Wheat-Specific Gene, Ribosomal Protein L21, Used as the

Article pubs.acs.org/JAFC

Wheat-Specific Gene, Ribosomal Protein L21, Used as the Endogenous Reference Gene for Qualitative and Real-Time Quantitative Polymerase Chain Reaction Detection of Transgenes Yi-Ke Liu,†,‡ He-Ping Li,*,†,‡ Tao Huang,†,‡ Wei Cheng,†,§ Chun-Sheng Gao,†,§ Dong-Yun Zuo,†,‡ Zheng-Xi Zhao,†,§ and Yu-Cai Liao*,†,§,∥ †

Molecular Biotechnology Laboratory of Triticeae Crops, ‡College of Life Science and Technology, §College of Plant Science and Technology, and ∥National Center of Plant Gene Research (Wuhan), Huazhong Agricultural University, Wuhan, Hubei 430070, People’s Republic of China S Supporting Information *

ABSTRACT: Wheat-specific ribosomal protein L21 (RPL21) is an endogenous reference gene suitable for genetically modified (GM) wheat identification. This taxon-specific RPL21 sequence displayed high homogeneity in different wheat varieties. Southern blots revealed 1 or 3 copies, and sequence analyses showed one amplicon in common wheat. Combined analyses with sequences from common wheat (AABBDD) and three diploid ancestral species, Triticum urartu (AA), Aegilops speltoides (BB), and Aegilops tauschii (DD), demonstrated the presence of this amplicon in the AA genome. Using conventional qualitative polymerase chain reaction (PCR), the limit of detection was 2 copies of wheat haploid genome per reaction. In the quantitative real-time PCR assay, limits of detection and quantification were about 2 and 8 haploid genome copies, respectively, the latter of which is 2.5−4-fold lower than other reported wheat endogenous reference genes. Construct-specific PCR assays were developed using RPL21 as an endogenous reference gene, and as little as 0.5% of GM wheat contents containing Arabidopsis NPR1 were properly quantified. KEYWORDS: Triticum aestivum, ribosomal protein L21, endogenous reference gene, genetically modified organisms, real-time PCR

■

INTRODUCTION In the past 2 decades, more than 140 genetically modified (GM) plant events have been approved for commercialization worldwide. The acreage of GM crop production increased 100fold, from 1.7 million ha in 1996 to 170.3 million ha in 2012, accounting for more than 12% of the world’s arable land, mainly with cotton, soybean, potato, and papaya.1 In 1996, the first GM maize producing a Bt Cry protein, which killed the European corn borer and related species, was approved; subsequently, different Bt genes were introduced that killed corn rootworm larvae.2 In August 2009, China’s Ministry of Agriculture issued safety certificates to two transgenic varieties of rice, Bt-Shanyou63 and Bt-Minghui63,3 allowing for the two varieties to be planted on small-scale trails in Hubei province in China. The commercialization of GM staple food crops has become the general trend. However, to protect consumers’ rights to obtain relevant information, labeling regulations for GM contents of food crops have been established in more than 50 countries and regions;4 the content thresholds requiring a GM label are 0.9% in the European Union, 3% in Korea, 5% in Japan, and 0.01% in China.5−8 Real-time polymerase chain reaction (PCR) is widely used for the detection and quantification of specific nucleic acid sequences.9 Techniques based on this methodology have been widely applied for the detection and quantification of GM contents.10 With amplification of both a specific GM target sequence and a taxon-specific target sequence, researchers can estimate the relative ratio of GM materials in a given matrix. To develop such an assay, a prerequisite is to develop an © 2014 American Chemical Society

endogenous reference gene system for specific detection and quantification of the DNA of a given taxon. A plant endogenous reference gene must be taxon-specific, present at a low copy number (preferably a single copy), and exhibit low heterogeneity among varieties.11 To date, endogenous reference genes of many crops have been reported, including Gos 9 and SPS in rice,12−14 LAT52 in tomoto,15 BnACCg8 in rapeseed,16 Chy in papaya,4,17 γ-hordein and PKABA1 in barley,12,18 lectin and bactin in soybean,19 Lhcb2 in peach,20 and Ivr1, zein, adh1, and hmg in maize.21 Common wheat (Triticum aestivum L.) is a major crop and an important source of protein, vitamins, and minerals in the world, accounting for 20% of the calories consumed by humans.22 Although no commercial GM wheat is currently grown anywhere in the world, there is an increasing interest in this alternative, and many agricultural biotech companies, including Monsanto, Syngenta, and Bayer Crop Science, are working on the improvement of drought, yield, and phosphorus absorption in wheat.23 Four endogenous reference genes, ACC1, PKABA1, ALMT1, and Waxy-D1, as well as their corresponding real-time PCR assays have been reported for GM wheat detection and quantification.12,18,24,25 They were comprehensively evaluated for target gene sequence variation and real-time PCR performance among 37 common wheat Received: Revised: Accepted: Published: 10405

July 30, 2014 October 5, 2014 October 7, 2014 October 7, 2014 dx.doi.org/10.1021/jf503559b | J. Agric. Food Chem. 2014, 62, 10405−10413

Journal of Agricultural and Food Chemistry

Article

Table 1. Sequences of Primers and Probes Used in This Study primer name

primer sequence (5′−3′)

amplicon (bp)

RPL21-1F RPL21-1R RPL21-P RPL21-2F RPL21-2R RPL21-KpnI RPL21-SacI NPR1-1F NPR1-1R NPR1-P

CCTAGCCCGTTTCATCTAATGTGTCCTA TACTACCAACGAGAACCATTAGAGAGC TGGATGCATTTCATGGCTCATCTTTGT TCCGCAAGAAGGGGTACAT GAAGAGTTCATCACAGGCACAC GGGGTACCGGTATGCCGCACAAGTT TCCGAGCTCACTCCTCGTTGCACCTGGAT GAGAAGACGACACTGCTGAGAAACGACTACA GTTGATTTCGATGTGGAAGAAGTCGAATCT AAGAAGGCCTTTAGTGAGGACAATTTGGA

161

taxon-specific detection

441

probe for southern blotting

1242 148

purpose

sequencing detection of GM wheat

Figure 1. Homology analyses of the wheat RPL21 gene and its sequence and positions for annealing by primers. (A) BLAST analysis of wheat RPL21 based on the nucleotide collection database. (B) Primers and their annealing positions are indicated by underlines and labels.

lines, and the Waxy-D1 gene assay was validated to be useful in establishing qualitative and quantitative PCR analyses of GM wheat.26 However, some Chinese wheat landraces were null Waxy-D1 mutants.27,28 Moreover, none of these endogenous reference genes was verified for detecting GM wheat contents with GM wheat materials. In the present work, we investigated whether the wheat ribosomal protein L21 (RPL21) gene encoding 60S ribosomal

protein L21 was a good candidate to serve as a wheat endogenous reference gene for a GM wheat assay. RPL21 was found by searching database sequences. We designed speciesspecific primers based on this gene and developed conventional and quantitative real-time PCR systems. Furthermore, we developed the construct-specific real-time PCR method using NPR1 GM wheat, and seven mixed NPR1 GM wheat samples 10406

dx.doi.org/10.1021/jf503559b | J. Agric. Food Chem. 2014, 62, 10405−10413


Article

Co., Ltd., Shanghai, China). The sequences obtained were aligned using DNAMAN software (Lynnon Biosoft, Quebec, Canada). Conventional PCR Conditions. Conventional PCR assays were carried out in a 25 μL final volume on a thermal cycling instrument (MyCycler, Bio-Rad, Hercules, CA). Each reaction mixture contained the following reagents: 10× EasyTaq buffer (TransGen Biotech, Beijing, China), 2 units of EasyTaq polymerase (TransGen), 120 μM dNTPs (TaKaRa), 1 μL of template (about 50 ng), 0.5 μM of each primer, and double-distilled water (ddH2O). Conventional PCR programs were as follows: 5 min of predenaturation at 94 °C, followed by 35 cycles of 30 s at 94 °C, 30 s at 60 °C, and 30 s at 72 °C, and a final extension of 10 min at 72 °C. The PCR-amplified products were analyzed by 1% (w/v) agarose electrophoresis in 0.5× TBE with ethidium bromide staining. As for PCRs used to test the limit of detection (LOD), wheat genomic DNA was serially diluted to 6250, 1250, 250, 50, 10, 2, and 1 initial template copies of the haploid genome based on the DNA content of 17.3 pg/haploid genome in common wheat;24 these dilutions were used in PCRs with the primer pair RPL21-1F/1R under the conditions described above. Quantitative Real-Time PCR. Quantitative real-time PCR reactions were performed in a 20 μL final volume containing 50 ng of sample DNA, 10 μL of FastStart Universal Probe Master (Roche Applied Science, Indianapolis, IN), 0.5 μM each of the forward and reverse primers, and 0.2 μM FAM/TAMRA-labeled oligonucleotide probe. Real-time PCR reactions were run on a Roche LightCycler 480 (Roche, Mannheim, Germany) using the following program: 95 °C for 10 min, 40 cycles of denaturation at 95 °C for 20 s each, followed by annealing at 60 °C for 40 s. For the generation of standard curves of the two genes RPL21 and NPR1, extracted genomic DNA from GM wheat line R4 was diluted 5-fold to final copy numbers of 5000, 1000, 200, 40, and 8 per reaction. All of the quantitative PCRs were repeated 3 times, each with three replicates. The resulting data were analyzed, and standard curves were constructed with the LightCycler 480 software release 1.5.0 (Roche).

of known content were also quantitatively analyzed using the developed real-time PCR method.

■

MATERIALS AND METHODS

Plant Materials. A total of 17 plant species were used for the specificity test of the designated primers: barley (Hordeum vulgare L.), maize (Zea mays L.), rye (Secale cereale L.), tomato (Lycopersicon esculentum Mill.), common bean (Phaseolus vulgaris L.), rapeseed (Brassica napus L.), Chinese cabbage (Brassica campestris L. ssp. pekinensis), cotton (Gossypium hirsutum L.), soybean (Glycine max L. Merr.), mung bean (Phaseolus vulgaris L.), Arabidopsis [Arabidopsis thaliana (L.) Heynh.], cucumber (Cucumis sativus L.), sweet potato [Ipomoea batatas (L.) Lam.], pea (Pisum sativum L.), rice (Oryza sativa L.), sunflower (Helianthus annuus L.), and sorghum (Sorghum bicolor L. Moench). All samples were obtained from local stores. A total of 18 common wheat (AABBDD) varieties from different ecological regions in China, including hard winter wheat, hard spring wheat, soft winter wheat, and soft spring wheat, were stored in our laboratory or kindly provided by Professor Jun Yin from Henan Agricultural University (Zhengzhou, Henan, China). Triticum urartu (AA), Aegilops speltoides (BB), and Aegilops tauschii (DD) were kindly provided by Professor Jizeng Jia from the Institute of Crop Science, the Chinese Academy of Agriculture Sciences, China. The NPR1 (nonexpressor of PR genes) GM wheat line R4 was developed in our laboratory.29 DNA Extraction. Total genomic DNA from seedlings of the 17 plant species, 18 common wheat varieties, 3 diploid wheat species, and dry flour of common wheat was extracted using the cetyltrimethylammonium bromide (CTAB) protocol.30 The concentration and quality of the purified DNA samples were measured and evaluated using a Shimadzu UV-1800 spectrophotometer (Shimadzu Corporation, Kyoto, Japan), and the DNA quality was further checked by 1% (w/v) agarose gel electrophoresis in 0.5× TBE with ethidium bromide staining. Oligonucleotide Primers and Probes. Oligonucleotide primers and probes used in this study were designed with Primer Premier 5 (PREMIER Biosoft, Palo Alto, CA) and are listed in Table 1. Primers RPL21-1F/1R, RPL21-2F/2R, and RPL21-KpnI/SacI were designed on the basis of the wheat RPL21 gene sequence (GenBank HM138481.1). The annealing sites of these primers are shown in Figure 1. The primer pair NPR1-1F/1R was designed according to the sequence of the A. thaliana NPR1 gene (GenBank NM_105102.2), which was integrated into an elite wheat cultivar Yangmai11.29 The TaqMan probes were labeled on the 5′ end with the 6carboxyfluorescein (FAM) reporter dye, and 6-carboxytetramethylrhodamine (TAMRA) quencher dye was attached to the 3′ end. All of the primers and probes were synthesized by Sangon (Shanghai, China). The probe for southern blot was a fragment derived from 74 to 514 of the wheat RPL21 sequence (Figure 1B) amplified with primer pair PRPL21-2F/2R (Table 1) using a Takara random primer DNA labeling kit, version 2 (TaKaRa, Dalian, China). Southern Blot Analysis. Aliquots of 15 μg of DNA from young leaves of common wheat culture Yangmai11 were digested with 60 units of restriction enzymes HindIII and NdeI (TaKaRa) overnight and electrophoresed on 0.8% agarose gels. DNA fragments were transferred onto a nylon membrane (Hybond-N+, Amersham, Buckinghamshire, U.K.) and hybridized with an α-[32P]-dCTP-labeled DNA fragment derived from the RPL21 sequence amplified with primer pair RPL21-2F/2R (Figure 1). Autoradiography was conducted using a Fujifilm imaging plate and cassette, which was analyzed with a Fuji BAS1800-II system (Fujifilm, Tokyo, Japan). Sequencing Analysis of the RPL21 Gene. The specific DNA fragments were amplified with the primer pair RPL21-KpnI/SacI from the common wheat variety Yangmai11 and three diploid ancestral species, T. urartu (AA), A. speltoides (BB), and A. tauschii (DD), employing the KOD Plus DNA polymerase PCR kit (TaKaRa). The amplified DNA fragments were cloned into pBluescript SK(−) vector and analyzed with the ABI Prism 3730 genetic analyzer (Invitrogen

■

RESULTS AND DISCUSSION

Selection of Wheat Endogenous Reference Gene. The application of an endogenous reference gene makes the detection of plant species more practical and precise. Reference genes must be species-specific and have a low and consistent copy number in different varieties of the same species.11 To choose a suitable reference gene in common wheat, large amounts of gene information were collected from GenBank and several candidates were evaluated. After BLAST and homology analyses, the 60S ribosomal protein L21 (RPL21) in the common wheat genome (accession number HM138481.1) was found to have low homology with the sequences from other non-wheat species. The homologue in Arabidopsis to this chloroplast ribosomal protein L21 is required for chloroplast development and embryogenesis,31 whereas the exact biological function of the RPL21 gene in wheat is not yet known. Sequence alignment analyses indicated that a region of the wheat RPL21 sequence from 257 to 1322 nucleotides displayed no homology with other known sequences in the database (Figure 1A). Subsequently, primers specific to this region were designed, and a specificity analysis for each primer was performed by a BLAST search for each primer against several public and genetically modified organism (GMO) DNA sequence databases, such as NCBI. Any primer showing homology with non-relevant DNA sequences was discarded. Finally, we designed the primer pair RPL21-1F/1R, which spanned a sequence of 161 base pairs (bp) within the region of 257−1322 nucleotides and was wheat-specific (Table 1 and Figure 1B). The specificity of the primers was further tested in both qualitative and quantitative assays. 10407



Article

Figure 2. Agarose gel electrophoresis of conventional PCR products amplified with the RPL21-1F/1R primer pair. (A) PCR-amplified products with DNA from wheat and other plant species: (1) no DNA template control, (2) common wheat, (3) barley, (4) maize, (5) rye, (6) tomato, (7) bean, (8) rapeseed, (9) Chinese cabbage, (10) cotton, (11) soybean, (12) mung bean, (13) Arabidopsis, (14) cucumber, (15) sweet potato, (16) pea, (17) rice, (18) sunflower, (19) sorghum and (M) 100 bp ladder size standard. (B) PCR-amplified products with DNA from (2−19) 18 different varieties of common wheat, (1) no DNA template control, and (M) 100 bp ladder size marker. (C) PCR-amplified products with serial dilutions of common wheat DNA: (1) no DNA template control, (2) 6250 copies, (3) 1250 copies, (4) 250 copies, (5) 50 copies, (6) 10 copies, (7) 2 copies, (8) 1 copy, and (M) 100 bp ladder size standard.

Specificity, Allelic Stability, and Sensitivity of RPL21 Systems in Conventional Qualitative PCR. To assess the specificity of the RPL21 gene-based PCR system using the primer pair RPL21-1F/1R, qualitative PCRs were performed using 50 ng of genomic DNA extracted from 17 plant species that are either closely related to common wheat or frequently consumed plant materials. A single 161 bp DNA fragment was amplified only from wheat, whereas no product was amplified from any of the other 16 plant species (Figure 2A), demonstrating that the RPL21 gene is wheat-specific. To examine whether an allelic variation of the RPL21 gene is present in wheat, genomic DNA isolated from 18 common wheat varieties collected from different ecological regions in China was tested by PCR with the primer pair RPL21-1F/1R. As shown in Figure 2B, all of the varieties contained one DNA fragment of identical size (161 bp) and similar intensity, indicating the presence of the same amplicon in those wheat genotypes. Thus, the RPL21 fragment has no allelic variation among the wheat varieties. To further evaluate the sensitivity of the primer pair, known amounts of wheat genomic DNA isolated from Yangmai11 were assayed by conventional PCR. A series of wheat genomic DNA dilutions containing approximately 6250, 1250, 250, 50, 10, 2, and 1 initial template copies of the haploid genome was used in PCRs with the primer pair RPL21-1F/1R to test its LOD. The expected 161 bp amplicon was obtained in all of the dilutions, except for the level of 1 copy and water (Figure 2C), indicating that the LOD of the primer pair RPL21-1F/1R was

as low as about 2 copies of common wheat haploid genome. This level of sensitivity was similar to that of a wheat ALMT1 system (2.3 copies) and better than that of Waxy-D1 system (7 copies).24,25 Copy and Amplicon Number of the Wheat RPL21 Gene. The copy number of an endogenous reference gene is critical for GMO quantification. Targeting a gene sequence with a single or stably low copy number should result in stable real-time PCR assays.25 To estimate the copy number of the RPL21 gene in the common wheat genome, we designed another primer pair RPL21-2F/2R to amplify a 441 bp DNA fragment used as a probe for southern blot analysis. Wheat genomic DNA from Yangmai11 digested with HindIII and NdeI was hybridized with the 441 bp DNA fragment derived from the RPL21 gene (Figure 1B), revealing three hybridizing bands in both enzyme-digested DNA samples (Figure 3). Among the three bands, one had stronger signal intensity than the other two bands, which had similar intensities in both digests. These results suggest that the stronger band was the sequence from the AA genome nearly identical (about 98% identity) to the probe, whereas the weak bands were the sequences from the BB and DD genomes, respectively, which have low similarity to the probe (see Figure S1 of the Supporting Information). Therefore, the RPL21 gene may have 3 copies or 1 copy in the common wheat genome. In the Waxy-D system, two hybridizing bands were detected in southern blots, suggesting the presence of 1 or 2 copies,25 whereas the copy numbers of 10408



Article

1R generated only one amplicon from the A genome of common wheat. Quantitative Assay Based on LOD and Limit of Quantification (LOQ). When quantifying a nucleotide sequence by real-time PCR, LOD and LOQ are the most important parameters, referring to the lowest quantity of target that can be reliably detected and quantified with a probability of ≥95%.34,35 The absolute limit is the lowest number of initial template copies that can be detected and quantified. To determine LOD and LOQ of the established method based on the primer pair RPL21-1F/1R by real-time PCR, six serial dilutions of common wheat DNA containing approximately 5000, 1000, 200, 40, 8, and 1.6 haploid genomes were prepared and tested in seven replicates per dilution. As shown in Table 2, Table 2. Amplification Data Used To Determine the Absolute LOD and LOQ

Figure 3. Estimation of the copy number of a wheat RPL21 gene as illustrated by genomic southern blot of common wheat (Yangmai11) genomic DNA digested with HindIII and NdeI, separately, and hybridized to a 441 bp probe of the RPL21 gene amplified with primer pair RPL21-2F/2R.

other endogenous reference genes from wheat have not been confirmed.12,18,24 Common wheat is a hexaploid species with the genome constitution of AABBDD originating from three diploid ancestral species: T. urartu (AA), A. speltoides (BB), and A. tauschii (DD).32 Allopolyploidization leads to the generation of duplicated homeologous genes (homeologs). Therefore, most genes in hexaploid wheat are present as triplicate homeologs.33 To obtain information on the amplicon number generated by the primer pair RPL21-1F/1R from ancestral wheat species, the primer pair RPL21-KpnI/SacI was used to amplify fragments (about 1242 bp) from T. urartu, A. speltoides, and A. tauschii. The alignment of the four amplified sequences (see Figure S1 of the Supporting Information) showed that the annealing sites of the primer pair RPL21-1F/1R were only present in the A genome but not in the B or D genomes, thus generating only one amplicon in common wheat (Figure 4). Conventional PCRs with the primer pair RPL21-1F/1R confirmed that one expected 161 bp DNA fragment was amplified from T. urartu (AA) and common wheat (AABBDD), but no amplicon was obtained from A. speltoides (BB) or A. tauschii (DD) (data not shown). Thus, the RPL21 gene was apparently evolutionarily derived from diploid T. urartu, and the primer pair RPL21-1F/

estimated template copies

signal rate (number of positive signals)

mean Cp values

SD

RSD (%)

5000 1000 200 40 8 1.6 0

7/7 7/7 7/7 7/7 7/7 4/7 0/7

24.27 26.68 28.89 31.12 33.45 35.81 >45

0.14 0.14 0.16 0.25 0.37 ND ND

0.57 0.53 0.56 0.83 1.12 ND ND

the ability to detect RPL21 decreased with the reduction of genomic DNA copy number, and 1.6 copies of wheat genomic DNA were detected 3 times in the seven replicates, indicating that the LOD value was about 2 copies. This value is in accordance with that determined by the conventional PCRs. A LOD of 2 haploid genome copies was reported for the wheat Waxy-D1, acc1, and ALMT1 systems,12,24,25 and a LOD of 5 genome copies was reported for the PKABA1 system.18 The LOQ values were calculated on the basis of the crossing point (Cp) values and confidence intervals.12 The results showed that approximately 8 initial template copies were required to obtain reliable quantification results with 95% confidence under ideal conditions (Table 2), indicating that the LOQ of the RPL21-1F/1R-based real-time PCR assay was about 8 copies of haploid genome.36,37 This value is 2.5−4-fold lower than that of the ALMT1 (20 copies) and acc1 (30 copies) systems, respectively.12,24 No such information is available for the Waxy-D and PKABA1 systems. Construct-Specific Qualitative PCR Detection of NPR1 in Transgenic Wheat. To validate the applicability and sensitivity of the developed RPL21 system with transgenic

Figure 4. Sequence alignment of a portion of the wheat RPL21 gene containing the region amplified with the primer pair RPL21-1F/1R with DNA from T. aestivum (AABBDD, GenBank accession number HM138481.1), T. urartu (AA), A. speltoides (BB), and A. tauschii (DD). The sequences in the red boxes were the region annealed with the primer pair RPL21-1F/1R. 10409



Article

standard curves were 0.993 and 0.997, respectively (Figure 6), indicating a good linearity for both assays. On the basis of the equation E = 10−(1/slope) − 1, the PCR efficiency can be calculated and the ideal slope should be −3.32 for 100% PCR efficiency.38 Slopes in the range from −3.1 to −3.6 are acceptable, indicating PCR efficiency from 90 to 110%. The two efficiencies were 101.3% for endogenous RLP21 and 97.4% for NPR1 in the standard dilutions, indicating that the PCR efficiencies were acceptable. The acceptable PCR reaction efficiencies and the good linearity between the logarithm of initial DNA quantities and Cp indicated that the established real-time PCR systems of RLP21 and NPR1 are suitable for quantitative analysis. Quantification of the Samples with Known Transgenic Wheat Content. Seven samples with 0.5, 1, 2, 5, 20, 50, or 100% of GM wheat contents were prepared by mixing pure dried wheat flour of transgenic line R4 with non-GM dried wheat flour on a w/w basis, from which DNA was extracted. An aliquot of 50 ng of DNA from each sample was used as a template in each reaction, and GM contents were calculated on the basis of the standard curves using the relative quantification method. The quantitative results of these seven samples were 0.45, 0.85, 1.90, 4.56, 17.37, 48.17, and 108.26%, respectively (Table 3). The quantified biases (mean tested value versus true value) of tested samples ranged from 4.88 to 15.22%, and the relative standard deviation (RSD) values ranged from 5.19 to 10.63%. All variations from the samples were below 25%, the accepted level for GMO quantification.38 These findings suggest that the RPL21 gene can be used as the wheat endogenous reference gene for quantifying GM wheat food contents, and the established construct-specific PCR systems are suitable for the quantification of practical samples derived from NPR1 transgenic wheat. A previous study used a PKABA1-based system to test 10 samples of food and feed and showed that 8 of the analyzed samples presumably contained wheat contents, and on the basis of that, the authors stated that PKABA1 could be used for the detection of GM wheat.18 However, no previous study has quantified genuine GM wheat contents using an endogenous reference gene system. The RPL21 system developed in this study can quantify GM wheat contents as little as 0.5%, satisfying the labeling regulations in the European Union and many other countries.5−7 To our knowledge, this is the first study to detect the contents of GM wheat using a reference gene system with quantitative real-time PCR. In conclusion, the wheat RPL21 gene used as an endogenous reference gene was validated for GM wheat detection and quantification with qualitative and real-time quantitative PCR assays. Southern blot with common wheat DNA and sequence analyses of common wheat together with its three diploid ancestral species congruently indicated that the primer pair RPL21-1F/1R had only one amplicon in common wheat. The LOD of conventional PCR was 2 copies of wheat haploid genome. The LOD and LOQ of real-time PCR were 2 and 8 copies of wheat haploid genome, respectively. Furthermore, two standard curves of RPL21 and NPR1 were established using NPR1 transgenic wheat, and seven mixed samples with known content of NPR1 GM wheat were relatively accurately quantified using the established real-time PCR method. All of these results demonstrate that the RPL21 gene is a suitable endogenous reference gene for GM wheat detection, and the developed RPL21 system will facilitate the enforcement of GMO labeling for wheat in the near future.

wheat materials, we selected a stably transgenic wheat line R4 that contained a NPR1 gene from A. thaliana.29 To detect the content of NPR1 in wheat line R4 through quantitative realtime PCR, the sensitivity and specificity of the constructspecific sequence of NPR1 were first evaluated using qualitative PCR. The construct-specific primer pair NPR1-1F/1R (Table 1) was designed on the basis of the NPR1 sequence to establish the construct-specific conventional PCR assay. As shown in Figure 5A, a 148 bp DNA fragment was amplified only from

Figure 5. Agarose gel electrophoresis of conventional PCR products with the primer pair NPR1-1F/1R. (A) PCR-amplified products from NPR1 transgenic wheat line R4 and some non-GM wheat varieties: (1) no DNA template control, (2) transgenic wheat line R4, (3) Yangmai11, (4) Zhenmai9023, (5) Yangmai158, and (M) 100 bp ladder size standard. (B) PCR-amplified products with DNA from a non-GM wheat mixed with serial dilutions with GM wheat line R4: (1) no DNA template control, (2) 0%, (3) 0.2%, (4) 1%, (5) 0.5%, (6) 2.0%, (7) 5.0%, and (M) 100 bp ladder size standard.

NPR1 transgenic wheat and not from other non-GM wheat varieties and no template control, indicating a high specificity of this primer pair. To test the LOD of the established construct-specific PCR assay, pure dried wheat flour from transgenic line R4 was mixed at proportions of 0, 0.2, 0.5, 1.0, 2.0, and 5.0% with flour from non-transgenic wheat variety Yangmai11 and subjected to DNA isolation and PCR analyses. In conventional PCR assays, an aliquot of 50 ng of genomic DNA was used as the template per reaction. The results showed that the expected 148 bp target DNA fragment of NPR1 gene was generated from all levels of transgenic wheat flour, except for 0% and no template control, indicating that the LOD of the conventional PCR assay is at least 0.2%. This level corresponds to about 6 copies of wheat haploid genome (AABBDD = 6; Figure 5B), confirming that the construct-specific PCR assay is highly specific and sensitive for practical detection of NPR1 transgenic wheat samples. Establishment of Standard Curves. To establish a method to estimate the contents of transgenic wheat, two standard curves (one for endogenous gene RPL21 and the other for transgenic gene NPR1) through five 5-fold serial dilutions (corresponding to 5000, 1000, 200, 40, and 8 copies of the wheat haploid genome per reaction) were performed in transgenic wheat line R4, in which an A. thaliana NPR1 gene was integrated into wheat variety Yangmai11.29 The calculated Cp values were plotted versus the log copies of total DNA of each starting quantity. The correlation coefficients (R2) of the 10410



Article

Figure 6. Real-time PCR assay of the logarithmic plots resulting from the amplification of five 5-fold serial dilutions (corresponding to 5000, 1000, 200, 40, and 8 copies of the wheat haploid genome per reaction) of DNA from GM wheat line R4 and its relative standard curve obtained with the crossing point (Cp) value versus the log of each initial total DNA for (A) RPL21 gene and (B) NPR1 gene.

Table 3. Quantification of NPR1 Transgenic Wheat Content in Seven Mixed Samples construct amounts × 100/endogenous amounts

■

accuracy

mean 1

mean 2

mean 3

mean (%)

bias (%)

SD

RSD (%)

0.50 1.0 2.0 5.0 20 50 100

0.49 0.80 1.74 4.57 16.85 41.67 100.59

0.46 0.86 1.99 5.20 15.35 48.56 103.69

0.40 0.88 1.97 3.92 19.90 54.28 120.49

0.45 0.85 1.90 4.56 17.37 48.17 108.26

10.19 15.22 4.88 8.77 13.15 3.66 8.26

0.00043 0.00042 0.0014 0.0064 0.023 0.063 0.11

8.76 5.19 8.14 13.99 13.76 15.16 10.64

ASSOCIATED CONTENT

Funding

* Supporting Information

This work was supported by the Ministry of Agriculture of

S

Sequence alignment of the RPL21 gene from T. aestivum (AABBDD, accession number HM138481.1), T. urartu (AA), A. speltoides (BB), and A. tauschii (DD), with the latter three amplified by the primer pair RPL21-KpnI/SacI (Figure S1). This material is available free of charge via the Internet at http://pubs.acs.org.

■

precision

true value (%)

China (2011ZX08002-001 and 2014ZX0800202B-001) and the National Natural Science Foundation of China (31271717). Notes

The authors declare no competing financial interest.

■

AUTHOR INFORMATION

ACKNOWLEDGMENTS

The authors thank Prof. Jizeng Jia for diploid wheat materials,

Corresponding Authors

Prof. Jun Yin for common wheat materials, and Mr. Hong-Jie

*E-mail: [email protected]. *E-mail: [email protected].

Du for assistance of PCR. 10411



■

Article

(18) Rønning, S.; Berdal, K.; Andersen, C.; Holst-Jensen, A. Novel reference gene, PKABA1, used in a duplex real-time polymerase chain reaction for detection and quantitation of wheat- and barley-derived DNA. J. Agric. Food Chem. 2006, 54, 682−687. (19) James, D.; Schmidt, A.; Wall, E.; Green, M.; Masri, S. Reliable detection and identification of genetically modified maize, soybean, and canola by multiplex PCR analysis. J. Agric. Food Chem. 2003, 51, 5829−5834. (20) Shang, Y.; Zhu, P.; Huang, K.; Liu, W.; Tian, W.; Luo, Y.; Xu, W. A peach (Prunus persica)-specific gene, Lhcb2, used as an endogenous reference gene for qualitative and real-time quantitative PCR to detect fruit products. LWTFood Sci. Technol. 2014, 55, 218−223. (21) Hernández, M.; Duplan, M.; Berthier, G.; Vaïtilingom, M.; Hauser, W.; Freyer, R.; Pla, M.; Bertheau, Y. Development and comparison of four real-time polymerase chain reaction systems for specific detection and quantification of Zea mays L. J. Agric. Food Chem. 2004, 52, 4632−4637. (22) Brenchley, R.; Spannagl, M.; Pfeifer, M.; Barker, G.; D’Amore, R.; Allen, A.; McKenzie, N.; Kramer, M.; Kerhornou, A.; Bolser, D.; Kay, S.; Waite, D.; Trick, M.; Bancroft, I.; Gu, Y.; Huo, N.; Luo, M.; Sehgal, S.; Gill, B.; Kianian, S.; Anderson, O.; Kersey, P.; Dvorak, J.; McCombie, W.; Hall, A.; Mayer, K.; Edwards, K.; Bevan, M.; Hall, N. Analysis of the bread wheat genome using whole-genome shotgun sequencing. Nature 2012, 491, 705−710. (23) Xia, L.; Ma, Y.; He, Y.; Jones, H. GM wheat development in China: Current status and challenges to commercialization. J. Exp. Bot. 2012, 63, 1785−1790. (24) Vautrin, S.; Zhang, D. Real-time polymerase chain reaction assay for endogenous reference gene for specific detection and quantification of common wheat-derived DNA (Triticum aestivum L.). J. AOAC Int. 2007, 90, 794−801. (25) Iida, M.; Yamashiro, S.; Yamakawa, H.; Hayakawa, K.; Kuribara, H.; Kodama, T.; Furui, S.; Akiyams, H.; Maitani, T.; Hino, A. Development of taxon-specific sequences of common wheat for the detection of genetically modified wheat. J. Agric. Food Chem. 2005, 53, 6294−6300. (26) Huang, H.; Cheng, F.; Wang, R.; Zhang, D.; Yang, L. Evaluation of four endogenous reference genes and their real-time PCR assays for common wheat quantification in GMOs detection. PloS One 2013, 8, No. e75850. (27) Du, X.; Hao, C.; Zhang, X.; Ma, Z.; You, G.; Wang, L.; Dong, Y. Genetic diversity of Waxy gene in Chinese wheat landraces. Acta Agron. Sin. 2007, 33, 503−506. (28) Yamamori, M.; Nakamura, T.; Endo, T. R.; Nagamine, T. Waxy protein deficiency and chromosomal location of coding genes in common wheat. Theor. Appl. Genet. 1994, 89, 179−184. (29) Gao, C.; Kou, X.; Li, H.; Zhang, J.; Saad, A.; Liao, Y. Inverse effects of Arabidopsis NPR1 gene on fusarium seedling blight and fusarium head blight in transgenic wheat. Plant Pathol. 2013, 62, 383− 392. (30) Li, H.; Zhang, J.; Shi, R.; Huang, T.; Fischer, R.; Liao, Y. Engineering fusarium head blight resistance in wheat by expression of a fusion protein containing a Fusarium-specific antibody and an antifungal peptide. Mol. Plant-Microbe Interact. 2008, 21, 1242−1248. (31) Yin, T.; Pan, G.; Liu, H.; Wu, J.; Li, Y.; Zhao, Z.; Fu, T.; Zhou, Y. The chloroplast ribosomal protein L21 gene is essential for plastid development and embryogenesis in Arabidopsis. Planta 2012, 235, 907−921. (32) Feldman, M.; Levy, A. Allopolyploidy: A shaping force in the evolution of wheat genomes. Cytogenet. Genome Res. 2005, 109, 250− 258. (33) Hu, Z.; Han, Z.; Song, N.; Chai, L.; Yao, Y.; Peng, H.; Ni, Z.; Sun, Q. Epigenetic modification contributes to the expression divergence of three TaEXPA1 homeologs in hexaploid wheat (Triticum aestivum). New Phytol. 2013, 197, 1344−1352. (34) Berdal, K.; Holst-Jensen, A. Roundup ready soybean event specific real-time quantitative PCR assay and estimation of the

ABBREVIATIONS USED PCR, polymerase chain reaction; GMO, genetically modified organism; GM, genetically modified; LOD, limit of detection; LOQ, limit of quantification; FAM, 6-carboxyfluorescein; TAMRA, 6-carboxytetramethylrhodamine; CTAB, cetyltrimethylammonium bromide; Cp, crossing point; SD, standard deviation; RSD, relative standard deviation

■

REFERENCES

(1) James, C. Global Status of Commercialized Biotech/GM Crops: 2012; International Service for the Acquisition of Agri-biotech Applications: Ithaca, NY, 2013; Brief 44. (2) Hellmich, R.; Hellmich, K. Use and impact of Bt maize. Nat. Educ. Knowl. 2012, 3, 4. (3) Lu, C. The first approved transgenic rice in China. GM Crops 2010, 1, 113−115. (4) Wei, J.; Li, F.; Guo, J.; Li, X.; Xu, J.; Wu, G.; Zhang, D.; Yang, L. Collaborative ring trial of the papaya endogenous reference gene and its polymerase chain reaction assays for genetically modified organism analysis. J. Agric. Food Chem. 2013, 61, 11363−11370. (5) European Communities (EC).. European Commission Regulation (EC) 1829/2003 and 1830/2003. Off. J. Eur. Communities: Legis. 2003, 268, 1−28. (6) Ministry of Agriculture and Forestry of Korea. Notification 200031; Ministry of Agriculture and Forestry of Korea: Seoul, South Korea, 2000. (7) Food and Marketing Bureau, Ministry of Agriculture, Forestry, and Fisheries. Notification 1775; Food and Marketing Bureau, Ministry of Agriculture, Forestry, and Fisheries: Tokyo, Japan, 2000. (8) Ministry of Agriculture of the People’s Republic of China. Order 10; Ministry of Agriculture of the People’s Republic of China: Beijing, China, 2002. (9) Valasek, M.; Repa, J. The power of real-time PCR. Adv. Physiol. Educ. 2005, 29, 151−159. (10) Zhang, D.; Guo, J. The development and standardization of testing methods for genetically modified organisms and their derived products. J. Integr. Plant Biol. 2011, 53, 539−551. (11) Chaouachi, M.; El Malki, R.; Berard, A.; Romaniuk, M.; Laval, V.; Brunel, D.; Bertheau, Y. Development of a real-time PCR method for the differential detection and quantification of four Solanaceae in GMO analysis: potato (Solanum tuberosum), tomato (Solanum lycopersicum), eggplant (Solanum melongena), and pepper (Capsicum annuum). J. Agric. Food Chem. 2008, 56, 1818−1828. (12) Hernández, M.; Esteve, T.; Pla, M. Real-time polymerase chain reaction based assays for quantitative detection of barley, rice, sunflower, and wheat. J. Agric. Food Chem. 2005, 53, 7003−7009. (13) Ding, J.; Jia, J.; Yang, L.; Wen, H.; Zhang, C.; Liu, W.; Zhang, D. Validation of a rice specific gene, sucrose phosphate synthase, used as the endogenous reference gene for qualitative and real-time quantitative PCR detection of transgenes. J. Agric. Food Chem. 2004, 52, 3372− 3377. (14) Jiang, L.; Yang, L.; Zhang, H.; Guo, J.; Mazzara, M.; Van den Eede, G.; Zhang, D. International collaborative study of the endogenous reference gene, sucrose phosphate synthase (SPS), used for qualitative and quantitative analysis of genetically modified rice. J. Agric. Food Chem. 2009, 57, 3525−3532. (15) Yang, L.; Zhang, H.; Guo, J.; Pan, L.; Zhang, D. International collaborative study of the endogenous reference gene LAT52 used for qualitative and quantitative analyses of genetically modified tomato. J. Agric. Food Chem. 2008, 56, 3438−3443. (16) Hernández, M.; Río, A.; Esteve, T.; Prat, S.; Pla, M. A rapeseedspecific gene, acetyl-CoA carboxylase, can be used as a reference for qualitative and real-time quantitative PCR detection of transgenes from mixed food samples. J. Agric. Food Chem. 2001, 49, 3622−3627. (17) Guo, J.; Yang, L.; Liu, X.; Zhang, H.; Qian, B.; Zhang, D. Applicability of the chymopapain gene used as endogenous reference gene for transgenic Huanong No. 1 papaya detection. J. Agric. Food Chem. 2009, 57, 6502−6509. 10412



Article

practical detection and quantification limits in GMO analyses. Eur. Food Res. Technol. 2001, 213, 432−438. (35) Bonfini, L.; Heinze, P.; Kay, S.; Van den Eede, G. Review of GMO Detection and Quantification Techniques; Institute for Health and Consumer Protection, Food Products and Consumer Goods Unit: Ispra, Italy, 2002. (36) Jiang, L.; Yang, L.; Rao, J.; Guo, J.; Wang, S.; Liu, J.; Lee, S.; Zhang, D. Development and in-house validation of the event-specific qualitative and quantitative PCR detection methods for genetically modified cotton MON15985. J. Sci. Food Agric. 2010, 90, 402−408. (37) Yang, L.; Xu, S.; Pan, A.; Yin, C.; Zhang, K.; Wang, Z.; Zhou, Z.; Zhang, D. Event specific qualitative and quantitative polymerase chain reaction detection of genetically modified MON863 maize based on the 5′-transgene integration sequence. J. Agric. Food Chem. 2005, 53, 9312−9318. (38) Ginzinger, D. Gene quantification using real-time quantitative PCR: An emerging technology hits the mainstream. Exp. Hematol. 2002, 30, 503−512.

10413


Wheat-Specific Gene, Ribosomal Protein L21, Used as the

Recommend Documents