal analytical performance. As shown in Figure 3, the fluorescence intensity in the presence of target protein increased as the ratio value increased. When the molar ratio increased to 2:1 (namely, 75.8 nM padlock probe involved), the maximum fluorescence signal was achieved. Higher molar ratio brought a gradual decrease in fluorescence intensity. Presumably, a large excess of padlock probe disturbed its hybridization with

the CNDA in a head-to-tail fashion and subsequent L-RCA reaction. Therefore, a concentration of 75.8 nM of padlock probe was used in the RCA-based assay system. The effect of the ratio of aptamer to CDNA was also evaluated. The measured data indicated that the optimum ratio is 1:1. Further increasing or decreasing the ratio (e.g., 2:1 and 1:2) can deteriorate the assay sensitivity and/or lead to an increase in the background fluorescence. Therefore, the aptamer-to-CDNA ratio of 1:1 was used for target detection. Signal Generation and Optimization. Most reported RCAbased aptameric strategies30-32 were carried out on the interfaces where the biorecognition elements and primers were immobilized. In those cases, a sandwich structure was required and/or the used biosensors could not be regenerated. A few studies developed RCA-based assays in homogeneous solution2,27 where the fluorescence-active intercalators were used as the signal reporters. However, the intercalators cannot specifically recognize the defined sequences, and they are not general screening strategies because of their inherent drawbacks. To solve the problems associated with the sensing on interfaces, in our novel assay strategy, the target detection was performed in solution, and the reactions involved were sufficient and fast. To transduce specifically the target/aptamer binding events into the detectable signal, molecular beacons were employed as the detection probes. The loop of the molecular beacon was designed to match only with the RCA product. Only when the RCA reaction took place could the molecular beacons be opened, creating the amplified fluorescence signal. The resultant low background fluorescence intensity of the molecular beacon endowed the present assay system with high sensitivity. To achieve desirable analytical characteristics, the incubation time for the hybridization between the detection probe and the RCA products was optimized. The experiments are (30) Zhou, L.; Ou, L. J.; Chu, X.; Shen, G. L.; Yu, R. Q. Anal. Chem. 2007, 79, 7492–7500. (31) Cho, E. J.; Yang, L.; Levy, M.; Ellington, A. D. J. Am. Chem. Soc. 2005, 127, 2022–2023. (32) Huang, Y.; Nie, W. M.; Gan, S. L.; Jiang, J. H.; Shen, G. L.; Yu, R. Q. Anal. Biochem. 2008, 382, 16–22.

Analytical Chemistry, Vol. 82, No. 6, March 15, 2010

2225

Figure 4. Time dependence of the hybridization between the RCA products and detection probes. The resulting solution without detection probe was used to evaluate the initial state of addition of detection probe.

Figure 5. Fluorescence spectra of assay systems at different concentrations of target protein. Inset: linear relationship between the fluorescence intensity at 518 nm and the target concentration. The error bars indicate the standard deviation of repeated measurements. The details are seen in the corresponding section of text.

shown in Figure 4. The fluorescence signal increased sharply within 1 min and then approached to a constant. To ensure the completeness of hybridization between the RCA products and detection probes, 5 min incubation time was chosen as the hybridization time. Relatively high fluorescence signal and a comparatively short hybridization time demonstrate a complete hybridization and a high reaction rate, indicating the successful design of the assay scheme. The present assay strategy also overcomes the limitation of the existing homogeneous RCAmediated aptameric systems2,27 as described in other sections. Incubation time for RCA reaction as well as target/aptamer binding was investigated as shown in Supporting Information. Analytical Performance of Protein Detection. PDGF, a growth factor protein found in human platelets, is directly related with tumor growth33 since it has growth-promoting activity toward fibroblasts, glial cells, and smooth muscle cells. The efficient identification and accurate quantification of this protein highly important. Accordingly, PDGF-BB was often chosen as the model analyte to evaluate the analytical performance of the assay systems in previous studies. For example, Huang et al.29 developed a colorimetric sensing system for the PDGF detection using gold nanoparticles as signal repoters. Fang et al.34 employed a fluorescein-labeled aptamer for real-time PDGF analysis in homogeneous solution by fluorescence anisotropy. However, these optical methods usually suffered from low sensitivity (nM or subnM). Development of a robust assay with improved analytical properties is still an area of great interest from the viewpoint of practical application. To confirm the ability of the described strategy to sensitively quantify target protein, a series of different concentrations of PDGF-BB were measured, and a fluorescence intensity at 518 nm was employed to obtain the calibration curve. The results showed that the fluorescence intensity was linear to the concentration of target protein in the range from 11.0 pM to 16.7 nM as shown in Figure 5. When further increasing the concentration of target species, no obvious change in the

fluorescence intensity is observed. Moreover, the response data points are outside the linear response range. The calibration equation was F ) 37.98C + 49.31 with a correlation coefficient of 0.9984 (n ) 5, RSD ) 7.8%). The detection limit was estimated as 6.8 pM from three times the standard deviation corresponding to the blank sample detection. Taking the sample volume into account, we detected about 1.36 amol of protein molecules. Such excellent detection capability demonstrated an improvement by a factor of 470, 58, 147, and 90 when being compared with the previous aptameric screening systems for the same target protein based on colorimetric,29 fluorescent,2 luminescent,35 and electrochemical36 measurements, respectively, even though the L-RCAmediated signal amplification was also adopted.2 Furthermore, the linear dynamic range afforded by the present strategy is 15-220 fold wider than the values obtained in those studies. As reported in the literature,37 Kd for the formation of aptamer/PDGF-BB duplex is 0.1 nM. According to the literature reports,38,39 it is reasonable to achieve a linear dynamic range of 3 orders of magnitude for the proposed aptameric screening scheme. Moreover, compared with the previous studies,38,39 the target binding to one aptamer rather than two different aptamers can trigger the ligation-rolling circle amplification reaction in our signaling scheme, making the signal transduction easier. Besides the properties of target/aptamer binding, such analytical capabilities should be attributed to several factors. First, the aptamer probe without any chemical modification could preserve its intrinsic bioactivity that also determines the desirable detection specificity (see the following section for details). Second, introduction of PDGF could force the CDNA to hybridize with the padlock probe, and eventually thousands of detection sites were obtained from

(33) Wang, J.; Meng, W.; Zheng, X.; Liu, S.; Li, G. Biosens. Bioelectron. 2009, 24, 1598–1602. (34) Fang, X.; Cao, Z.; Beck, T.; Tan, W. Anal. Chem. 2001, 73, 5752–5757.

2226

Analytical Chemistry, Vol. 82, No. 6, March 15, 2010

(35) Jiang, Y.; Fang, X.; Bai, C. Anal. Chem. 2004, 76, 5230–5235. (36) Degefa, T. H.; Kwak, J. Anal. Chim. Acta 2008, 613, 163–168. (37) Green, L. S.; Jellinek, D.; Jenison, R.; Ostman, A.; Heldin, C. H.; Janjic, N. Biochemistry 1996, 35, 14413–14424. (38) Fredriksson, S.; Gullberg, M.; Jarvius, J.; Olsson, C.; Pietras, K.; Gustafsdottir, S. M.; Ostman, A.; Landegren, U. Nat. Biotechnol. 2002, 20, 473– 477. (39) Gullberg, M.; Gustafsdottir, S. M.; Schallmeiner, E.; Jarvius, J.; Bjarnegard, M.; Betsholtz, C.; Landegren, U.; Fredriksson, S. Proc. Natl. Acad. Sci. U.S.A 2004, 101, 8420–8424.

for parallel samples, indicating that the proposed sensing system could offer an acceptable reproducibility for protein detection. To evaluate the applicability and reliability of the proposed system, the recovery experiments were performed. Four samples containing the same concentration (8.4 nM) (defined as added concentration) of target protein were prepared individually by adding the known concentration of target sample to sera (final concentration of 1%), and each was detected four times. The target detections were carried out according to the procedure described in Experimental Section. The “found” concentration was estimated from the optical signal according to the regression equation. The average recovery and the average relative standard derivation were ∼96.2% and 3.7%, respectively.

Figure 6. Detection selectivity of the aptameric assay system. Four nontarget proteins at high concentration were used to investigate the fluorescence intensity corresponding to the nonspecific binding between the aptamer probes and nontarget proteins. All the experiments were carried out under identical conditions.

the L-RCA reaction, amplifying the target binding event. Additionally, the background fluorescence is relatively low because molecular beacons are opened only in the presence of target protein, and a very small amount of target protein could trigger a detectable fluorescence signal. Detection Specificity. Sensitivity and specificity are the two critical factors for a successful assay system for protein. In the proposed strategy, the sensitivity is mainly depended on the RCA reaction and the low background fluorescence associated with the specific hybridization of molecular beacons with RCA products. The detection specificity is basically determined by the aptameric recognition function and the sequence dependence of ligation reaction. In order to evaluate the detection specificity of the present detection system, the fluorescence change induced by the nonspecific binding of several nontarget proteins were investigated. As shown in Figure 6, compared with the value of more than 690 au upon target protein, the fluorescence intensity corresponding to the nontarget proteins (100 µg/mL of HSA, 18 µg/mL of IgG, 309.4 µg/mL of Fn, and 97.1 µg/mL of complement IV) was very low even though their concentration is higher by more than 1000 times than that of target species. For example, the maximal background-subtracted fluorescent peak induced by nonspecific binding is about 6.5%. The measured data demonstrate that the fluorescence signal was specifically triggered by the aptamer/target binding. Reproducibility and Applicability. To test the reproducibility of the present method, target samples at different concentrations in the linear detection range (8.40 nM, 2.10 nM and 370 pM) were measured. The maximum value of the relative standard deviations was 3.1% (n ) 3) for repeated measurements and 8.3% (n ) 5)

CONCLUSIONS In the present study, we proposed a universal approach for the development of an aptameric detection system for proteins by merging the function of aptameric recognition with DNA amplification technology. This homogeneous assay system not only eliminates the thermal cycling, the complex process for the interface preparation, and multistep assay procedure but also achieves improved assay characteristics (e.g., the wide linear response range, low detection limit, and high specificity). Moreover, there is no need to make any modification on the aptamer probe, decreasing the assay cost as well as making aptamer retain the high target binding activity. Additionally, the aptamer/target binding indirectly initiates L-RCA reaction where CDNA is used to mediate the signaling process. Namely, the L-RCA does not directly depend on the sequence of aptamer probe. Thus, the design of the screening scheme should be general enough so that it can be applied to the construction of other aptasensors for target analytes of interest. The generality of the sensing scheme also benefits from the separation between the target binding and L-RCA that overcomes the limitations of the sandwich assay, circumventing the requisite of two binding sites per target protein. Given attractive analytical characteristics and distinct advantages, the proposed assay strategy is expected to play an important role in both fundamental and applied research. ACKNOWLEDGMENT This study was financially supported by the National Natural Science Foundation of China (Grants No. 20375012, 90817101, 20775023) and “973” National Basic Research Program of China (No. 2007CB310500). SUPPORTING INFORMATION AVAILABLE Additional information as noted in the text. This material is available free of charge via the Internet at http://pubs.acs.org. Received for review August 9, 2009. Accepted January 29, 2010. AC901794W

Analytical Chemistry, Vol. 82, No. 6, March 15, 2010

2227