Variation in Seed Fatty Acid Composition and Sequence Divergence

Kim , M. J.; Kim , J. K.; Shin , J. S.; Suh , M. C. The SebHLH transcription factor mediates trans-activation of the SeFAD2 gene promoter through bind...
1 downloads 4 Views 2MB Size
Download PDF
Article pubs.acs.org/JAFC

Variation in Seed Fatty Acid Composition and Sequence Divergence in the FAD2 Gene Coding Region between Wild and Cultivated Sesame Zhenbang Chen,*,† Brandon Tonnis,‡ Brad Morris,‡ Richard B. Wang,§ Amy L. Zhang,§ David Pinnow,‡ and Ming Li Wang*,‡ †

Department of Crop and Soil Sciences, University of Georgia, Griffin, Georgia 30223, United States Plant Genetic Resources Conservation Unit, USDA-ARS, Griffin, Georgia 30223, United States § Young Scholar Program, University of Georgia, Griffin, Georgia 30223, United States ‡

S Supporting Information *

ABSTRACT: Sesame germplasm harbors genetic diversity which can be useful for sesame improvement in breeding programs. Seven accessions with different levels of oleic acid were selected from the entire USDA sesame germplasm collection (1232 accessions) and planted for morphological observation and re-examination of fatty acid composition. The coding region of the FAD2 gene for fatty acid desaturase (FAD) in these accessions was also sequenced. Cultivated sesame accessions flowered and matured earlier than the wild species. The cultivated sesame seeds contained a significantly higher percentage of oleic acid (40.4%) than the seeds of the wild species (26.1%). Nucleotide polymorphisms were identified in the FAD2 gene coding region between wild and cultivated species. Some nucleotide polymorphisms led to amino acid changes, one of which was located in the enzyme active site and may contribute to the altered fatty acid composition. Based on the morphology observation, chemical analysis, and sequence analysis, it was determined that two accessions were misnamed and need to be reclassified. The results obtained from this study are useful for sesame improvement in molecular breeding programs. KEYWORDS: sesame, fatty acid composition, gene for fatty acid desaturase (FAD2), nucleotide diversity

■

INTRODUCTION

Cultivated sesame (Sesame indicum L.) is a diploid species (2n = 2x = 26) with a haploid nuclear genome size of approximately 354 Mb.2,9,10 Sesame belongs to the Pedaliaceae family, which contains about 17 genera and 80 species.11 Some research work has been conducted on interspecies crosses and cytogenetic studies, but the phylogenetic relationship and ploidy level within the genus and family are not well understood or established due to the variable basic chromosome numbers (x = 8 or x = 13).1,2 Seed oil content and fatty acid composition are important parameters for determining the seed quality and oil properties. There is not much research on sesame seed oil content, but there are several reports on genes which directly affect the fatty acid composition. The FAD2 gene for fatty acid desaturase (FAD) is responsible for converting oleic acid (C18:1) to linoleic acid (C18:2) by adding a carbon double bond into the hydrocarbon chain at the Δ12 position. A full length cDNA (AF192486) for sesame fatty acid desaturase (SeFAD2) has been cloned and sequenced12−14 showing a distant phylogenetic relationship with other plant FAD2 families.15 A single copy of FAD2 gene was identified in Arabidopsis;16 but two, three, and four copies of the gene have been identified in soybean, sunflower, and cotton, respectively.17−19 Southern genomic hybridization

Sesame (Sesame indicum L.) is one of the oldest oilseed crops known to humankind with a long history of cultivation for its edible seeds and oil.1 Sesame seeds are nutritious, containing ∼55% oil and ∼20% protein plus some useful phytochemicals (e.g., sesamin, sesamol, and sesamolinol) with high antioxidant activity.2−4 Sesame seeds are used on breads, cakes, candies, and chips and in other foods as ingredients. Sesame oil has a pleasant taste, flavor, and aromatic odor. It is used in cooking, on salads, in sauce additives, and also in medicine (e.g., as a substitute for olive oil in pharmaceuticals) and industry. Consuming sesame products can lower blood serum lipids and enhance antioxidant capacity in hyperlipidemic patients.5 Like resveratrol, sesamol also has antitumor promoting effects and can be potentially used as a cancer chemopreventive agent.6 Sesame is a self-pollinated species but with a low percentage of cross-pollination depending on the cultivation and environmental conditions.7,8 Sesame is mainly cultivated in tropical and subtropical regions. In 2010, sesame was grown worldwide on over 7.8 million hectares with a total global harvest of about 3.84 million metric tons of seeds; and the world trade of sesame seeds was worth over one billion dollars (source from FAO, 2012). Although the average yield of sesame is not very high, it can be cultivated as a cash crop due to its high nutritional value and the medicinal properties of seeds. The demand and world trade of sesame seeds has been increasing rapidly during the last two decades. © 2014 American Chemical Society

Received: Revised: Accepted: Published: 11706

July 29, 2014 November 8, 2014 November 11, 2014 November 11, 2014 dx.doi.org/10.1021/jf503648b | J. Agric. Food Chem. 2014, 62, 11706−11710

Journal of Agricultural and Food Chemistry

Article

Agilent 7890A GC equipped with a flame ionization detector (FID) following a previously described method.21 A fatty acid methyl ester (FAME) standard mix was purchased from Sigma. The relative percentage of each fatty acid was calculated from the corresponding peak area. The O/L ratio was determined by % oleic acid/% linoleic acid. Data on fatty acids were recorded by replicates, accessions, and batches (old or new seeds). An analysis of variance was performed on the data, and means were separated using Tukey’s multiple comparison procedure (SAS, 2008, Online Doc 9.2. Cary, NC: SAS Institute Inc.). Significant correlations between seed traits were determined using Pearson correlation coefficients. Amplification and Sequence of DNA Fragments in the FAD2 Coding Region. Genomic DNA was extracted from fresh leaf tissue using an E.Z.N.A. Plant DNA kit from Omega Bio-Tek (Doraville, GA). All DNA samples were dissolved and diluted in 0.1 × TE (1 mM Tris, 0.1 mM EDTA, pH 8.0) to a final concentration 10 ng/μL for use in PCR. For primer design, the sequence of the FAD2 gene region was downloaded from GenBank (AY770501). Due to nucleotide divergence between cultivated and wild sesame, some specific primers were designed only for wild species (including some degenerate primers) (Table 2). In total, 33 sets of primers were designed and

analysis indicated that there might be more than one copy of SeFAD2 gene in the sesame genome.15 So far, Sesame indicum L. is the only large-scale cultivated species in the genus. For improvement of sesame in breeding programs by introgression of useful traits, e.g., resistance to diseases and pests, tolerance to abiotic and biotic stresses, etc., wild relative species of sesame need to be explored. The sesame germplasm collection in the U.S. is maintained by the USDAARS, PGRCU, in Griffin, Georgia. Fatty acid composition of the entire USDA collection (1232 accessions) has been evaluated, and significant variability was identified within the collection (Wang et al., unpublished results). From this screening, we selected seven accessions (including two wild species) with significant variation in fatty acid composition, and O/L ratio. These accessions were planted for sequencing the FAD2 gene coding region and for chemical analysis of the harvested seeds. To our knowledge, we are not aware of any report on association of FAD2 genotypes with fatty acid profiles in sesame. The objectives of this study were therefore to (1) confirm fatty acid composition and O/L ratio using newly harvested seeds, (2) identify nucleotide diversity in the FAD2 gene coding region, and (3) identify nucleotide polymorphisms possibly contributing to alter the fatty acid profile and O/L ratio.

■

Table 2. Primers Designed for Amplification of FAD2 Coding Region in Cultivated and Wild Species amplified fragment

forward and reverse primers (5′−3′)

cultivated 1

btFAD-5F: TTTTTCGGGTGTTCGTTACC btFAD-5R: GCCACTGGTAATCGCTGAAT btFAD-6F: GCTACCTAGCTTGGCCCATT btFAD-6R: AGAGCTCCCCTTAGCCAGTC btFAD-7F: TGGGGTACCGTTACTCATTG btFAD-7R: AGAATCCGACCAGCACAGAC SeWCodF1: TTGGGAGGTTTTGATTCAG SeWCodR1: GAGGCCAACCRAGAGTAAGA SeWCodF2: CCTTGCTTGTGCCCTATTTC SeWCodR2: CACTAACARAGGAYGCATCTTA

MATERIALS AND METHODS cultivated 2

Plant Materials and Seed Harvest. Information on the seven selected sesame accessions is listed in Table 1. Among these, five were

cultivated 3

Table 1. Information on the Seven Selected Accessions from Seed Quality Analysis PI no.

species

188815

S. indicum L.

224663 278164

490268 599435

S. indicum L. S. radiatum Schum. & Thonn. S. radiatum Schum. & Thonn. S. indicum L. S. indicum L.

599442

S. indicum L.

367899

linoleic acid

O/L ratio

Luzon, Philippines Libya Angola

53.22

0.58

45.78 47.35

0.86 0.78

Tanzania

61.79

0.34

India Texas, United States Texas, United States

54.5 34.99

0.5 1.4

33.49

1.5

collection site

wild 1 wild 2

synthesized by Operon (Qiagen, Germantown, MD, USA, http:// www.operon.com). Different PCR conditions were used based on the amplicon size and annealing temperature for DNA fragment amplification. Identification of Nucleotide Polymorphisms in the Coding Region and Amino Acid Substitution in the Polypeptides. After trimming and editing each DNA sequence, gene coding sequences were aligned with a sesame reference sequence (AY770501) using Sequencher (ver. 4.10.1). Following sequence alignment, nucleotide polymorphisms were identified among accessions. From the deduced amino acid sequence, substitutions were identified in the polypeptides. Evaluation of Selected Accessions. An integrated approach including morphological observation, chemical analysis, and DNA sequence analysis was used for evaluation of the selected accessions. A phylogenetic dendrogram was generated from nucleotide polymorphisms in the coding region using the Arlequin 3.01 program.22 Subsequently, a cladogram was generated from the deduced amino acid sequences along with Glycine and Arachis sequences using the ClustalW2 (http://www.ebi.ac.uk/Tools/msa/clustalw2) program. The selected accessions clustered into different groups. Misnamed accessions were identified and reclassified.

from the cultivated form (S. indicum L.) and two were from the wild form (S. radiatum Schum & Thonn.) based on the passport data (www.ars-grin.gov). One hundred seeds for each accession were acquired from the seed store of USDA-ARS-PGRCU, Griffin, Georgia. Twenty seeds from each accession were planted in large pots (PolyTainer-Can, No. 7s, Nursery Supplies Inc., Orange, CA) containing potting soil (Metromix-360, Griffin House and Nursery Inc., Griffin, GA) on April 30, 2012. Two weeks after germination, seedlings were thinned from 20 to 8. During plant growth, water and fertilizer for each pot were controlled. Seeds were harvested on multiple occasions from newly opened capsules. The capsules were collected into a paper bag and dried for 2 weeks at low humidity. After drying, the seeds were removed from the capsules and cleaned for seed morphology observation and chemical analysis. Morphological Observation and Chemical Analysis. Flowering time, leaf shape, plant stature, and seed morphology were observed, measured, and recorded. All samples were measured in triplicate and results averaged for each accession. Fatty acid methyl esters (FAMEs) were prepared from sesame seeds by alkaline transmethylation.20 Fatty acid composition was determined on an

■

RESULTS AND DISCUSSION Variation on Plant and Seed Morphology. There was significant variation in plant and seed morphology among the seven accessions. Variation in plant and seed morphology is shown in Figure 1. All seven accessions were planted on the same day, April 30, 2012. Four accessions flowered 7 weeks after planting, and PI 278164 flowered a week later. PI 490268 flowered in the middle of August, and PI 367899 eventually

11707

dx.doi.org/10.1021/jf503648b | J. Agric. Food Chem. 2014, 62, 11706−11710

Journal of Agricultural and Food Chemistry

Article

Variation on Fatty Acid Composition. Significant variation in the fatty acid composition was detected between stored (old) seeds and freshly harvested (new) seeds (Table 3). On average, the freshly harvested seeds contained a higher amount of palmitic acid (C16:0) than the stored seeds (9.22% vs 8.87%), whereas the stored seeds contained higher amounts of stearic (C18:0), arachidic (C20:0), gadoleic (C20:1), and lignoceric (24:0) acids than the freshly harvested seeds (5.73% vs 5.26%; 0.69% vs 0.66%; 0.19% vs 0.16%; and 0.10% vs 0.06%). This variability may be due to environmental conditions. No significant variability in the other five traits was detected between the old and new seeds (Table 3). Since the old seeds were collected from different locations and/or years, comparisons among accessions with the old seeds would not be biologically informative. Only data collected on the new seeds grown under the same conditions in 2012 were used for comparison between accessions, and the data on the old seeds were used simply as reference information. There was significant variability in oleic acid (23.85% to 42.92%), linoleic acid (41.67% to 58.63%), and O/L ratio (0.41 to 1.03) (Table 3 and Figure S1 in the Supporting Information). Oleic acid had a significantly negative correlation with linoleic acid (r = −0.99 at p < 0.0001 level). For example, PI 367899 had the highest percentage of linoleic acid (58.63%) and the lowest percentage of oleic acid (23.85%). The ratio of oleic acid and linoleic acid (O/L) can reflect the seed quality and oil properties. Oils with higher oleic acid content generally have a longer shelf life and are healthier for consumption. Among these seven accessions, oil from PI 599442 may have the best quality based on this criterion, containing the lowest percentage of linoleic acid (41.67%) and the highest oleic acid (42.92%). Single Nucleotide Polymorphisms, Deduced Amino Acid Substitutions in the Coding Region, Polypeptides

Figure 1. Plant and seed morphology of the selected sesame accessions. The picture of seed morphology was taken using newly harvested seeds from the plants shown above. The scale bar represents one centimeter.

flowered, but did not produce seeds until the middle of November. This accession was originally collected from Tanzania (Table 1) and may be temperature sensitive (high temperature leading to unsuccessful pollination). PI 224663 produced purple petioles whereas PI 599442 produced curly leaves (Figure 1). By the latter developmental stages, PIs 188815, 367899, and 490268 were taller than 1.2 m with big branches on the main stems. Three accessions (PIs 188815, 367899, and 490268) produced dark, almost black seeds, and the other four accessions produced lighter colored seeds. Table 3. Fatty Acid Composition from Old and New Seedsa C16:0 % C16:1 % C18:0 % C18:1 % C18:2 % C18:3 % C20:0 % C20:1 % C22:0 % C24:0 % O/L ratio

188815b

224663b

278164b

367899b

490268b

599435b

599442b

9.225 9.88 0.115 0.12 5.08 4.905 30.96 30.545 53.22 53.155 0.36 0.365 0.625 0.61 0.175 0.17 0.155 0.145 0.09 0.1 0.58 0.575

8.66 8.82 0.13 0.13 4.71 4.875 39.4 39.22 45.78 45.695 0.34 0.325 0.56 0.545 0.2 0.19 0.14 0.125 0.08 0.075 0.86 0.858

9.27 9.7 0.11 0.1 4.955 4.66 36.91 32.395 47.35 51.605 0.375 0.5 0.605 0.605 0.19 0.19 0.15 0.165 0.09 0.095 0.78 0.629

8.975 8.26 0.14 0.2 5.51 6.57 21.07 23.85 61.79 58.625 1.235 1.27 0.795 0.835 0.15 0.185 0.22 0.22 0.125 0 0.34 0.407

8.875 10.01 0.115 0 7.215 5.99 27.08 28.435 54.5 53.375 0.83 0.97 0.92 0.87 0.17 0 0.22 0.35 0.11 0 0.5 0.533

8.545 8.86 0.1 0.155 6.23 4.795 48.81 39.165 34.99 45.695 0.265 0.345 0.655 0.575 0.21 0.19 0.12 0.135 0.1 0.085 1.4 0.857

8.505 9.03 0.08 0.105 6.4 5.005 50.07 42.915 33.49 41.67 0.37 0.31 0.67 0.56 0.2 0.185 0.125 0.135 0.095 0.08 1.5 1.03

mean 8.865 9.223 0.113 0.116 5.729 5.257 36.33 33.79 47.30 49.97 0.539 0.584 0.690 0.657 0.185 0.159 0.161 0.182 0.099 0.062 0.851 0.698

b a a a a b a a a a a a a b a b a a a b a b

LSDc 0.294 0.072 0.342 3.661 3.621 0.103 0.001 0.008 0.072 0.008 0.136

a

For each trait, the data in the upper and lower rows were from the old and new seeds, respectively. There is a significant difference if the letters (after values) are different in the same column. bPI no. cLeast significant difference. 11708

dx.doi.org/10.1021/jf503648b | J. Agric. Food Chem. 2014, 62, 11706−11710

Journal of Agricultural and Food Chemistry

Article

of the FAD2, and Phylogenetic Relationship among Accessions. The sequences in the coding region (1152 bp) of the SeFAD2 were aligned (Figure S2 in the Supporting Information), and 61 single nucleotide polymorphisms (SNPs) were identified among the seven accessions. The deduced amino acid sequences (383 aa) of SeFAD2 were aligned (Figure S3 in the Supporting Information), and 12 amino acid substitutions were identified. A phylogenetic dendrogram and cladogram were generated using nucleotide sequences and deduced amino acid sequences, respectively (Figures 2a and 2b). There were no DNA polymorphisms

Schum. & Thonn., Cluster II). Most SNPs originated between the wild and cultivated sesame. There was an amino acid substitution at 317 from alanine (A) to threonine (T) between the wild and cultivated sesame which was located in the H Box 3 (in the active site of the fatty acid desaturase). This critical substitution may contribute to the altered fatty acid composition between wild and cultivated sesame. In general, the results from the dendrogram and the cladogram were consistent; and they suggest that two accessions were misnamed in the GRIN database. PI 278164 does not belong to the wild species (S. radiatum Schum. & Thonn.) and should be classified as cultivated sesame (S. indicum L.). PI 490268 does not belong to the cultivated sesame and should be classified with the wild species. Our cladogram analysis also indicated that the sesame FAD2 coding sequence had a higher similarity to the corresponding soybean sequences than to the Arachis sequences. The results from morphological observation, chemical analysis, and FAD2 gene coding sequence were consistent when freshly harvested seeds were analyzed. PI 278164 and PI 490268 were misnamed in the GRIN database. PI 278164 should be classified with the cultivated form (S. indicum L.) instead of the wild form (S. radiatum Schum & Thonn.), whereas PI 490268 should be classified as the wild form instead of the cultivated form. Ultimately, more research is still required to determine to which wild form PI 490268 belongs. The wild accessions PI 367899 and PI 490268 flowered and matured later, and they produced seeds with lower amounts of oleic acid (23.85% and 28.44%) but higher amounts of linoleic acid (58.63% and 53.38%) than the cultivated form. Our results demonstrate how an integrated approach including morphological observation, chemical analysis, and genetic analysis can be used to properly characterize and evaluate plant germplasm accessions. High oleate cultivars have been developed in several major oilseed crops including soybean, canola, sunflower, and peanut;23 but so far none in sesame. A high oleate sesame line (Ant-33 containing 41.4% oleic acid) was identified by screening 103 Turkey cultivated sesame landraces,4 but this is much lower than the high oleate soybean containing over 80% oleic acid.24 This high oleate soybean was developed by crossing two accessions (PI 603452 and PI 283327) which contained spontaneous mutations in FAD2-1A and FAD2-1B, respectively, and then by selection of the mutant alleles using marker-assisted selection (MAS) in breeding programs. Mutagenesis has been explored in sesame. Closed capsule and determinate growth habit mutants have been successfully identified using γ-irradiation, but there was limited enhancement of oleic acid only up to 46%.25 If there are two copies of the FAD2 gene in the sesame genome, the probability of simultaneously mutating both copies in one individual would be very low. Natural genetic variation in the level of oleic acid may exist in the sesame genome. More sesame germplasm accessions need to be screened for identification of new FAD2 mutations. Newly identified accessions encompassing different mutant alleles of FAD2 can be used as breeding materials for further developing high oleate sesame cultivars.

Figure 2. Dendrogram and cladogram from cluster analysis using nucleotide and amino acid sequence data, respectively. (a) Dendrogram was generated using nucleotide sequences from seven sesame accessions and (b) cladogram was generated from amino acid sequences from seven sesame accessions plus one sesame reference and two soybean (Glycine) and six peanut (Arachis) accessions: sesame reference, AAX11454.1; G. max1, BAD89862.1; G. max2, P48631; A. hypogaea1, AAY53559.1; A. hypogaea2, AAB84262.1; A. hypogaea3, AAK67829.1; A. duranensis, AAF82294.1; A. ipaensis, AAF82295.1; and A. monticola, AAX14399.1. Scale bar represents coefficient similarity.

among four accessions (PI 224663, PI 278164, PI 599435, and PI 599442) which were identical to the sesame reference sequence (previously deposited FAD2 coding sequence, AY770501). These four accessions may belong to the cultivated sesame type (S. indicum L., Cluster I). In comparison to these four accessions, PI 188815 had eight SNPs, but only one led to an amino acid substitution (T71A). This accession may still belong to the cultivated type but with significant divergence. Compared to the reference sequence, both PI 367899 and PI 490268 had 46 SNPs resulting in 6 and 8 amino acid substitutions, respectively. These two accessions were closely related and may belong to the wild sesame type (S. radiatum

■

ASSOCIATED CONTENT

S Supporting Information *

Figure S1, comparison of oleic acid (C18:1) and linoleic acid (C18:2) levels among seven accessions. Figure S2, DNA sequence alignment in the FAD2 gene coding region among 11709

dx.doi.org/10.1021/jf503648b | J. Agric. Food Chem. 2014, 62, 11706−11710

Journal of Agricultural and Food Chemistry

Article

temporal expression of a ω-6 fatty acid desaturase cDNA from sesame (Sesamum indicum L.) seeds. Plant Sci. 2001, 161, 935−941. (16) Okuley, J.; Lightner, J.; Feldmann, K.; Yadav, N.; Lark, E.; Browsw, J. Arabidopsis FAD2 gene encodes the enzyme that is essential for polyunsaturated lipid synthesis. Plant Cell 1994, 6, 147−158. (17) Heppard, E. P.; Kinney, A. J.; Stecca, K. L.; Miao, G. H. Developmental and growth temperature regulation of two different microsomal [omega]-6 desaturase genes in soybeans. Plant Physiol. 1996, 110, 311−319. (18) Martínez-Rivas, J. M.; Sperling, P.; Lühs, W.; Heinz, E. Spatial and temporal regulation of three different microsomal oleate desaturase genes (FAD2) from normal type and high-oleic varieties of sunflower (Helianthus annuus L.). Mol. Breed. 2001, 8, 159−168. (19) Liu, Q.; Singh, S. P.; Brubake, C. L.; Sharp, P. J.; Green, A. G.; Marshall, D. R. Molecular cloning and expression on a cDNA encoding a microsomal ω-6 fatty acid desaturase from cotton (Gossypium hirsutum). Funct. Plant Biol. 1999, 26, 101−106. (20) Liu, K. Preparation of fatty acid methyl esters for gas chromatographic analysis of lipids in biological materials. J. Am. Oil Chem. Soc. 1994, 71, 1179−1187. (21) Wang, M. L.; Chen, C. Y.; Tonnis, B.; Barkley, N. A.; Pinnow, D. L.; Pittman, R. N.; Davis, J.; Holbrook, C. C.; Stalker, H. T.; Pederson, G. A. Oil, fatty acid, flavonoid, and resveratrol content variability and FAD2A functional SNP genotypes in the U.S. peanut mini-core collection. J. Agric. Food Chem. 2013, 61, 2875−2882. (22) Excoffier, L.; Laval, G.; Schneider, S. Arlequin ver. 3.0: An integrated software package for population genetics data analysis. Evol. Bioinformatics Online 2005, 1, 47−50. (23) Barkley, N. A.; Wang, M. L. Oleic acid: Natural variation and potential enhancement in oilseed crops. In Oleic acid: Dietary sources, functions and health benefits; Silva, L. P., Ed.; Nova Scientific Publishers, Inc.: 2012; pp 59−72. (24) Pham, A. T.; Lee, J. D.; Shannon, J. G.; Bilyeu, K. D. A novel FAD2-1A allele in a soybean plant introduction offers an alternate means to produce soybean seed oil with 85% oleic acid content. Theor. Appl. Genet. 2011, 123, 793−802. (25) Arslan, Ç .; Uzun, B.; Ü lger, S.; Ç ağirgan, M. I.̇ Determination of oil content and fatty acid composition of sesame mutants suitable for intensive management conditions. J. Am. Oil Chem. Soc. 2007, 84, 917−920.

accessions. Figure S3, amino acid sequence alignment for the FAD2 among accessions. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Authors

*(Z.C.) E-mail: [email protected]. Phone: 770-228-7331. *(M.L.W.) E-mail: [email protected]. Phone: 770-2293342. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS The authors would like to thank Drs. Paul Raymer and Charles Y. Chen for their useful comments and suggestions for improving the quality of this manuscript and Ken Manley for his help in planting sesame seeds.

■

REFERENCES

(1) Nimmakayala, P.; Perumal, R.; Mulpuri, S.; Reddy, U. K. Sesame. In Wild Crop Relatives: Genomic and Breeding Resources, Oilseeds; Kole, C., Ed.; Springer-Verlag: Berlin Heidelberg, 2011; pp 261−273. (2) Nayar, N. M.; Mehra, K. L. Sesame: its uses, botany, cytogenetics, and origin. Econ. Bot. 1970, 24, 20−31. (3) Cheung, S. C. M.; Szeto, Y. T.; Benzie, I. F. F. (2007) Antioxidant protection of edible oils. Plant Foods Hum. Nutr. 2007, 62, 39−42. (4) Uzun, B.; Arslan, Ç .; Furat, Ş. Variation in fatty acid composition, oil content and oil yield in germplasm collection of sesame (Sesamum indicum L.). J. Am. Oil Chem. Soc. 2008, 85, 1135−1142. (5) Chen, P. R.; Chien, K. L.; Su, T. C.; Chang, C. J.; Liu, T. L.; Cheng, H.; Tsai, C. Dietary sesame reduces serum cholesterol and enhances antioxidant capacity in hypercholesterolemia. Nutr. Res. (N.Y.) 2005, 25, 559−567. (6) Kapadia, G. J.; Azuine, M. A.; Tokuda, H.; Takasaki, M.; Mukainaka, T.; Konoshima, T.; Nishino, H. Chemopreventive effect of resveratrol, sesamol, sesame oil and sunflower oil in the epstein-barr virus early antigen activation assay and the mouse skin two-stage carcinogenesis. Pharmacol. Res. 2002, 45, 499−505. (7) Yermanos, D. M. Sesame. In Hybridization of crop plants; Fehr, D. M., Hadley, H. H., Eds.; American Society of Agronomy and Crop Science Society: Madison, WI, 1980; pp 549−563. (8) Morris, J. B. Characterization of sesame (Sesamum indicum L.) germplasm regenerated in Georgia, USA. Genet. Resour. Crop Evol. 2009, 56, 925−936. (9) Morinaga, T.; Fukushima, E.; Kano, T.; Yamasaki, Y. Chromosome numbers of cultivated plants. II. Bot. Mag. 1929, 43, 589−594. (10) Zhang, H.; Miao, H.; Wang, L.; Qu, L.; Liu, H.; Wang, Q.; Yue, M. Genome sequencing of the important oilseed crop Sesamum indicum L. Genome Biol. 2013, 13, 401. (11) Cronquist, A. An integrated system of classification of flowering plants; Columbia University Press: New York, 1981; 1262 pp. (12) Kim, M. J.; Kim, H.; Shin, J. S.; Chung, C. H.; Ohirogge, J. B.; Suh, M. C. Seed specific expression of sesame microsomal oleic acid desaturase is controlled by combinational properties between negative cis-regulatory elements in the SeFAD2 promoter and enhancers in the 5′-UTR intron. Mol. Genet. Genomics 2006, 276, 351−368. (13) Kim, M. J.; Kim, J. K.; Shin, J. S.; Suh, M. C. The SebHLH transcription factor mediates trans-activation of the SeFAD2 gene promoter through binding to E- and G-box elements. Plant Mol. Biol. 2007, 64, 453−466. (14) Kim, M. J.; Go, Y. S.; Lee, S. B.; Kim, Y. S.; Shin, J. S.; Min, M. K.; Hwang, I.; Suh, M. C. Seed-expressed casein kinase I acts as positive regulator of the SeFAD2 promoter via phosphorylation of the SebHLH transcription factor. Plant Mol. Biol. 2010, 73, 425−437. (15) Jin, U. H.; Lee, J. W.; Chung, Y. S.; Lee, J. H.; Yi, Y. B.; Kim, Y. K.; Hyung, N. I.; Pyee, J. H.; Chung, C. H. Characterization and 11710

dx.doi.org/10.1021/jf503648b | J. Agric. Food Chem. 2014, 62, 11706−11710