Article pubs.acs.org/JAFC
Watsonianone A from Rhodomyrtus tomentosa Fruit Attenuates Respiratory-Syncytial-Virus-Induced Inflammation In Vitro Ling Zhuang,† Li-Feng Chen,† Yu-Bo Zhang,† Zhong Liu,‡ Xu-Hui Xiao,‡ Wei Tang,† Guo-Cai Wang,† Wen-Jun Song,‡ Yao-Lan Li,*,† and Man-Mei Li*,† †
Institute of Traditional Chinese Medicine and Natural Products, College of Pharmacy, and ‡Guangdong Provincial Key Laboratory of Bioengineering Medicine, College of Life Science and Technology, Jinan University, Guangzhou, Guangdong 510632, People’s Republic of China S Supporting Information *
ABSTRACT: Respiratory syncytial virus (RSV) is one of the most common respiratory pathogens. Immoderate inflammation plays a great role in causing RSV-induced diseases. In the present study, watsonianone A, isolated from the fruit of Rhodomyrtus tomentosa (Ait.) Hassk, was found to show a good inhibitory effect on RSV-induced NO production, with a half-maximal inhibitory concentration of 37.2 ± 1.6 μM. Enzyme-linked immunosorbent assay and fluorescence quantitative polymerase chain reaction analyses indicated that watsonianone A markedly reduced both mRNA and protein levels of tumor necrosis factor α, interleukin 6, and monocyte chemoattractant protein 1 in RSV-infected RAW264.7 cells. Mechanistically, watsonianone A inhibited nuclear factor κB (NF-κB) activation by suppressing IκBα phosphorylation. Further analysis revealed that watsonianone A activated the thioredoxin system and decreased intracellular reactive oxygen species (ROS) levels, which are closely associated with NF-κB activation in RSV-infected cells. These results reveal that watsonianone A can attenuate RSV-induced inflammation via the suppression of ROS-sensitive inflammatory signaling. KEYWORDS: Rhodomyrtus tomentosa, watsonianone A, respiratory syncytial virus, inflammation, ROS
■
that nuclear factor κB (NF-κB) can be activated during RSV infection and results in the overexpression of various inflammatory and immunomodulatory genes.12 Mitogenactivated protein kinases (MAPKs) can be also activated by many biological factors, including viruses. Following stimulation, several downstream transcriptional factors involved in the regulation of inflammation are activated.13,14 The intracellular reactive oxygen species (ROS) level has been shown to be closely involved in the pathogenesis and deterioration of RSVinduced clinical diseases.15,16 When infected by RSV, epithelial cells release ROS rapidly, causing cellular oxidative damage and, sometimes, inducing lipid peroxidation and lung inflammation.17 The thioredoxin (Trx) system is one of the most important cellular cytoplasmic redox systems and comprises Trx, thioredoxin reductase (TrxR), and nicotinamide adenine dinucleotide phosphate (NADPH).18 Trx acts as a direct scavenger of ROS and possesses anti-inflammatory properties. For these reasons, Trx has been reported to be a potentially good therapeutic target for treating influenza-virus-related acute lung injuries.19 Rhodomyrtus tomentosa (Ait.) Hassk (Figure 1A) belongs to the family Myrtaceae. It is a common bush found in southern China, Vietnam, and Thailand.20 The fruit of R. tomentosa is very popular in these countries and has been reported to be nutritious and low-calorie.20 In Southeast Asia, the fruit of R. tomentosa (called “sim fruit” in Vietnam) is used to make
INTRODUCTION
Respiratory syncytial virus (RSV) is one of leading causes of severe respiratory diseases, such as bronchiolitis and pneumonia in infants and the elderly.1,2 However, no effective vaccine is available for prevention of RSV infection nowadays. 3 Palivizumab, a neutralizing monoclonal antibody, is currently the mainstay prophylactic for infants at high risk of severe RSV infection, but the antibody is ineffective in improving lung histopathology and reducing inflammation.4 Ribavirin is approved for treating RSV infections by the U.S. Food and Drug Administration (FDA), but its routine use in infants and young children is limited because of its variable efficacy and toxicity.5 Developing safer and more effective therapeutic strategies that are not limited to virus-based approaches for treating RSV-induced diseases is desperately needed. Studies have shown that an exaggerated immune response is one of major causes of the RSV-induced diseases.6,7 Macrophages are crucial components of both non-specific and acquired immune responses and can be activated by inflammatory cytokines, bacterial lipopolysaccharides (LPS), and viruses (including RSV), after which they release various other pro-inflammatory cytokines. As a potent biological stimulus of macrophages, RSV can induce the activation of Toll-like receptors and production of inflammatory factors, such as active nitrogen and pro-inflammatory cytokine. These mediators activate the inflammatory cascade, which may lead to organ injuries.8−10 Weakening but not abrogating a virusinduced cytokine storm has been regarded as an effective therapeutic tactic to control the symptoms of RSV infection.11 The production of RSV-induced inflammatory mediators is regulated at several levels. Over the past few years, it is reported © XXXX American Chemical Society
Received: February 4, 2017 Revised: April 17, 2017 Accepted: April 18, 2017
A
DOI: 10.1021/acs.jafc.7b00537 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry
Figure 1. Cytotoxicity and anti-RSV activities of watsonianone A. (A) Fruit of R. tomentosa. (B) Chemical structure of watsonianone A. (C) Effects of watsonianone A on the viability of RAW264.7 cells. (D) Effects of watsonianone A on the viability of HEp-2 cells. (E) Anti-RSV activity of watsonianone A. All data represent the means ± SE of three independent experiments. Differences between watsonianone-A-treated cells and control cells are considered significant when (∗∗∗) p < 0.001.
traditional wine and jam. A fermented drink termed “Ruou sim” is popular in southern and central Vietnam.21 The fruit is also used medicinally to treat diarrhea, dysentery, and traumatic hemorrhage.21 Studies have demonstrated that its extracts possessed antibacterial and antihepatitis activities.22 The methanol extract of R. tomentosa has been reported to inhibit LPS-induced prostaglandin E2 (PGE2) and nitric oxide (NO) production in macrophages.23 However, the anti-inflammatory components of R. tomentosa are not yet clear. In the present study, watsonianone A (Figure 1B) was isolated from the fruit of R. tomentosa, and we found that this compound possessed a good inhibitory effect against RSV-induced inflammation. Possible molecular mechanisms of action in RSV-infected RAW264.7 cells were also investigated.
■
phosphatase inhibitor were supplied by Roche (Basel, Switzerland). Bicinchoninic acid (BCA) protein assay kits were supplied by Pierce Biotechnology (Rockford, IL, U.S.A.). Griess reagents, phenylmethanesulfonyl fluoride (PMSF), radioimmunoprecipitation assay (RIPA) buffer, nuclear and cytoplasmic extraction kits, RNase, dihydroethidium (DHE), and 2′,7′-dichlorofluorescin diacetate (DCFH-DA) were obtained from Beyotime Biotechnology (Shanghai, China). HySOX was purchased from Bioluminor (Xiamen, China). Intracellular hydrogen peroxide detection kits were supplied by BioVision (Milpitas, CA, U.S.A.). Enzyme-linked immunosorbent assay (ELISA) kits were obtained from Multi Sciences Biotechnology (Hangzhou, China). Inducible NO synthase (iNOS) antibody, cyclooxygenase-2 (COX-2) antibody, NF-κB pathway antibody sampler kit, MAPK antibody, anti-β-actin monoclonal antibody, and horseradish peroxidase (HRP)-conjugated secondary antibodies were supplied by Cell Signaling Technology (Danvers, MA, U.S.A.). Lamin B antibody, TrxR antibody, and Trx antibody were supplied by Santa Cruz Biotechnology (Dallas, TX, U.S.A.). Alexa Fluor R 488 antirabbit fluorescent secondary antibodies and Alexa Fluor R 568 phalloidin were supplied by Life Technologies (Carlsbad, CA, U.S.A.). Virus and Cell Cultures. HEp-2 cells and human RSV A2 strain were obtained from the Medicinal Virology Institute of Wuhan University, Wuhan, Hubei, China. RAW264.7 macrophages were purchased from American Type Culture Collection (ATCC, Manassas, VA, U.S.A.). HEp-2 and RAW264.7 cells were cultured in DMEM containing 10% FBS and 1% penicillin and streptomycin solution. The culture medium was designated as growth medium. RSV A2 strain was
MATERIALS AND METHODS
Chemicals. Watsonianone A (purity of >97%; Figure 1B) was isolated and purified in our laboratory from the fruit of R. tomentosa, and the chemical structure was identified using spectroscopic data (see the Supporting Information). Watsonianone A was dissolved in dimethyl sulfoxide (DMSO) at 50 mM. Fetal bovine serum (FBS) and Dulbecco’s modified Eagle’s medium (DMEM) were supplied by Invitrogen (Carlsbad, CA, U.S.A.). 3-(4,5-Dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide (MTT) and N-acetyl-L-cysteine (NAC) were supplied by Sigma-Aldrich (St. Louis, MO, U.S.A.). Protease and B
DOI: 10.1021/acs.jafc.7b00537 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry Table 1. Primers Used in FQ-PCR gene
forward primer (5′ → 3′)
reverse primer (5′ → 3′)
TNF-α IL-6 MCP-1 iNOS COX-2 GAPDH
AGCCCACGTCGTAGCAAACCACCAA TAGTCCTTCCTACCCCAATTTCC TCTGCCCTAAGGTCTTCAGCA GGAGTGACGGCAAACATGACT TTCAACACACTCTATCACTGGC AGGTCGGTGTGAACGGATTTG
AACACCCATTCCCTTCACAGAGCAAT TTGGTCCTTAGCCACTCCTTC GCATCACAGTCCGAGTCACACTA TCGATGCACAACTGGGTGAAC AGAAGCGTTTGCGGTACTCAT TGTAGACCATGTAGTTGAGGTCA
propagated in HEp-2 cells.24 HEp-2 cells inoculated with RSV were cultured in DMEM containing 2% FBS. All cells and virus were grown at 37 °C. A plaque reduction assay was used to determine the virus titers. The virus solutions were stored at −80 °C.25 MTT Assay. The MTT assay was used to evaluate the cytotoxicity of watsonianone A on RAW264.7 and HEp-2 cells. RAW264.7 and HEp-2 cells were seeded in 96-well plates. After 24 h of cultivation, cells were treated with watsonianone A at varying concentrations for another 24 and 48 h. Next, MTT solution was added to each well. The cells were incubated for another 4 h, and then the MTT solution was replaced with DMSO. Absorbance was detected at 570 nm using an enzyme immunoassay (EIA) reader (Thermo Fisher Scientific, Waltham, MA, U.S.A.). Anti-virus Assay. A plaque reduction assay was adopted to evaluate the anti-RSV activity of watsonianone A in vitro. HEp-2 cells were seeded in 24-well plates and cultured overnight. A total of 60−80 plaque-forming units (PFUs) of RSV and culture medium with a 2fold serial dilution of watsonianone A were added to corresponding wells. After the cells were incubated for 2 h at 37 °C with intermittent shaking, an agarose overlay medium (0.5 mL/well) and DMEM containing different concentrations of watsonianone A were added. The cells were incubated for 4 days before being fixed by 10% formalin. The cells were then stained with 1% crystal violet. The plaques were then counted. Determination of NO Production. The production of NO was assessed by the Griess assay.26 RAW264.7 cells were seeded in 96-well plates and cultured overnight. Watsonianone A or NAC was added to the cells 2 h prior to RSV infection [multiplicity of infection (MOI) = 1]. After RSV infection for 24 h, 50 μL of culture supernatant was collected and mixed with the same volume of Griess reagent at 25 °C. The absorbance was detected at 540 nm in an EIA reader within 10 min. The NO concentration was quantitatively determined from a NO standard reference curve. ROS Production Assay. Intracellular productions of total ROS, hypochlorous acid (HOCl), superoxide radicals (O2− •), and hydrogen peroxide (H2O2) were analyzed using flow cytometry. Briefly, RAW264.7 cells were seeded in 6-well plates for 24 h. Watsonianone A was added to the cells 2 h prior to RSV infection. After RSV infection for 12 h, cells were treated with 10 μM DCFH-DA for 15 min to detect total ROS, 10 μM DHE for 30 min to detect O2− •, 20 μM HySOX for 1 h to detect HOCl, and 20 μM H2O2 staining dye for 2 h to detect H2O2. Following incubation, the cells were washed and then fixed by formalin. After being fixed, cell samples were resuspended in DMEM without FBS. Fluorescence density was measured by flow cytometry. Fluorescence Quantitative Polymerase Chain Reaction (FQPCR). RAW264.7 cells were seeded in 6-well plates and cultured overnight. Watsonianone A was added to cells 2 h prior to RSV infection (MOI = 1). The cells were collected 10 h after infection, and then RNA was extracted. Following this, RNA reverse transcription was performed using a PrimeScript reverse transcription (RT) reagent kit. The specific primers for tumor necrosis factor α (TNF-α), interleukin 6 (IL-6), monocyte chemoattractant protein 1 (MCP-1), COX-2, iNOS, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were designed on the basis of known sequences using the Primer Premier software (PREMIER Biosoft International, Palo Alto, CA, U.S.A.). The reaction parameters were as follows: 95 °C for the first 5 min, followed by 40 cycles at 95 °C for 10 s, 60 °C for 10 s, and 72 °C for the last 10 s. The expression levels of each gene were
normalized using GAPDH as an internal control. Relative quantitation of gene expression was performed using a Light Cycler 480 (Roche, Pleasanton, CA, U.S.A.) system. The primers for the FQ-PCR are shown in Table 1. Determination of TNF-α, IL-6, MCP-1, and PGE2 Secretion in RAW264.7 Cell Culture Supernatants. To evaluate the effect of watsonianone A on inflammatory responses in RSV-infected cells, the concentrations of TNF-α, IL-6, MCP-1, and PGE2 in the RAW264.7 cell culture supernatant were measured using ELISA kits. RAW264.7 cells were seeded in 6-well plates and cultured overnight. The next day, the cells were pretreated with watsonianone A 2 h prior to RSV infection (MOI = 1). After cells were inoculated with RSV for 12 h, supernatants were collected and inflammatory mediators were assayed according to the instructions of the manufacturers. Western Blot Analysis. RAW264.7 cells were pretreated with watsonianone A 2 h prior to RSV infection (MOI = 1) for 30 min (for MAPKs and NF-κB) or 12 h (for COX-2, iNOS, Trx, and TrxR). Cells were collected and suspended in ice-cold RIPA buffer for 30 min. The samples were centrifuged at 12000g at 4 °C for 15 min, and the supernatant was collected. Nuclear and cytoplasmic extraction kits were used to extract nuclear and cytoplasmic proteins. The protein samples were separated by sodium dodecyl sulfate−polyacrylamide gel electrophoresis (SDS−PAGE) and then transferred to polyvinylidene fluoride (PVDF) membranes. After being blocked, the PVDF membranes were then successively incubated with primary antibodies and HRP-conjugated secondary antibodies. The target proteins were detected by a western blot detection kit (Invitrogen, Carlsbad, CA, U.S.A.). The interest proteins were normalized by β-actin or lamin B. Densitometry of the proteins was analyzed using ImageJ [National Institutes of Health (NIH), Bethesda, MD, U.S.A.]. Immunocytochemical Analysis. RAW264.7 cells were pretreated with watsonianone A 2 h prior to RSV infection (MOI = 1). At 30 min after infection, cells were collected by centrifugation and then fixed with formalin solution for 10 min at 25 °C. Following this, fixed cells were washed with phosphate-buffered saline (PBS) 3 times and permeabilized using PBS containing 0.2% Triton X-100 at 25 °C for 1 h. After rinsing with PBS and blocking with 5% BSA for 30 min, cells were successively incubated with a primary antibody and anti-rabbit fluorescent secondary antibody. Next, the cells were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) and phalloidin. Following this, cells were transferred to a confocal dish and observed under Zeiss LSM 700. Statistical Analysis. Data are expressed as the means ± standard error (SE). One-way analysis of variance (ANOVA) and Tukey’s posthoc test were performed using GraphPad Prism 5.0 (GraphPad, La Jolla, CA, U.S.A.). A p value of
