Xylose by Engineered

Subscriber access provided by Fudan University

Article

Co-fermentation of cellulose and sucrose/xylose by engineered yeasts for bioethanol production Yun-Jie Li, Yang-Yang Lu, Zi-Jian Zhang, Sen Mei, Tianwei Tan, and Li-Hai Fan Energy Fuels, Just Accepted Manuscript • DOI: 10.1021/acs.energyfuels.7b00032 • Publication Date (Web): 14 Mar 2017 Downloaded from http://pubs.acs.org on March 19, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Energy & Fuels is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Energy & Fuels

Co-fermentation of cellulose and sucrose/xylose by engineered yeasts for bioethanol production Yun-Jie Li1,2,3, Yang-Yang Lu1,2,3, Zi-Jian Zhang1,2,3, Sen Mei1,2,3, Tian-Wei Tan1,2,3, Li-Hai Fan1,2,3*

1

College of Life Science and Technology, Beijing University of Chemical Technology,

Beijing, People’s Republic of China. 2

National Energy R&D Center for Biorefinery, Beijing, People’s Republic of China.

3

Beijing Key Laboratory of Bioprocess, Beijing, People’s Republic of China.

*

Corresponding author

Abstract Consolidated bioprocessing (CBP) of cellulose mixed with fermentable sugar(s) is considered as a promising alternative to the use of cellulose as sole substrate for bioethanol production. Our research metabolically engineered Saccharomyces cerevisiae to allow for the co-conversion of cellulose and either sucrose or xylose to bioethanol. Constitutive promoter substitution and xylose metabolic pathway integration were carried out in a strain previously modified to express both bifunctional minicellulosomes by galactose induction and a cellodextrin pathway. 1

ACS Paragon Plus Environment

Energy & Fuels

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 36

Strain EBY101-CC, engineered for the co-fermentation of cellulose and sucrose, produced 4.3 g/L ethanol from 10 g/L carboxymethyl cellulose (CMC) and batch fed sucrose with an ethanol yield of 0.43 g/g of total sugars. Strains modified for co-fermentation of xylose and cellulose, EBY101-X5CC and EBY101-X5CP were able to produce 2.9 g/L cellulosic ethanol from 10 g/L CMC and 1.2 g/L from 10 g/L phosphoric acid-swollen cellulose (PASC) respectively when xylose was depleted. Keywords Cellulose, sucrose, xylose, bioethanol, Saccharomyces cerevisiae

1．．Introduction Production of bioethanol from lignocellulosic biomass has great potential to improve the supply of liquid fuels because of large-scale availability and sustainability of the raw materials.1-3 However, cellulose, the major component of lignocelluloses, cannot be degraded to fermentable sugars by Saccharomyces cerevisiae which is widely used in the bioethanol industry.4-5 We recently described a bifunctional minicellulosomes and cellodextrin metabolic pathway-based strategy for direct co-fermentation of cellulose and galactose with a limited inoculation.6 The cellulose-utilization systems from cellulosomal bacterium and cellulolytic fungus were engineered together into non-cellulolytic S. cerevisiae. The resulted yeasts succeeded in simultaneously fermenting cellulose and galactose with a high specific ethanol productivity, which can possibly also be applied in full utilization of marine biomass feedstocks.7-9 2


Page 3 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Energy & Fuels

In contrast with galactose, bio-conversion of sucrose or xylose to ethanol is more economically viable. Sucrose obtained from sugarcane has been used for production of bioethanol for several decades.10-11 The wild-type S. cerevisiae transports sucrose by sucrose transporters (SUTs), and then breaks down the disaccharide to glucose and fructose in the cytoplasm by invertases (SUCs) before further utilization.11 As the second major component in lignocellulosic biomass, xylose enters the yeast cells via hextose transporters (HXTs), but it cannot be metabolized by S. cerevisiae unless a heterogenous xylose metabolic pathway is engineered.12 Till now, many efforts have been devoted to improve the yeast fermentation of sucrose or xylose,13-15 but few researchers have so far succeeded in simultaneous utilization of these sugars together with cellulose. The major bottleneck that limits yeast co-fermentation of cellulose and sucrose/xylose is the so-called carbon catabolite repression,16-17 which is provoked by the extracellular glucose released from cellulose. In our previous study, minicellulosomes with endoglucanases (EGs) and exoglucanases (CBHs) were surface displayed on S. cerevisiae, and the resulting yeast was capable of extracellularly degrading cellulose to cellodextrins.6 Cellodextrins were then taken up through a CDT-1 transporter, cloned from Neurospora crassa18, and then digested into glucose by intracellular β-glucosidase (GH1-1). This unique cellulose-utilization system was found to bypass the glucose repression for simultaneously fermenting galactose and cellulose. However, in this system, biosynthesis of the cellulosomal units was under control of the galactose-inducible promoters (GAL1 and GAL10), so it still cannot be directly 3


Energy & Fuels

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 36

used for co-fermentation of cellulose and sucrose/xylose. Therefore, in the present study, we replaced the galactose-inducible promoters with yeast constitutive promoters for assembling the bifunctional minicellulosomes. The ability to co-ferment soluble carboxymethyl cellulose (CMC) and sucrose as shown in Fig. 1 was confirmed with the resulting S. cerevisiae. Moreover, we further introduced an efficient xylose metabolic pathway into the obtained yeast (Fig. 1) and finally succeeded in co-conversion of xylose and CMC or insoluble phosphoric acid-swollen cellulose (PASC) to bioethanol.

2. Materials and methods 2.1. Strains, plasmids and media E. coli Trans10 (TransGen Biotech, Beijing) was used for genetic manipulation. The plasmids and yeast strains used in this work were summarized in Table 1. Miniscaffoldin II length (CohII) and cellulases (EGs and CBHs) of cellulosomes have been optimized and selected for degradation of CMC and PASC.6 Combination of CohII = 4, engy (EG) from Clostridium cellulovorans and cbhb (CBH) from Aspergillus

niger

(pYD1-GAL10p-ScaI-GAL1p-ScaII-4

and

pRS425-cdt-1-gh1-1-engy-cbhb) was the most suitable for CMC degradation, while combination of CohII = 4, celcca from

C.

acetobutylicum

(EG) from C. cellulolyticum and CA_C0911 (CBH)

(pYD1-GAL10p-ScaI-GAL1p-ScaII-4

and

pRS425-

cdt-1-gh1-1-celcca-CA_C0911) was for PASC degradation. Expression and display of 4


Page 5 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Energy & Fuels

the miniscaffoldins I and II were regulated by the GAL1 and GAL10 promoters, and expression of EGs, CBHs, CDT-1 and GH1-1 were under the control of constitutive promoters (PGK1p, TEF1p, HXT7p, and TEF2p). The genes CDT-1 and GH1-1 were condon-optimized.6 5-FOA (5-Fluoroorotic acid) medium contains 0.67 % (wt/wt) YNB (yeast nitrogen base with ammonium sulfate and without amino acids), 0.1 % 5-FOA, 0.01% tryptophan, 0.01% uracil, 0.02% leucine and 2% glucose. YPD medium contains 1% yeast extract, 2% peptone and 2% glucose. YPG medium contains 1% yeast extract, 2% peptone and 2% galactose. Synthetic complete (SC) minimal medium contains 0.67% YNB, 2% glucose, and 0.005% (leucine and tryptophan). SC-Trp-Leu medium contains 0.67% YNB, 2% glucose, 0.01% (adenine, arginine, cysteine, lysine, threonine), 0.005% (aspartic acid, histidine, isoleucine, methionine, phenylalanine, proline, serine, tyrosine, valine) without leucine and tryptophan. YP medium contains 1% yeast extract, 2% peptone and 10 mM CaCl2. 2.2. Replacement of galactose-inducible promoters The AGA1 cassette under the control of the GAL1 promoter was previously integrated in ura3 locus of EBY100 with URA3 as the selection marker. We knocked it out by 5-FOA medium to produce EBY99. Furthermore, an AGA1 expression cassette under the control of the PGK1 promoter was constructed as shown in Table S1. The AGA1 gene was amplified from EBY100 genome using primers AGA1(PUC19)-F and -R (Table S2). Then it was digested and ligated into pUC19-PGK1p-αFactor-CYC1t. The 5


Energy & Fuels

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 36

AGA1 expression cassette was amplified from pUC19-PGK1p-AGA1-CYC1t using primers AGA1(YIplac211)-F and -R (Table S2), and the obtained fragment was then digested and ligated into YIplac211 (Takara Bio, Dalian). The linearized YIplac211-PGK1p-AGA1-CYC1t by SpeI was into EBY99 with lithium acetate method for cassette integration in genome (Fig. S1). The transformant was selected using SC minimal medium and the resulted yeast was named EBY101. The GAL10 promoter for Miniscaffoldin I and the GAL1 promoter for miniscaffoldin II in pYD16 were replaced with the constitutive PGK1 and TEF2 promoters respectively (Fig. S1). The PGK1 and TEF2 promoters were cloned from EBY100 genome using primers PGK1-F, PGK1-R and TEF2-F, TEF2-R, respectively (Table

S3).

The

PYD1

fragment

was

amplified

using

pYD1-GAL10p-ScaI-GAL1p-ScaII-4 as a template and pYD1-F, pYD1-R as primers (Table S3). The obtained fragments were assembled with One Step Cloning Kit (Vazyme Biotech, China) to form pYD1-PGK1p-ScaI-TEF2p-ScaII-4 (Table 1), which was then sequenced in Sangon Biotech (Beijing). 2.3. Construction of the xylose pathway and integration of expression cassettes The genes of XYL1 coding for xylose reductase (XR) and XYL2 coding for Xylitol dehydrogenase (XDH) from Scheffersomyces stipitis CBS6054 (Laboratory-stored), and XKS1 coding for xylulokinase (XK) from S.cerevisiae YS58 (laboratory-stored) were amplified by using the corresponding primers in Table S3. They were inserted between promoters and terminators individually in the recombinant pUC19 as shown 6


Page 7 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Energy & Fuels

in Table S1. The mutant XYL1 (A826C, G827A, A828C) (mXYL1) coding for XR with the point mutant of R276H (mXR) was amplified from pUC19-TEF2p-XYL1-TPI1t using the primers of R276H-F and R276H-R (Table S3), and then inserted into the recombinant pUC19 (Table S1). The genes of lpmo coding for lytic polysaccharide monooxygenase (LPMO) and cdh coding for cellobiose dehydrogenase (CDH) were condon-optimized and synthesized by Sangon Biotech (Beijing). The optimized lpmo and

cdh

were

ligated

into

PUC19-TEF1p-αFactor-PGIt

and

PUC19-TEF2p-αFactor-TPIt (Table S1). The gene cassettes were sequentially integrated to EBY101 through pAUR135 (Takara Bio, Dalian).19-20 Taking integration of mXYL1 expression cassette in YPRC_15 locus of EBY101 genome for example, homologous arms and mXR cassette were PCR amplified from EBY100 genome and pUC19-TEF1p-mXYL1-PGIt using the primers 20-up-F/R, 20-down-F/R, and mXYL1-F/R, respectively (Table S2). These three fragments were overlapped by PCR and the resulted fragment was then ligated into pAUR135. The obtained pAUR135-20-up-mXYL1-20-down was linearized by SpeI and then transformed into EBY101. The mXYL1expression cassette was integrated into YPRC_15 loci of the EBY101 genome. The transformants were selected through YPD medium with 4 µg/mL aureobasidin A. The antibiotic marker was knocked out using YPG plates. 20 2.4. Fermentation The recombinant yeasts were pre-cultured in SC-Trp-Leu medium. After washing 7


Energy & Fuels

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 36

with distilled water, cells were then inoculated into 20 mL YP medium with 2% fermentable sugars (galactose, sucrose or xylose) and 1% cellulose (PASC or CMC) in 50 mL flasks. PASC was prepared from Avicel as descript previously.21 All fermentation experiments were carried out at 30°C and 200 rpm under oxygen-limited conditions. The initial cell density was adjusted to an OD600 (optical density at 600 nm) of ~0.1. 2.5. Analysis methods Cell growth was monitored using UV-visible Spectrophotometer SU-2000 (OnLab, China). Sucrose was hydrolyzed by 1.2 M HCl to the reducing sugar and determined using 3,5-Dinitrosalicylic acid (DNS) method.22 Cellulose (CMC and PASC) was determined by anthone-H2SO4 method.23 Galactose, xylose and ethanol were monitored with high performance liquid chromatography (Agilent Technologies1200 Series, USA) equipped with a refractive index detector (Shimadzu, Japan) and an Aminex HPX-87H organic acid analysis column (7.8 × 300 mm) (Bio-Rad Laboratories, USA) which was maintained at 50°C and used 0.05 mM sulfuric acids as mobile phase. The sample injection volume was 10 µL and the flow rate was 0.6 mL/min.

8


Page 9 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Energy & Fuels

3. Results 3.1. Self-assembly of minicellulosomes under control of constitutive promoters Three galactose-inducible promoters controlling the minicellulosome biosynthesis (pYD1-GAL10p-ScaI-GAL1p-ScaII-4 and GAL1p-AGA1 in EBY100 genome) have to be replaced with yeast constitutive promoters for co-fermentation of cellulose and sucrose/xylose. The system employed for displaying of minicellulosomes uses the a-agglutinin receptor of S. cerevisiae EBY100. The a-agglutinin receptor consists of two subunits encoded by the AGA1 and AGA2 genes. The AGA1 cassette was integrated in the EBY100 genome and its transcription was under control of the GAL1 promoter which was replaced with the PGK1 promoter to produce EBY101 in this work. Expression of the miniscaffoldins I and II of minicellulosome was originally regulated by the GAL1 and GAL10 promoters through a pYD1-based plasmid, but here we substituted another PGK1 promoter for this GAL1 and the TEF2 promoter for GAL10 respectively (pYD1-PGK1p-ScaI-TEF2p-ScaII-4). We compared the fermentation performances of the reported EBY100-IC (galactose-inducible cellulosome expression) and the newly engineered EBY101-CC (constitutive cellulosome expression) with 20 g/L galactose and 10 g/L CMC. As illustrated in Fig. 2, both yeasts showed the ability to simultaneously utilize galactose and CMC, although use of the constitutive promoters (PGK1p, TEF2p) instead of the galactose-inducible promoters (GAL1p, GAL10p) might lead to a slight decrease on cellulose degradation rate and ethanol productivity. However, it is interesting that the 9


Energy & Fuels

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 36

final cellulosic ethanol level obtained by EBY101-CC was 1.2-fold that of EBY100-IC, and the ethanol yield increased from 0.32 g ethanol/g sugars to 0.37 g ethanol/g sugars (Table 2) by promoter substitutions. 3.2. Co-conversion of sucrose and CMC to bioethanol EBY101-CC was further applied for co-fermentation of sucrose and CMC. The sugar consumptions and the strain growth profiles during fermentation were determined. As shown in Fig. 3a, sucrose was rapidly depleted within 24 h, while CMC was only consumed 15% even after 72 h. The yeast density was observed to slightly decrease after 48h, indicating that the fermentable sugars released from CMC were unable to fully support the cell growth. On the other hand, it has been found that the produced ethanol might be reutilized by S. cerevisiae as a carbon source if the fermentable sugars in the medium are not adequate, which might explain the lower ethanol yield of EBY101-CC here than in the case of co-fermenting galactose and CMC (Table 2). Compared with the consumption profile of galactose in Fig. 2b, we suspected that insufficient supply of sucrose might be the major problem that limited the full utilization of cellulose. Therefore, batch feeding of sucrose (0, 24, 48, 72h) was carried out during the co-fermentation process. The results (Fig. 3b) showed that CMC started to sharply decrease after 48 h and was depleted within 96 h, which was better than the results of CMC and galactose shown in Fig. 2b. The total ethanol level with batch feeding of sucrose reached 38.7 g/L, of which cellulosic ethanol accounted for 4.3 g/L, and the corresponding ethanol yield was 0.43 g ethanol/g sugars (Table 2). 10


Page 11 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Energy & Fuels

3.3. Co-conversion of xylose and CMC/PASC to bioethanol Although S. cerevisiae is not able to grow on xylose, it can metabolize xylulose using the pentose phosphate pathway.12 Metabolic engineering has been used to develop the xylose-utilizing S. cerevisiae strains by introduction of XYL1 coding for XR and XYL2 coding for XDH from S. stipitis to convert xylose to xylulose.13,14,24 However, XR prefers NADPH to NADH, while XDH uses only NAD+, leading to a redox imbalance that is thought to cause xylitol accumulation and slow rate of xylose utilization.25 This problem can be overcome by replacing the wild-type XR with a mutant XR (R276H).25 In addition, either over-expression of XKS1 coding for endogenous XK or introduction of XYL3 coding for S. stipitis XK in S. cerevisiae was found to significantly improve the xylose fermentation.26,27 Therefore, in this work, the cassettes for expression of the mutant S. stipitis XR (R276H), S. stipitis XDH and endogenous XK were sequentially integrated into YPRC_15, YIRC_6 and YMRW_15 loci of the EBY101 genome to produce EBY101-X3 through plasmid pAUR135 using aureobasidin A as a selection marker.19 Then the corresponding CMC or PASC degradation plasmids were transformed into EBY101-X3 to obtain EBY101-X3CC and EBY101-X3CP. As showed in Fig. 4, xylose was almost depleted after 96 h. Meanwhile, 56% of CMC (Fig. 4a) and 16% of PASC (Fig. 4b) were consumed respectively. It was found that using xylose as a mixed sugar showed a higher ethanol yield and more efficient CMC degradation than that of using sucrose in batch culture. Recent studies have 11


Energy & Fuels

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 36

reported that the addition of LPMOs and CDHs to cellulase cocktails resulted in a significant improvement in cellulosic degradation.28-30 Therefore, in order to further enhance the yeast digestion of cellulose, lpmo and cdh expression cassettes were then integrated into the genome of EBY101-X3 to obtain EBY101-X5. With transformations of the corresponding CMC or PASC degradation plasmids, the resulted yeasts EBY101-X5CC and EBY101-X5CP were applied in co-fermentation of xylose and CMC or PASC. With similar strain growth conditions, CMC and PASC degradations were enhanced by 30% and 80% (Fig. 5), and ethanol yields were increased by 5.9% and 8.8% (Table 2).

4. Discussion Consolidated bioprocessing (CBP) of cellulose is considered as a cost-effective way to produce cellulosic bioethanol.31 Intensive efforts have thus focused on engineering S. cerevisiae with noncomplexed or complexed cellulase systems with the purpose to obtain a CBP-workable strain.32-37 The complexed cellulase systems are also called cellulosomes which are thought to have a much higher activity towards cellulose than the noncomplexed systems, since the cellulases involved in cellulosomes are assembled into a highly ordered structure that can provoke enzyme-enzyme, enzyme-proximity, and cellulose-enzyme-cell synergies.4,31,38 However, most of the reported S. cerevisiae strains with cellulosomes showed low specific ethanol productivities in CBP of cellulose, probably because the assembly of functional 12


Page 13 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Energy & Fuels

cellulosomes was time-consuming and the release of glucose from cellulose via cellulosomes was too slow to fully support the cell growth. In our previous study, by utilizing a bifunctional cellulosomes and a cellodextrin metabolic pathway, we have succeeded in yeast co-fermentation of cellulose and galactose.4,6 More interestingly, we found that fermentation of cellulose with a mixed fermentable sugar as an extra carbon source was able to markedly increase the specific productivity of cellulosic ethanol when applying the cellulosome-engineered S. cerevisiae in CBP of cellulose for ethanol production. However, conversion of galactose to bioethanol does not show a very promising prospect for industrial application, so we further metabolically engineered our S. cerevisiae in this work, trying to replace galactose with sucrose or xylose in the co-fermentation process. After substitution of constitutive promoters for galactose-inducible promoters to control the transcription of cellulosome units, our results showed that the cell growth of the obtained S. cerevisiae was similar with that of the original strain in co-fermentation of cellulose and galactose. The yeast using constitutive promoters showed a little decrease in efficiency of CMC degradation, suggesting that the galactose-inducible promoters of GAL1p and GAL10p might be better than the constitutive promoters of PGK1p and TEF2p for cellulose degradation systems in yeast. On the other hand, the reduced cellulosomes could probably help cells to decrease the metabolic load during surface display of cellulosome, which might explain the increased ethanol yield after promoter substitutions. Sucrose was then tested with cellulose in co-fermentation. Batch feeding of sucrose facilitated complete 13


Energy & Fuels

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 36

degradation of cellulose, suggesting that the fermentable sugars should be present during whole fermentation process. This finding further confirmed that use of constitutive promoters for cellulosome assembly was successful and it was also in agreement with our hypothesis that the released glucose via CBP of cellulose could not fully satisfy the cell demand. Co-fermentation of xylose and cellulose was also investigated

after

introduction

of a

xylose

metabolic

pathway

into

the

promoter-replaced S. cerevisiae. The cellulose degradation performance with xylose was inferior with that of galactose or sucrose. The possible reason was the slow growth rate of the engineered yeast with xylose as the carbon source. In this case, cellulose utilization could be improved by further expression of LPMO and CDH, which were found to enhance the cellulolytic activity of cellulases.

5. Conclusion Promoter substitution and xylose metabolic pathway engineering were carried out in a previously engineered S. cerevisiae that has been reported to be capable of co-fermenting cellulose and galactose. The obtained yeast strains succeeded in co-utilization of cellulose and either sucrose or xylose without galactose induction. However, although the engineered S. cerevisiae in this work has showed a good performance on CBP of soluble cellulose in the mixed-sugar fermentation, more efforts should be placed on efficient utilization of insoluble cellulose. In future, the engineered cellulolytic S. cerevisiae may be applied in full utilization of sugarcane to 14


Page 15 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Energy & Fuels

produce bioethanol, in which sugarcane is pretreated to sucrose, xylose and cellulose as a mixed fermentable carbon source.

Abbreviations CBP: consolidated bioprocessing CMC: carboxymethyl cellulose PASC: phosphoric acid-swollen cellulose mXR: xylose reductase with the point mutant of R276H XDH: xylitol dehydrogenase XK: xylulokinase EG: endoglucanase CBH: exoglucanase CBM: cellulose-binding module CDT-1: cellodextrin transporter BGL: β-glucosidase Aga1p: the Aga1 protein Aga2p: the Aga2 protein LPMO: lytic polysaccharide monooxygenase CDH: cellobiose dehydrogenase SUC: invertase SUT: sucrose transporter HXT: hextose transporter α-factor: a yeast secretion signal 5-FOA: 5-Fluoroorotic acid YNB: yeast nitrogen base with ammonium sulfate and without amino acids SC: synthetic complete DNS: 3, 5-dinitrosalicylic acid OD600: cell optical density at 600 nm

Author information Corresponding author *

Telephone: +86-10-64416691. Fax: +86-10-64715443.

E-mail: [email protected].

15


Energy & Fuels

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 36

Notes The authors declare that they have no competing interests.

Acknowledgements This work was supported by funding from the National High Technology Research and Development Program of China (863 Program, grant 2014AA020522), the National Natural Science Foundation of China (grant 21376023), and the National Basic Research Program of China（973 program, grant 2013CB733600).

Reference (1) Baeyens, J.; Kang, Q.; Appels, L.; Dewil, R.; Lv, Y. Q.; Tan, T. W. Challenges and opportunities in improving the production of bio-ethanol. Prog. Energy Combust. Sci. 2015, 47, 60-88. (2) Liao, J. C.; Mi, L.; Pontrelli, S.; Luo, S. Fuelling the future: microbial engineering for the production of sustainable biofuels. Nat. Rev. Microbiol. 2016, 14 (5), 288-304. (3) Peplow, M. Cellulosic ethanol fights for life. Nature 2014, 507(7491), 152-153. (4) Fan, L. H.; Zhang, Z. J.; Yu, X. Y.; Xue, Y. X.; Tan, T. W. Self-surface assembly of cellulosomes with two miniscaffoldins on Saccharomyces cerevisiae for cellulosic ethanol production. Proc. Natl. Acad. Sci. USA 2012, 109 (33), 13260-13265. (5) Kricka, W.; Fitzpatrick, J.; Bond, U. Metabolic engineering of yeasts by 16


Page 17 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Energy & Fuels

heterologous enzyme production for degradation of cellulose and hemicellulose from biomass: a perspective. Front. Microbiol. 2014, 5 (2), 174. (6) Fan, L. H.; Zhang, Z. J.; Mei, S.; Lu, Y. Y.; Li, M.; Wang, Z. Y.; Yang, S.T.; Tan, T.W. Engineering yeast with bifunctional minicellulosome and cellodextrin pathway for co-utilization of cellulose-mixed sugars. Biotechnol. Biofuels 2016, 9 (1), 1-11. (7) Wi, S. G.; Kim, H. J.; Mahadevan, S. A.; Yang, D. J.; Bae, H. J. The potential value of the seaweed Ceylon moss (Gelidium amansii) as an alternative bioenergy resource. Bioresource Technol. 2009, 100 (24), 6658-6660. (8) Ha, S. J.; Wei, Q.; Kim, S. R.; Galazka, J. M.; Cate, J. H.; Jin, Y. S. Cofermentation of cellobiose and galactose by an engineered Saccharomyces cerevisiae strain. Appl. Environ. Microbiol. 2011, 77 (16), 5822-5825. (9) Kawai, S.; Murata, K. Biofuel production based on carbohydrates from both brown and red macroalgae: recent developments in key biotechnologies. Int. J. Mol. Sci. 2016, 17 (2), 145. (10) Naumova, E. S.; Sadykova, A. Z.; Martynenko, N. N.; Naumov, G. I. Molecular polymorphism of β-fructosidase SUC genes in the Saccharomyces yeasts. Mol. Biol. 2014, 48 (4), 573-582. (11) Marques, W.L.; Raghavendran, V.; Stambuk, B.U.; Gombert, A.K. Sucrose and Saccharomyces cerevisiae: a relationship most sweet. FEMS Yeast Res. 2016, 16 (1), 107. (12) Toivari, M. H.; Salusjärvi, L.; Ruohonen, L.; Penttilä, M. Endogenous xylose pathway in Saccharomyces cerevisiae. Appl. Environ. Microbiol. 2004, 70 (6), 17


Energy & Fuels

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 36

3681-3686. (13) Kim, S. R.; Park, Y. C.; Jin, Y. S.; Seo, J. H. Strain engineering of Saccharomyces cerevisiae for enhanced xylose metabolism. Biotechnol. Adv. 2013, 31 (6), 851-861. (14) Wei, N.; Quarterman, J.; Kim, S. R.; Cate, J. H.; Jin, Y. S. Enhanced biofuel production through coupled acetic acid and xylose consumption by engineered yeast. Nat. Commun. 2013, 4 (10), 2580-2580. (15) Lee, S. M.; Jellison, T.; Alper, H. S. Bioprospecting and evolving alternative xylose and arabinose pathway enzymes for use in Saccharomyces cerevisiae. Appl. Microbiol. Biot. 2016, 100 (5), 2487-2498. (16) Ostergaard, S.; Olsson, L.; Johnston, M.; Nielsen, J. Increasing galactose consumption by Saccharomyces cerevisiae through metabolic engineering of the GAL gene regulatory network. Nat. Biotechnol. 2000, 18 (12), 1283-1286. (17) Subtil, T.; Boles, E.; Competition between pentoses and glucose during uptake and catabolism in recombinant Saccharomyces cerevisiae. Biotechnol. Biofuels 2012, 5 (1), 1-12. (18) Galazka, J. M.; Tian, C.; Beeson, W. T.; Martinez, B.; Glass, N. L.; Cate, J. H. Cellodextrin transport in yeast for improved biofuel production. Science 2010, 330 (6000), 84-86. (19) Flagfeldt, D. B.; Siewers, V.; Huang, L.; Nielsen, J. Characterization of chromosomal integration sites for heterologous gene expression in Saccharomyces cerevisiae. Yeast 2009, 26 (10), 545-551. (20) Hashida-Okado, T.; Ogawa, A.; Kato, I.; Takesako, K. Transformation system for 18


Page 19 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Energy & Fuels

prototrophic industrial yeasts using the AUR1 gene as a dominant selection marker. FEBS Lett. 1998, 425 (1), 117-122. (21) Zhang, Y. H.; Cui, J.; Lynd, L. R.; Kuang, L. R. A transition from cellulose swelling to cellulose dissolution by o-phosphoric acid: evidence from enzymatic hydrolysis and supramolecular structure. Biomacromolecules 2006, 7 (2), 644-648. (22) Bertolini, M. C.; Ernandes, J. R.; Laluce, C. New yeast strains for alcoholic fermentation at higher sugar concentration. Biotechnol. Lett. 1991, 13 (3), 197-202. (23) Updegraff, D.M. Semimicro determination of cellulose in biological material. Anal. Biochem. 1969, 32 (3), 420-424. (24) Jeffries, T.W.; Jin, Y.S. Metabolic engineering for improved fermentation of pentoses by yeasts. Appl. Microbiol. Biot. 2004, 63 (5), 495-509. (25) Watanabe, S.; Abu, S. A.; Pack, S. P.; Annaluru, N.; Kodaki, T.; Makino, K. Ethanol production from xylose by recombinant Saccharomyces cerevisiae expressing protein-engineered

NADH-preferring

xylose

reductase from Pichia

stipitis.

Microbiology 2007, 153 (9), 3044-3054. (26) Toivari, M. H.; Aristidou, A.; Ruohonen, L.; Penttilä, M. Conversion of xylose to ethanol by recombinant Saccharomyces cerevisiae: importance of xylulokinase (XKS1) and oxygen availability. Metab. Eng. 2001, 3 (3), 236-249. (27) Jin, Y. S.; Ni, H.; Laplaza, J. M.; Jeffries, T. W. Optimal growth and ethanol production from xylose by recombinant Saccharomyces cerevisiae require moderate D-xylulokinase activity. Appl. Environ. Microbiol. 2003, 69 (1), 495-503. (28) Kracher, D.; Scheiblbrandner, S.; Felice, A. K.; Breslmayr, E.; Preims, M.; 19


Energy & Fuels

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 36

Ludwicka, K.; Haltrich, D.; Eijsink, V. G. H.; Ludwig, R. Extracellular electron transfer systems fuel cellulose oxidative degradation. Science 2016, 352 (6289), 1098-1101. (29) Bennati-Granier, C.; Garajova, S.; Champion, C.; Grisel, S.; Haon, M.; Zhou, S.; Fanuel, M.; Ropartz, D.; Rogniaux, H.; Gimbert, I.; Record, E.; Berrin; J.G. Substrate specificity and regioselectivity of fungal AA9 lytic polysaccharide monooxygenases secreted by Podospora anserina. Biotechnol. Biofuels 2015, 8 (1), 1-14. (30) Navarro, D.; Rosso, M. N.; Haon, M.; Olivé, C.; Bonnin, E.; Lesage-Meessen, L.; Chevret, D.; Coutinho, P. M. Henrissat; B.; Berrin; J.G. Fast solubilization of recalcitrant cellulosic biomass by the basidiomycete fungus Laetisaria arvalis involves successive secretion of oxidative and hydrolytic enzymes. Biotechnol. Biofuels 2014, 7 (1), 1-14. (31) Lynd, L. R.; Van Zyl, W. H.; Mcbride, J. E.; Laser, M. Consolidated bioprocessing of cellulosic biomass: an update. Curr. Opin. Biotechnol. 2005, 16 (5), 577-583. (32) Wen, F.; Sun, J.; Zhao, H. Yeast surface display of trifunctional minicellulosomes for simultaneous saccharification and fermentation of cellulose to ethanol. Appl. Environ. Microbiol. 2010, 76 (76), 1251-1260. (33) Tsai, S. L.; DaSilva, N. A. Chen W. Functional display of complex cellulosomes on the yeast surface via adaptive assembly. ACS Synth. Biol. 2013, 2 (1), 14-21. (34) Tsai, S.L.; Goyal, G.; Chen, W. Surface display of a functional minicellulosome by intracellular complementation using a synthetic yeast consortium and its 20


Page 21 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Energy & Fuels

application to cellulose hydrolysis and ethanol production. Appl. Environ. Microbiol. 2010, 76 (22), 7514-7520. (35) Goyal, G.; Tsai, S. L.; Madan, B.; DaSilva, N. A.; Chen, W. Simultaneous cell growth and ethanol production from cellulose by an engineered yeast consortium displaying a functional mini-cellulosome. Microb Cell Fact. 2011, 10 (1), 4029. (36) Liang, Y.; Si, T.; Ang, E.L.; Zhao, H. Engineered pentafunctional minicellulosome for simultaneous saccharification and ethanol fermentation in Saccharomyces cerevisiae. Appl. Environ. Microbiol. 2014, 80 (21), 6677-6684. (37) Kim, S.; Baek, S.H.; Lee, K.; Hahn, J.S. Cellulosic ethanol production using a yeast consortium displaying a minicellulosome and β-glucosidase. Microb. Cell Fact. 2013, 12 (1), 14. (38) Fontes, C.M.; Gilbert, H.J. Cellulosomes: highly efficient nanomachines designed to deconstruct plant cell wall complex carbohydrates. Annu. Rev. Biochem. 2010, 79 (79), 655-681.

21


Energy & Fuels

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 36

Tables Table 1 Plasmids and Strains used in this study Plasmids or strains

Description

Reference

Plasmids Parent vector for protein surface display

pYD1

on EBY100. Parent vector for protein expression in

pRS425

EBY100.

Invitrogen Laboratory -stored

Insert of expression cassettes of pYD1-GAL10p-ScaI-GAL1p-ScaII-4

miniscaffoldin I and II in pYD1 with CohII= 4 under the control of GAL1 and

(6)

GAL10 promoters. Expression of CDT-1, GH1-1, EngY, and pRS425-cdt-1-gh1-1-engy-cbhb

cbhB through pRS425, which is suitable

(6)

for CMC degradation. Expression of CDT-1, GH1-1, CleCCA,

pRS425cdt-1-gh1-1-celcca-CA_C0911

and CA_C0911 through pRS425, which is

(6)

suitable for PASC degradation. Construction of expression cassettes of

pYD1-PGK1p-ScaI-TEF2p-ScaII-4

miniscaffoldin I and II in pYD1 with CohII= 4 under the control of PGK1p and

This work

TEF2p promoters. Strains EBY100

EBY101

EBY101-X3

EBY101-X5

AGA1 expression cassette under control of GAL1 promoter in genome AGA1 expression cassette under control of PGK1 promoter in genome Expression of mXR, XDH and XK in EBY101 genome expression of LPMO and CDH in EBY101-X3 genome

Invitrogen

This work

This work

This work

EBY100 harboring EBY100-IC

pYD1-GAL10p-ScaI-GAL1p-ScaII-4 and

(6)

pRS425-cdt-1-gh1-1-engy-cbhb EBY101-CC

EBY101 harboring

This work 22


Page 23 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Energy & Fuels

pYD1-PGK1p-ScaI-TEF2p-ScaII-4 and pRS425-cdt-1-gh1-1-engy-cbhb EBY101-X3 harboring EBY101-X3CC

pYD1-PGK1p-ScaI-TEF2p-ScaII-4 and

This work

pRS425-cdt-1-gh1-1-engy-cbhb EBY101-X3 harboring EBY101-X3CP


This work

pRS425- cdt-1-gh1-1-celcca-CA_C0911 EBY101-X5 harboring EBY101-X5CC


This work

pRS425-cdt-1-gh1-1-engy-cbhb EBY101-X5 harboring EBY101-X5CP


This work

pRS425- cdt-1-gh1-1-celcca-CA_C0911

23


Energy & Fuels

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 36

Table 2 Comparison of co-fermentation performances Carbon source (g/L)

Strains

Ethanol (g/L)

Cellulosic

Ethanol yield

ethanol (g/L)

(g/g sugars)

EBY100-IC

9.6

3.2

0.32

EBY101-CC

11.1

3.7

0.37

Sucrose/ CMC (20/10)

EBY101-CC

6.9

0.48

0.32

Sucrose/ CMC (80/10)

EBY101-CC

38.7

4.3

0.43

Xylose/ CMC (20/10)

EBY101-X3CC

8.8

2.0

0.34

EBY101-X5CC

10.1

2.9

0.36

EBY101-X3CP

7.4

0.6

0.34

EBY101-X5CP

8.6

1.2

0.37

Galactose/ CMC (20/10)

Xylose/ PASC (20/10)

24


Page 25 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Energy & Fuels

Supplementary Material

Fig. S1 Structure of AGA1 cassette in genome and miniscaffodins I and II in pYD1. AGA1p, TEF2p and PGK1p are constitutive promoters.

Sequence of the codon-optimized lpmo: GGTTTCGTTCAAAACATTGTCATAGATGGAAAGAAATATTACGGTGGTTACCTAGTAAA TCAATACCCATATATGTCTAACCCTCCAGAGGTAATCGCATGGTCTACCACTGCCACTGA TTTAGGTTTTGTAGACGGCACGGGCTATCAGACTCCAGATATTATCTGTCATAGAGGCG CAAAACCTGGCGCTTTGACCGCCCCAGTTTCACCAGGTGGCACCGTTGAACTGCAATG GACTCCATGGCCAGATTCTCATCACGGTCCTGTCATTAATTACTTGGCCCCTTGTAACGG CGATTGTTCCACCGTTGACAAAACCCAACTTGAATTCTTTAAGATAGCAGAGTCCGGCT TAATTAATGATGACAACCCACCTGGAATATGGGCTAGCGATAATTTGATCGCTGCTAATA ACTCATGGACGGTGACTATACCAACTACTATTGCTCCAGGTAATTATGTGTTAAGACATG AGATCATAGCCTTACATTCCGCACAAAATCAGGATGGTGCCCAAAACTACCCTCAATGC ATTAACCTGCAGGTGACTGGTGGAGGTAGTGATAATCCAGCTGGTACACTTGGAACCG CTTTATATCACGATACGGATCCTGGAATCCTTATCAATATTTATCAGAAACTATCCAGTTA TATTATTCCAGGCCCACCTTTATACACAGGATAA

25


Energy & Fuels

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 36

Sequence of the codon-optimized cdh: ATGAAGTTTTTAGGTCGCATTGGTGCCACTGCTCTGGCTGCTTCTTTGTACCTAACTTCA GGTGCAGCTCAAGCAACAGGTGATGCATATACAGATTCTGAAACTGGCATCAAATTCC AGACATGGAGCCCTGACCCTCAATTTACCTTCGGTTTGGCTTTACCACCTGACGCATTG GAGAAGGATGCAACTGAATATATCGGTCTTTTACGTTGTACCAGGGCTGACCCTTCGGA TCCTGGTTATTGTGGCCTTAGCCATGGCCAAGTTGGTCAAATGACCCAATCTTTGTTATT AGTGGCTTGGGCTTATGAAAATCAAGTTTATACCTCCTTTAGATACGCTACTGGATACAC CTTGCCTGGTCTATATACAGGTAATGCTAAATTGACTCAGCTCTCCGTTAACATAACTGA TACTTCCTTTGAATTAATTTACAGATGTGAAAATTGTTTTAGTTGGGAGCATGAGGGTTC AACTGGTTCGTCTTCGACTTCTCAAGGTTATCTCGTTCTTGGTAGAGCATCGGCCCGAA GAGGTGTAGTTGGACCTACATGTCCAGATACCGCCACATTCGGTTTCCATGATAATGGT TTTGGTCAGTGGGGTGTTGGACTAGAAAATGCTGTCTCAGAACAGTATTCTGAATGGG CAAGTCTCCCTGGTCTTACCGTTGAAACAACCTGTGAGGGAAGCGGTCCAGGTGAGG CCCAATGTGTCCCTGCACCTGAGGAGACTTATGACTATATAGTTGTTGGTGCAGGAGCC GGTGGCATACCTGTCGCAGATAAGTTGAGCGAAGCAGGCCACAAAGTACTCCTTATTG AAAAGGGTCCTCCTTCCACAGGTAGATGGCAAGGTACAATGAAACCAGAATGGCTAGA GGGTACAGATTTAACCCGATTCGATGTGCCTGGTTTGTGTAACCAGATTTGGGTCGATT CGGCTGGTATAGCATGTACCGATACTGACCAAATGGCTGGTTGTGTTCTCGGCGGAGGA ACCGCTGTTAATGCTGGTCTATGGTGGAAACCAATAGACCTGGATTGGGATGAAAACTT TCCTGAAGGCTGGCATAGTCAAGATTTGGCAGCTGCTACAGAAAGGGTGTTTGAGCGT ATTCCTGGCACCTGGCATCCTTCTATGGACGGAAAATTGTATAGAGACGAAGGTTATAA GGTGCTAAGTAGTGGCCTGGCAGAATCTGGATGGAAAGAGGTGGTTGCAAATGAAGTA CCTAATGAAAAAAACAGAACCTTTGCTCATACACATTTTATGTTTGCTGGTGGTGAGAG AAATGGCCCTTTAGCAACATATTTGGTTTCGGCTGATGCTAGAGAGAACTTTAGTTTATG GACTAATACTGCCGTACGCAGAGCAGTTAGAACCGGTGGTAAAGTCACAGGTGTAGAA TTGGAATGTTTAACCGACGGAGGTTATTCAGGCATTGTAAAGTTGAATGAAGGCGGCG GTGTGATTTTTTCTGCTGGAGCATTCGGTTCAGCAAAACTGCTGTTTAGAAGCGGTATA 26


Page 27 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Energy & Fuels

GGTCCAGAAGACCAATTACGTGTAGTTGCATCCTCAAAAGATGGTGAGGATTTCATTGA TGAGAAGGACTGGATAAAGTTGCCAGTAGGATATAATCTTATCGACCATCTCAACACTG ATCTTATCTTGACTCACCCAGACGTTGTCTTTTATGATTTTTATGAAGCTTGGACCACAC CAATAGAGGCAGATAAACAACTATATTTGGAGCAACGATCCGGAATCTTAGCCCAAGCC GCTCCAAACATTGGTCCTATGATGTGGGAACAGGTTACTCCAAGTGACGGTATCACCA GACAATTTCAGTGGACAGCAAGAGTGGAAGGTGATTCTCGTTTTACTAATTCCTCGCAT GCAATGACACTCTCACAATACTTAGGACGTGGCGTTGTTAGCCGCGGTAGAGCAACTAT TACTCAAGGATTAGTTACCACTGTAGCCGAGCATCCTTATCTACACAACGCTGGTGACA AGGAAGCTGTTATCCAAGGTATAAAGAATTTAATTGAATCATTAAATGTGATTCCAAATA TCACATGGGTACTGCCACCACCAGGAAGTACTGTGGAAGAATATGTGGACTCACTGCT AGTGTCTGCTTCCGCCCGAAGATCCAATCATTGGATGGGTACAGCCAAATTAGGTACAG ATGACGGAAGGTATGGTGGTACTTCCGTAGTTGATTTGGATACTAAGGTATATGGCACT GACAATTTATTCGTTGTAGATGCCTCTATTTTTCCTGGAATGTCTACTGGTAATCCTTCGG CAATGATAGTTATCGCTGCTGAACAAGCAGCCGAAAGGATCTTAAAATTGAGAAAATA A

27


Energy & Fuels

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 36

Table S1. Construction of gene expression cassettes Plasmids

Description

Reference

Insert of PGK1 promoter, α-factor, pUC19-PGK1p-αFactor-CYC1t

(1) and CYC1 terminator in pUC19. Insert of TEF1 promoter, α-factor, and

pUC19-TEF1p-αFactor-PGIt

(1) PGI terminator in pUC19. Insert of TEF2 promoter, α-factor, and

pUC19-TEF2p-αFactor-TPI1t

(1) TPI1 terminator in pUC19. Insert of HXT7 promoter, cdt-1, and

pRS424-HXT7p-cdt-1-HXT7t

(2) HXT7 terminator in pRS424.

pUC19-TEF2p-XYL1-TPI1t

XYL1 expression cassette.

This work

pUC19-TEF1p-mXYL1-PGIt

mXYL1 expression cassette.

This work

pUC19-PGK1p-XYL2-CYC1t

XYL2 expression cassette.

This work

pRS424-HXT7p-XKS1-HXT7t

XKS1 expression cassette.

This work

pUC19-PGK1p- AGA1-CYC1t

AGA1 expression cassette.

This work

YIplac211-PGK1p-AGA1-CYC1t

AGA1expression cassette

This work

pUC19- TEF1p-aFactor-lpmo-PGIt

lpmo expression cassette.

This work

pUC19- TEF2p-aFactor-cdh-TPIt

cdh expression cassette.

This work

28


Page 29 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Energy & Fuels

Table S2. Primers used for gene integration in yeast genome Integration

Integration

genes

sites

primers

Forward

Reverse

CAGAGCTCATGACATT

TGATGTCGACTTAAC

ATCTTTCGCTCATTTTA

TGAAAATTACATTGC

CC

AAGCAACTG

AGA1

CCCAAGCTTACGCACA

GCTCTAGAGCAATTA

(YIplac211)

GATATATAACATCTGCA

AAGCCTTCGAGCG

TCCCCCGGGGCCAGGC

TTGAAGCTATTTTGC

GCCTTTATATC

GAAACCCTATGCTC

GTTTCGCAAAATAGCT

ACCTTCCATTGGTAT

TCAAAATGTTTCTACTC

ACTGGAGGCTTCAT

CCAGTATACCAATGGA

TCCCCCGGGATAAA

AGGTCGGGATGAG

GCAGCCGCTACCAA

AGA1 AGA1

URA3

(pUC19)

20-up

mXYL1

YPRC_15

mXYL1

20-down

AC 12-up

XYL2

YIRC_6

XYL2

12-down

14-up

XKS1

YMRW_15

XKS1

TCCCCCGGGGCCGCTC

ATCTGTGCGTCTTAG

GTAAAAACAAAAAG

CCGGCTGAATAATC

GCCGGCTAAGACGCAC

AGACGGGGGAGCAA

AGATATATAACATCTG

TTAAAGCCTTCGAG

CTTTAATTGCTCCCCCG

TCCCCCGGGTCAAC

TCTTTCTTGTC

AATGTCGCTTCCG

TCCCCCGGGTCAATCA

TACGAGAAGTTGCG

AAGCAACCCAC

GTGTAAGAAAATGA

TTACACCGCAACTTCT

ATTTTCCATGATAAC

CGTAGGACAATTTC

TGACTCATTAGACAC TTTTTG

14-down

18-up

AGTCAGTTATCATGGA

TCCCCCGGGGCCGT

AAATGCAACCGATAAA

CCTCATGATGTGTTA

TCCCCCGGGTGTGCAC

ACTGGCCGTCGTTTT

AAAGGCCATAATA

ACGGCATGAGTTATG GTTGCAC

lpmo

YORW_17

lpmo

18-down

GTGCAACCATAACTCA

CACTTTTGTTGGGG

TGCCGTAAAACGACGG

ACGATTCAGGAAAC

CCAGT

AGCTATGAC

GTCATAGCTGTTTCCTG

TCCCCCGGGAAAGC

AATCGTCCCCAACAAA

TGGCTCCCCTTAGAC 29


Energy & Fuels

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 36

AGTG

24-up

TCCCCCGGGCTTTCAA

ACTGGCCGTCGTTTT

GGGTGGGGGCGG

ACGTTGAAGTCGCC TGGTAGCC

cdh

PDC6

cdh

24-down

GGCTACCAGGCGACTT

GCAACAGGGCGAGG

CAACGTAAAACGACG

TGATCCCAGGAAAC

GCCAGT

AGCTATGAC

GTCATAGCTGTTTCCTG

TCCCCCGGGGGCTG

GGATCACCTCGCCCTG

AACAACAGTCTCTC

TTGC

CCC

30


Page 31 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Energy & Fuels

Table S3. Primers used for promoter substitution in pYD1-based plasmid and construction of gene expression cassettes for xylose metabolic pathway Primers

PGK1

Forward

Reverse

AATTGAAGGAAATCTCATCGTGTTTT

TATACGGCCCGAATTCACGCACA

ATATTTGTTGTAAAAAGTAGATAATT

GATATTATAACATCTG

AC TEF2

pYD1

XYL1

XYL2

XKS1

R276H

ATCTGTGCGTGAATTCGGGCCGTATA

AAACAGCGAAGTAACTGCATGT

CTTACATATAGTAG

TTAGTTAATTATAGTTCGTTGACC

ATGCAGTTACTTCGCTGTTTTTC

CGATGAGATTTCCTTCAATTTTT AC

CGAGCTCATGCCTTCTATTAAGTTGA

GCTCTAGATTAGACGAAGATAG

ACTCTGG

GAATCTTGTCCC

CGAGCTCATGACTGCTAACCCTTCC

ACGCGTCGACTTACTCAGGGCC

TTGGT

GTCAATGA

GGAATTCATGTTGTGTTCAGTAATTC

GGAATTCTTAGATGAGAGTCTTT

AGAGACAG

TCCAGTTCGC

ACTGTCCCACACTTGTTGGAAAACA

TCCAACAAGTGTGGGACAGTGT TG

REFERENCES (1) Fan, L. H.; Zhang, Z. J.; Yu, X. Y.; Xue, Y. X.; Tan, T. W. Self-surface assembly of cellulosomes with two miniscaffoldins on Saccharomyces cerevisiae for cellulosic ethanol production. Proc. Natl. Acad. Sci. USA 2012, 109 (33), 13260-13265. (2) Fan, L. H.; Zhang, Z. J.; Mei, S.; Lu, Y. Y.; Li, M.; Wang, Z. Y.; Yang, S.T.; Tan, T.W. Engineering yeast with bifunctional minicellulosome and cellodextrin pathway for co-utilization of cellulose-mixed sugars. Biotechnol. Biofuels 2016, 9 (1), 1-11.

31


Energy & Fuels

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Fig. 1 Strategy for engineering S. cerevisiae to co-ferment cellulose and sucrose or xylose. The mutant XR (mXR): xylose reductase with the point mutant of R276H; XDH: xylitol dehydrogenase; XK: xylulokinase; BGL: β-glucosidase; EG: endoglucanase; CBH: exoglucanase; CBM: cellulose-binding module; CDT-1: cellodextrin transporter; Aga1p: Aga1 protein; Aga2p: the Aga2 protein. 165x114mm (300 x 300 DPI)


Page 32 of 36

Page 33 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Energy & Fuels

Fig. 2 Co-fermentation of galactose and CMC by EBY100-IC (a, galactose inducible expression) and EBY101CC (b, constitutive expression). CMC (filled square), galactose (open triangle), and OD600 (open square). 60x21mm (300 x 300 DPI)


Energy & Fuels

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Fig. 3 Co-fermentation of sucrose and CMC by EBY101-CC in batch culture (a) and fed-batch culture (b). CMC (filled square), sucrose (open triangle), and OD600 (open square). 62x23mm (300 x 300 DPI)


Page 34 of 36

Page 35 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Energy & Fuels

Fig. 4 Co-fermentation of xylose and CMC by EBY101-X3CC (a) or xylose and PASC by EBY101-X3CP (b). Cellulose (filled square), sucrose (open triangle), and OD600 (open square). 61x22mm (300 x 300 DPI)


Energy & Fuels

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Fig. 5 Improvement of cellulose utilization by expression of LPMO and CDH. 75x67mm (300 x 300 DPI)


Page 36 of 36

Xylose by Engineered

Recommend Documents