ZnO nanocomposites assisted by dental

Subscriber access provided by LUNDS UNIV

Applications and Health

Rapid antibiofilm effect of Ag/ZnO nanocomposites assisted by dental LED curing light against facultative anaerobic oral pathogen Streptococcus mutans Shilei Wang, Qiaomu Huang, Xiangyu Liu, Zhao Li, Hao Yang, and Zhong Lu ACS Biomater. Sci. Eng., Just Accepted Manuscript • DOI: 10.1021/ acsbiomaterials.9b00118 • Publication Date (Web): 22 Feb 2019 Downloaded from http://pubs.acs.org on February 25, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Biomaterials Science & Engineering

Rapid antibiofilm effect of Ag/ZnO nanocomposites assisted by dental LED curing light against facultative anaerobic oral pathogen Streptococcus mutans Shilei Wang, Qiaomu Huang, Xiangyu Liu, Zhao Li, Hao Yang, Zhong Lu*

Research Center for Environmental Ecology and Engineering, Key Laboratory for Green Chemical Process of Ministry of Education, School of Environmental Ecology and Biological Engineering, Wuhan Institute of Technology, No.206, Guanggu 1st road, Wuhan, 430073, PR China Wuhan, 430073, China

*Corresponding Author: [email protected]

KEYWORDS: Ag/ZnO nanocomposites; LED curing light; S. mutans biofilm; synergistic antibacterial; reactive oxygen

1

ACS Paragon Plus Environment

ACS Biomaterials Science & Engineering 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT

The integration of nanomaterials with clinical therapeutic instruments is a promising approach to improve the effects of nanomaterials. We reported an efficient synergistic antibacterial strategy formed through the combination of Ag/ZnO nanocomposites with a light-emitting diode (LED) curing light, which is a commonly used small instrument in dental clinics. The as-designed integration depicted a significantly enhanced bactericidal effect on facultative anaerobic oral pathogen Streptococcus mutans (S. mutans) both in planktonic and biofilm phases over a very short irradiation time ( 5 min). Further study showed that the combination of LED and Ag/ZnO nanocomposites induced more ·OH and ·O2- generation, which is responsible for the enhanced antibacterial activity. Moreover, this combination could destroy S. mutans biofilm by killing the bacteria embedded within biofilm, inhibiting exopolysaccharide production and down-regulating the biofilm-related gene expression. Therefore, it is proposed that this combination could be applied in dental clinics to realize the dental caries prevention and dental restoration simultaneously.

2


Page 2 of 36

Page 3 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION Dental caries is one of the most prevalent oral diseases mainly caused by dental plaque biofilm,1 which consists of bacteria and extracellular matrix.2 The facultative anaerobic Streptococcus mutans (S. mutans) is an common cariogenic bacterial species isolated from human dental plaque.3 This bacterium can produce acids, which causes a slow localized chemical dissolution of dental hard tissues known as dental caries.4 Unfortunately, the effective removal and inactivation of the bacteria in dental biofilm are extremely difficult, and simply brushing and flossing are not sufficient. Currently, antimicrobials, such as chlorhexidine (CHX) and antibiotics, are applied as adjunction treatments for dental caries.5,

6

These antibacterial agents showed excellent killing

capacity for oral pathogenic bacteria in planktonic state, however, they are less effective against bacteria in biofilms.7,

8

The presence of exopolysaccharides (EPS)-riched

extracellular matrix, with its local barriers to perfusion of drugs, reduces drugs access and triggers bacterial tolerance to antimicrobials.9 In addition, the application of antibiotics at levels below the inhibitory concentration has been shown to induce biofilms formation or enhance antibiotic resistance.10 Therefore, there is an urgent need to explore new approaches to inactivate S. mutans in biofilms and further eliminate dental caries.11 As a cheaper, non-toxic and biocompatible material, ZnO is widely used in dental clinics as endodontic sealer and restoration cement and is recognized by the U.S. Food and Drug Administration.12, 13 The antibacterial activity of ZnO at the nanoscale has been reported; however, this effect is limited and needs very long drug treatment 3



time.14-17 To improve the antibacterial activity, Ag nanoparticles (NPs) were introduced to materials to form nanocomposites. For example, the incorporation of Ag NPs into a titanium disk was achieved to decrease implant failures caused by bacterial infection.18, 19

In addition, Ag and/or Zn incorporated into mesoporous calcium-silicate NPs not

only showed enhanced antibacterial activity but also adhered well to root canal walls and infiltrated into the dentinal tubules; in the meantime they had no negative effects on the mechanical properties of dentin.20 The incorporation of Ag NPs into ZnO to form Ag/ZnO nanocomposites can increase the antibacterial activity against Escherichia coli, Staphylococcus aureus and Pseudomonas aeruginosa.21-24 We also have found that this nanocomposites shows enhanced antibacterial activity against planktonic S. mutans.23 However, this antibacterial action needs long drug treatment time (24 h), and the effect of Ag/ZnO on S. mutans biofilm has not been reported. Light cure of resin-based materials is the mainstay of esthetic restoration in dentistry.25,

26

In recent years, light-emitting diodes (LED) curing light with

wavelengths of 420~480 nm has been commonly used in dentistry. Compare with halogen technology light-curing units, LED curing light offers reduced curing time and increased mean surface microhardness values of resin cements.27, 28 In addition, this curing light has the advantages of minimal heat generation, high emission intensity and ease of operation.29,

30

If replacing some of dental clinic ZnO by Ag/ZnO

nanocomposites and using in endodontic sealer and restoration cement, it could realize the bacteria inhibition and dental restoration simultaneously in the process of LED light 4


Page 4 of 36

Page 5 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


treatment. Therefore, in the current study, we present an approach of amalgamating the antibacterial Ag/ZnO nanocomposites with LED curing light for the first time to inhibit S. mutans in planktonic and biofilm states in a short irradiation time ( 5 min). The antibiofilm mechanism was also investigated. EXPERIMENTAL SECTION Materials 2, 7-dichlorofluorescein diacetate (DCFH-DA) was purchased from Sigma-Aldrich (USA). N-acetyl-L-cysteine (NAC) and 5, 5-dimethy-1-pyrroline-N-oxide (DMPO) were purchased from Aladdin (China). Dimethyl sulfoxide (DMSO) was purchased from Merck Seccosolv (Germany). Sucrose was purchased from Sinopharm Chemical Reagent Co., Ltd. (China). Trizol reagent was purchased from Ambion (USA). The cDNA reverse transcription kit was purchased from TaKaRa (Japan). Ag/ZnO nanocomposites and ZnO nanorods were synthesized as previously described.23 Ag NPs were synthesized from AgNO3, PVP and NaBH4 according to our group’s method.31 Both Ag/ZnO and ZnO are rod-like morphology with length of 300~500 nm and width of 10~20 nm. The molar percentage of Ag element in Ag/ZnO is 7.04%. The bacteria strain of S. mutans Ingbitt was obtained from School of Stomatology, Wuhan University. The bacteria were incubated anaerobically in a brain heart infusion (BHI, Oxoid, England) at 37 ºC. All the cultures were achieved in sealed culture bags together with an AnaeroPack-Anaero, which kept an anaerobic environment in the bag. 5



Page 6 of 36

Light Source The blue LED curing light (Bluephase, Ivoclar Vivadent, Schaan/Liechtenstein, Austria) was provided by School of Stomatology, Wuhan University. Its wavelength falls in the scope of 420-480 nm. When the distance between the light source and the sample surface was set at 0.8 cm, the power density was 170.0 mW/cm2. The temperature variation of the sample was no more than 2 ºC, which was measured by a power meter (PM200, Thorlabs). The diameter of the LED light source is 1.0 cm. The sample was irradiated for 30 s, then stopped for 10 s, and total irradiation times were set for 1, 3 and 5 min, and the accumulated fluences are 10.2, 30.6, and 51.0 J/cm2, respectively, calculating according to the following formula32: Fluence (J/cm2) = Power Density (W/cm2) × Illumination Time (s)

(1)

Antibacterial activity against planktonic S. mutans S. mutans was incubated in 1 mL of BHI broth at 37 ºC for 18 h, then diluted by phosphate buffer (PBS) to a concentration of 107 colony forming units (CFU)/mL. The mixture of 100 μL of diluted bacteria suspension with 0.2, 0.6 and 1.0 mg/mL of Ag/ZnO or ZnO suspension was added into a 96-well plate, and exposed to LED illumination for 1, 3 and 5 min, respectively. After that, the mixture was diluted serially by 10-fold of PBS, then spread 10 μL of the diluent on BHI agar plate. The plate was incubated anaerobically at 37 ºC for 24 h, then the number of the colonies was counted. To avoid the illumination from LED affecting the nearby wells, we finished the whole steps in one well, then began to add the drug and the bacteria in the next well and 6


Page 7 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


illuminate. To analyze whether Ag element plays a main role in antibacterial action for LED combined with Ag/ZnO, 40 g/mL Ag NPs (equivalent Ag content in Ag/ZnO composites) alone was added into bacteria suspension for 5 min illumination and the antibacterial activity was measured. For NAC treatment experiment, 5 mmol/L of NAC was added together with Ag/ZnO, and the other steps were the same as that of bacteria treatment by Ag/ZnO and LED.33 Groups without nanomaterials or LED light were designed as two blank controls. Three independent experiments were performed and every experiment had three replicates. Antibacterial activity against S. mutans mature biofilm Planktonic S. mutans was revived in BHI broth at 37 ºC over night. For biofilm formation, S. mutans were seeded in 96-well plates and cultivated in fresh BHI medium supplemented with 1% sucrose (final concentration of S. mutans was 108 CFU/mL) at 37 °C under anaerobic conditions. To avoid the illumination affecting the nearby wells, six empty wells were kept between two experimental wells, which is about 5.4 cm in distance. After 24 h growth, the medium was removed and the biofilm in the well was washed with PBS. Then added 100 μL of 0.2, 0.6 and 1.0 mg/mL of Ag/ZnO suspension (or ZnO) to the wells and illuminated by LED curing light for 1, 3 and 5 min, respectively. To determine the amounts of live bacteria in biofilm, the biofilm was detached and diluted serially by 10-fold of PBS, then spread 10 μL of the diluent on BHI agar plate and further incubated anaerobically at 37 ºC for 24 h. The number of the colonies was counted. A blank without nanomaterials and LED illumination served as control. Three independent experiments were performed and every experiment had 7



three replicates. Observations by field-emission scanning electron microscopy (FE-SEM) and confocal laser scanning microscopy (CLSM) FE-SEM was used to visualize the changes of cell morphologies. The mixture of 108 CFU/mL bacteria and 1.0 mg/mL of Ag/ZnO suspension was exposed to LED light for 1, 3 and 5 min, respectively, then the mixture was fixed on glass coverslips with 2.5% of glutaraldehyde solution at 4 ºC overnight. Afterwards, cells dehydrated with a graded ethanol series (50%, 75%, 85%, 95% and 100%) followed by gold spraying and imaged by FE-SEM (Quanta 450 FEG, USA) at an extra high tension of 5.0 kV. A blank without nanomaterial and LED light served as control. A tooth slice, a horizontal section with 0.5 mm thickness from a human third molar, was used to simulate the true tooth surface where bacterial biofilm formed. To analyze the bacterial viability of S. mutans in mature biofilm, a biofilm pre-formed on a tooth slice for 24 h was exposed to Ag/ZnO suspension and LED light, then the tooth slice was washed with PBS and stained by a LIVE/DEAD BacLightTM Bacterial Viability Kit (Molecular Probes, USA) containing SYTO 9 and propidium iodide (PI) for 15 min at room temperature. The final concentrations of SYTO 9 and PI were 6 μmol/L and 30 μmol/L, respectively. Fluorescence photograph was taken using a CLSM (Olympus Fluoview FV1000, Japan) under a 60 × oil dipping object lens. Each biofilm was scanned randomly at three different positions. The excitation and emission wavelengths were 488 nm and 532 nm, respectively, and the fluorescence was detected in the ranges 500-530 nm and 630-700 nm, respectively. The optical section was acquired at spacing 8


Page 8 of 36

Page 9 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


steps of 2 μm intervals from the surface to the depth of the biofilm. Ions release and their antibacterial activity The mixture of l mL of 107 CFU/mL bacteria and 1 mL of 1.0 mg/mL Ag/ZnO suspension was exposed to LED irradiation for 5 min, then the mixture was centrifuged and the supernatant was filtered through a Millipore filter (pore size of 0.45 μm), and the concentrations of Ag+ and Zn2+ in the filtrate were measured by inductively coupled plasma-atomic emission spectrometry (ICP-AES, IRIS Intrepid II XSP, Perkin Elmer, USA). The mixture without LED treatment served as control. To evaluate the antibacterial effects of releasing Ag+ and Zn2+ from Ag/ZnO under illumination, 0.6 mg/L Ag+ + 0.68 mg/L Zn2+ and 5 × (0.6 mg/L Ag+ + 0.68 mg/L Zn2+) were co-culture with bacteria for 5 min, respectively, then the CFU of culture solution was measured. The bacteria without ions treatment served as control. Three independent experiments were performed in triplicate.

Electron spin resonance (ESR) measurements ESR measurements were performed to detect the hydroxyl radicals (·OH) and superoxide radical anions (·O2−) in 50 μL of 2 mg/mL Ag/ZnO suspension after LED illumination. Deionized water and DMSO with volume of 125 μL were used as solvent for hydroxyl radical and superoxide radical anion trapping, respectively. After illumination, 25 μL of fresh DMPO solution (25 mg/mL) was added quickly as the spintrapping agent. The ESR spectra were recorded on an ESR spectrometer (EMX-8/2.7, Bruker, Germany).34 9



Detection of intracellular reactive oxygen species (ROS) ROS levels in bacteria were measured using the oxidation-sensitive fluorescent probe DCFH-DA. In brief, 2 mL of cell suspension (108 CFU/mL) was seeded in a 24-well plate. After treatment by LED light and 1.0 mg/mL of Ag/ZnO or ZnO, the cells were labelled with 100 μmol/L of DCFH-DA dye at 37 ºC for 1 h. Then the bacteria were collected by centrifugation and washed two times with PBS. Bacteria were resuspended in PBS and the fluorescence intensity was measured using a fluorescence spectrophotometer (Hitachi F4600, Japan) at excitation and emission of 450 nm and 535 nm, respectively.35

Estimation of exopolysaccharides (EPS) S. mutans biofilms were formed in a 24-well plate for 24 h, then treated with 1 mg/mL Ag/ZnO suspension and LED light. After illumination for 1, 3 and 5 min respectively, Ag/ZnO suspension was discarded, and the biofilm were washed three times with PBS, then added with 2 mL of BHI (with 1% sucrose). The biofilms were detached from the 24-well plate, and dispersed in BHI and further incubated anaerobically at 37 ºC for 24 h. The water soluble and insoluble EPS were extracted according to the reference.36 The biofilms were detached from the 24-well plate and dispersed, then centrifuged at 5,500 × g for 10 min at 4 ºC, and the supernatant was collected. The pellets were washed by deionized water for three times and the supernatant was collected. Total supernatants were combined for soluble polysaccharide analysis. For the extraction of insoluble EPS, 10


Page 10 of 36

Page 11 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


the pellets were re-suspended in 1 mol/L NaOH solution and incubated at 37 ºC for 2 h. Then the samples were centrifuged at 14,000 × g for 10 min and the supernatants were collected. The cells were repeatedly washed by 1 mol/L of NaOH and centrifuged for three times, and the supernatants were collected and combined for insoluble polysaccharides analysis. To precipitate the polysaccharides, 3-fold volumes of icecold 95% ethanol was added into above collected supernatant and stored at 4 ºC overnight. The mixture was centrifuged for 20 min at 9,500 × g and the precipitant was washed with ice-cold 75% ethanol for three times, then re-suspended in 1 mL of water or 1 mL 1 mol/L of NaOH solution for water-soluble or insoluble polysaccharides tests, respectively, by the phenol-sulphuric acid colorimetric assay.37 The bacteria biofilms without Ag/ZnO and LED treatment served as control. The EPS content of mature biofilm after 5 min treatment by Ag/ZnO without LED irradiation was also measured. Three independent experiments were performed. Each independent experiment used three replicates.

Quantitative real time polymerase chain reaction (qRT-PCR) S. mutans was incubated in a 24-well plate for 24 h to form mature biofilm. After treatment with 1 mg/mL of Ag/ZnO and LED illumination, Ag/ZnO suspension was discarded and the biofilm was re-suspended in BHI (supplemented with 1% sucrose) for further 24 h anaerobic incubation at 37 ºC, then the biofilm was scraped away and washed with PBS, and then collected by centrifugation. The cells were digested with 4 mg/mL of lysozyme, then total RNA was isolated and purified by the Trizol reagent. 11



Then the cDNA reverse transcription was performed according to the specification contained in the kit. Quantitative real-time PCR amplification was performed on a qRTPCR System (QuantStudio 6 Flex, Thermo Fisher, USA). All primers are listed in Table 1. The PCR conditions included an initial denaturation at 95 ºC for 10 min, followed by 40-cycle amplification consisting of denaturation at 95 ºC for 15 s and annealing and extension at 60 ºC for 1 min. A standard curve was generated for each gene and then plotted by amplification of a series of diluted cDNA samples. The expression levels of all selected genes were normalized using 16S rRNA as an internal standard.38 Relative mRNA expression was determined by the 2-ΔΔCt method.39 Three independent experiments were performed. Each independent experiment used three replicates. Table 1. Nucleotide sequences of primers used in this study. Gene

Primer sequence (5’ – 3’) Forward

Reverse

gtfB40

AGCCGAAAGTTGGTATCGTCC

TGACGCTGTGTTTCTTGGCTC

gtfC40

TTCCGTCCCTTATTGATGACATG

AATTGAAGCGGACTGGTTGCT

ftf41

AAATATGAAGGCGGCTACAACG

CTTCACCAGTCTTAGCATCCTGA A

comD40

TTCCTGCAAACTCGATCATATAG G

TGCCAGTTCTGACTTGTTTAGGC

comE40

TTCCTCTGATTGACCATTCTTCTG

GAGTTTATGCCCCTCACTTTTCG

vicR38

TGACACGATTACAGCCTTTGATG

CGTCTAGTTCTGGTAACATTAAG TCCAATA

16S rRNA40

CCATGTGTAGCGGTGAAATGC

TCATCGTTTACGGCGTGGAC

12


Page 12 of 36

Page 13 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Statistical analysis Experiments were conducted at least three times and data were presented as mean ± standard deviation (SD). Difference between two groups was analyzed by Student’s ttest and P < 0.05(*) was considered statistically significant. Differences between three or more groups were analyzed by one-way analysis of variance (ANOVA) with Dunnett post hoc test and P < 0.05(*) or P < 0.01 (**) was considered statistically significant.

RESULTS Antibacterial activity on planktonic S. mutans Figure 1A and 1B are schematics of LED illumination tests. Figure 1C shows that Ag/ZnO nanocomposites with LED irradiation displayed remarkably different antibacterial activity against planktonic S. mutans compared to Ag/ZnO alone; however, an equivalent concentration of ZnO and an equivalent amount Ag NPs did not show such differences. After 5 min of LED irradiation, Ag/ZnO caused approximately 2.87 log reduction in cell CFU, however, Ag NPs caused only 0.56 log reduction and ZnO did not cause obvious decreases. As the purpose of this work is to improve the antibacterial capacity of dental material ZnO, Ag NPs alone were not be used as control in the following investigation.

13



Figure 1. Antibacterial activity of Ag/ZnO assisted with LED curing light. A. Image of LED curing light irradiating on bacteria in a 96-cell plate; B. Light turns on; C. Antibacterial activity of 1 mg/mL Ag/ZnO or ZnO and 40 g/mL Ag NPs against planktonic S. mutans with or without 5 min LED illumination. * p < 0.05 and **p < 0.01 by one-way ANOVA. All bars indicate means ± SD. To know more details about the effect of Ag/ZnO combined with LED, different concentrations of Ag/ZnO suspension and illumination time were introduced. As shown in Figure 2A, the combination of Ag/ZnO nanocomposites and LED illumination showed bactericidal effects toward planktonic S. mutans in time and dose-dependent manner. After 3 min and 5 min of illumination, 1 mg/mL of Ag/ZnO caused 94.0% and 99.8% bacterial death, respectively. One-way ANOVA analysis revealed that both the illumination time and Ag/ZnO concentration have significant influences on bactericidal activity. It is noted that when replacing Ag/ZnO by ZnO, the bacterial CFU almost had no variation when compared to the control group (Figure 2D). As shown in Figure 2B and 2E, the nanomaterials without illumination showed negligible disinfection efficiencies after 5 min of treatment. However, the illumination alone did not obviously kill the bacteria (Figure 2C). These results suggest that after a very short treatment time 14


Page 14 of 36

Page 15 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Ag/ZnO nanomaterial alone or LED illumination alone almost had no antibacterial activity on planktonic S. mutans; however, when combining them, there was a significant synergistic antibacterial effect.

Figure 2. Antibacterial activity of different concentrations of Ag/ZnO against planktonic S. mutans with or without LED illumination. A. Ag/ZnO nanocomposites with illumination; B. Ag/ZnO without illumination; C. Illumination alone; D. ZnO nanorods with illumination; E. ZnO without illumination. All bars indicate means ± SD. *p < 0.05 and **p < 0.01 by one-way ANOVA. Antibacterial activity on mature biofilm We next examined whether the combination of Ag/ZnO with LED illumination could kill S. mutans embedded in biofilm. As shown in Figure 3A, the exposure of biofilms to 0.6 mg/mL of Ag/ZnO and 5 min of LED illumination caused 92.5% reduction of CFU when compared to that of the control biofilm. Furthermore, 1 mg/mL of Ag/ZnO with 3 min and 5 min of illumination caused 90.2% and 99.6% bacteria CFU decrease, 15



respectively, which is very close to the antibacterial effect on planktonic S. mutans. The combination of LED illumination with ZnO had little effect on S. mutans biofilm (Figure 3B).

Figure 3. Antibiofilm activity of Ag/ZnO and ZnO combined with LED illumination. A. Ag/ZnO; B. ZnO. *p < 0.05 by one-way ANOVA. All bars indicate means ± SD. Integrity destruction of bacteria As shown in Figure 4A, untreated S. mutans displayed plump rod-shapes with smooth and intact cell envelope. After treatment by 1 min of illumination and Ag/ZnO suspension, the cell retained the rod-like morphology; however, cell surface had some depressions (Figure 4B). After treatment with 3 min of illumination and Ag/ZnO, the cells were obviously damaged and leakage of the cytoplasm was observed (Figure 4C). However, more destructions were observed by the treatment of 5 min illumination and Ag/ZnO. The membrane components scattered from their original ordered structure, and the rod-like morphology appeared almost disorganized (Figure 4D), indicating the extreme destruction of the cell envelope.

16


Page 16 of 36

Page 17 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. FE-SEM images of S. mutans treated with 1 mg/mL Ag/ZnO and different times of LED illumination. A. 0 min; B. 1 min; C. 3 min; D. 5 min. Dynamics of biofilm disruption To further confirm the antibiofilm activity, we developed a simulated clinical model by incubating biofilm on a tooth slice and treating with Ag/ZnO suspension and LED light to intuitively assess the damage of biofilm. As shown in Figure 5, most of the cells showed green fluorescence in the control group (0 min), indicating that the cells were alive. With the increase of illumination time, the amounts of dead bacteria (in red) increased; furthermore, the dead bacteria were homogeneously distributed in the biofilm (Figure 5A and 5B). Optical sectioning through the biofilm in 2-μm intervals allowed us to investigate the amounts of live/dead bacteria in different layers of biofilm, as displayed in Figure 5C. In the control group, the total biomass (total bacteria) was almost the same as the green biomass (live bacteria), and there was almost no red biomass (dead bacteria) in the different layers of the biofilm. Compared with the control group, the dead bacteria in every layer increased gradually with the prolongation of the illumination time. After 1 min of illumination treatment, the amounts of total bacteria 17



and the live bacteria among every layer increased with an increase in biofilm thickness; however, the amounts of dead bacteria in the different layers almost had no change. After 3 min of illumination, the number of dead bacteria among every layer clearly increased with going deeper into biofilms, and almost caught up to the number of live bacteria. The more destruction of the biofilm appeared by 5 min of illumination. The amounts of dead bacteria in every layer were higher than that of the live bacteria. The bacteria at the outer layers of the biofilm, where the bacteria exposed to light closely, showed a higher death proportion compared to that in deeper layers. The total live/dead cell ratios within the biofilms at each depth were showed in Figure 5D. When without LED illumination, live/dead cell ratios were more than 20 and increased with the biofilm thickness. After 3 min and 5 min irradiation, the total ratios were reduced to 1.1 and 0.8, respectively. These results mean that the lethality of this synergistic effect could reach very deep in the biofilm.

18


Page 18 of 36

Page 19 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5. Dynamics of biofilm disruption and biomass distribution analysis in different layers after treatment with 1 mg/mL Ag/ZnO and LED illumination. A. Confocal image; B. 3D architecture; C. Biomass distribution; D. Live/dead cell ratios Ag+ and Zn2+ release and their antibacterial activity To investigate the synergistic antibacterial mechanism of the combination of Ag/ZnO with LED illumination, we first studied the Ag+ and Zn2+ releasing from Ag/ZnO under LED curing light. From Figure 6A we observed that Ag+ releasing from Ag/ZnO under 5 min of illumination changed less compared with that of Ag/ZnO without LED illumination. The Zn2+ release from LED illuminated Ag/ZnO seems higher than that from Ag/ZnO without illumination. To investigate if the releasd Ag+ and Zn+ ions are the main reason for short-term killing efficacy, we measured the antibacterial activity 19



of the mixture of Ag+ and Zn2+ at two concentrations under 5 min treatment. One is the releasing concentration from Ag/ZnO with illumination (0.6 mg/mL Ag+ and 0.68 mg/mL Zn2+) and the other is 5-fold of the releasing concentration, and result was shown in Figure 6B. It was seen that the CFU of bacteria after treatment by Ag+ and Zn2+ even at 5-fold of releasing concentration was almost the same as the control. This result suggests that Ag+ and Zn2+ released from Ag/ZnO under irradiation possibly were not responsible for the synergistic bactericidal activity of the combination of LED and Ag/ZnO.

Figure 6. Ions releasing from Ag/ZnO with LED illumination (A) and their antibacterial activity (B). All bars indicate means ± SD, P > 0.05 by Student's t test (A) and by one-way ANOVA (B). ROS generation and their effect on the viability of S. mutans To further investigate the factors that are responsible for the enhanced antibacterial activity of Ag/ZnO under LED illumination, the ROS level was measured by ESR spectrometer. From Figure 7A and 7B, the characteristic peaks of the DMPO-·O2− adduct and the DMPO-·OH adduct were observed from Ag/ZnO suspension under LED illumination, and the intensity increased with the increase of illumination time, which 20


Page 20 of 36

Page 21 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


demonstrate the generation of ·O2− and ·OH radicals by Ag/ZnO under LED illumination. In contrast, ZnO suspensions exposed to LED illumination for 3 min exhibited nearly no ESR signal, suggesting no ·OH and ·O2− generation. To investigate whether the ROS generated by Ag/ZnO under LED illumination is responsible for the bactericidal activity, we measured the antibacterial performance of Ag/ZnO under LED illumination with the ROS-scavenger NAC. As shown in Figure 7C, the combination of Ag/ZnO with LED illumination reduced the bacterial viability in an illumination time-dependent manner, which is consistent with the previous result, however，the use of NAC reversed the reduced proliferation. These results confirmed that the ROS generated by Ag/ZnO under LED illumination play a key role in the bactericidal activity. To investigate whether the combination of Ag/ZnO with curing light illumination caused oxidative stress in S. mutans, the intracellular ROS was monitored with a sensitive fluorescent probe DCFH-DA. As shown in Figure 7D, LED illumination alone did not increase the intracellular ROS. However, the significant increase in cellular ROS was observed by treatment with a combination of ZnO and illumination. The greatest increase in cellular ROS was induced by the combination of Ag/ZnO and LED illumination. Furthermore, under LED illumination the amount of intracellular ROS induced by Ag/ZnO was significantly higher than that by ZnO.

21



Figure 7. Generation of ·O2− (A) and ·OH (B) by Ag/ZnO after LED illumination; C. Effect of ROS on bacterial viability under both Ag/ZnO and LED; D. Intracellular ROS in S. mutans induced by Ag/ZnO and ZnO (1 mg/mL) under LED illumination. All bars indicate means ± SD. **p < 0.01 by one-way ANOVA. EPS content in biofilm We next examined whether the combination of Ag/ZnO with LED illumination could reduce the EPS-matrix within the biofilm. Biofilms treated with Ag/ZnO were immediately exposed to LED curing light, then further incubated for 24 h and EPS content was determined (Figure 8). Biochemical analysis revealed that the amount of EPS in the biofilm treated by Ag/ZnO and LED irradiation was significantly reduced compared with that of the control. The insoluble and soluble EPS after Ag/ZnO combined with 5 min of illumination treatment reduced 72% and 67% respectively, and 22


Page 22 of 36

Page 23 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ZnO combined with 5 min of irradiation treatment reduced 51% and 10% respectively. However, 5 min of treatment by Ag/ZnO without LED illumination did not cause the obvious decrease of EPS content (Figure S1). These results suggest that reducing the EPS production in biofilm possibly be a reason for the antibiofilm mechanism of Ag/ZnO and LED illumination.

Figure 8. Production of EPS in biofilms after Ag/ZnO and LED treatment. S indicates S. mutans and L indicates LED. All bars indicate means and SD. **p < 0.01 by oneway ANOVA. qRT-PCR qRT-PCR was performed to gain insight into the effect of Ag/ZnO coupled with LED irradiation on the expression of biofilm-related genes in S. mutans and the results are plotted in Figure 9. The expressions of the gtfB, gtfC, ftf, vicR, comD and comE genes were reduced more than 66.5%. In contrast, after treatment with Ag/ZnO alone, the expressions of the gtfB, gtfC, vicR and comD were significantly up-regulated. When S. mutans was exposed to LED irradiation alone, the expressions of the gtfC, comE, ftf and vicR were almost unchanged, and gtfB was down-regulated. The results indicated 23



that the integration of Ag/ZnO and LED irradiation significantly down-regulated the expressions of EPS and quorum-sensing system related genes of S. mutans.

Figure 9. Expression profile of various biofilm-formative genes of S. mutans in response to the treatment with Ag/ZnO and LED illumination. All bars indicate means ± SD. *p < 0.05 and **p < 0.01 by one-way ANOVA. DISCUSSION Development of strategies to combat S. mutans in biofilm is a challenging task because these bacteria are much more resistant to antimicrobial therapies. The rapid advancement of nanotechnology offers us new approaches to control biofilm.42 It is well known that Ag NPs have excellent antibacterial activity against a broad range of pathogenic bacteria.31, 43, 44 Compared to Ag NPs, Ag/ZnO nanocomposites showed higher physico-chemical stability, lower cost, and less cytotoxicity.45 In the meantime, various Ag-based and ZnO-based hybrid nanoparticles were proved to have enhanced photocatalytic activities.46,

47

The hybridization of ZnO with Ag could immensely

facilitates the separation of electron-hole pairs and increases the rate of electron-transfer 24


Page 24 of 36

Page 25 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


under visible light irradiation, resulting in enhanced ROS generation.48 These ROS are not only responsible for enhancing the photocatalytic activity, but also for playing a very important role in killing bacterial cells.22,

49

The common photocatalytic

antibacterial method needs specialized light sources.50-52 In this study, we developed a novel approach by combining Ag/ZnO nanocomposites with LED curing light, a commonly used small instrument in dental clinics with minimal heat generation and ease of operation, to combat S. mutans biofilm. In this research, Ag/ZnO nanocomposites combined with LED curing light showed excellent antibacterial activity against the planktonic and biofilm phases of S. mutans, and this activity appeared in concentration and irradiation time-dependent manner (Figure 2 and Figure 3). At the concentration of 1 mg/mL and 5 min of irradiation time, the inhibition rates for the planktonic and biofilm states of S. mutans were 99.8% and 99.6%, respectively. However, Ag/ZnO alone almost did not reduce both states of S. mutans at this short time treatment. It is also noted that ZnO nanomaterial at the same condition did not reduce both the planktonic and biofilm states of S. mutans, and LED illumination alone only caused small (0.37 log) reduction of S. mutans. These results intensively confirmed the synergistic antibacterial and antibiofilm effect of Ag/ZnO combined with LED illumination. We have reported the antibacterial activity of Ag/ZnO nanocomposites without illumination against planktonic S. mutans;23 however, this antibacterial action needs 24 h drug treatment time. We further measured the timekilling curve of Ag/ZnO against S. mutans without LED irradiation (see supporting information) and the result shows that 1 mg/mL of Ag/ZnO under no illumination 25



Page 26 of 36

required 7-8 h of co-culture to achieve similar antimicrobial effect with that of 5 min of LED irradiation, and 0.6 mg/mL of Ag/ZnO needs more than 8 h (see Figure S2). Lipovsky reported that ZnO nanoparticles could decrease the viability of Candida albicans under blue light; however, higher power (180 J/cm2) and longer illumination time (30 min) were adopted.53 In the current study, a very short illuminating time ( 5 min) and lower power ( 51.0 J/cm2) were adopted. The very short time treatment makes this antibacterial method more easily realized in dental clinics. Therefore, very short treatment time, ease of operation and obvious antibiofilm activity are advantages of this work. CHX and antibiotics are capable of killing planktonic bacteria,6,

54

however, they are far less effective against plaque biofilm.7, 8 Therefore, our approach may provide a feasible platform for inhibiting dental plaque. Furthermore, the in vitro cytotoxicity of Ag/ZnO on mouse osteoblastic cell line MC3T3-E1 was measured and compared with commonly commercial ZnO nanoparticles (Figure S3). After 48 - 96 h treatment with Ag/ZnO, the cells had approximately 86-130% cell relative viability when compared with ZnO at equivalent concentrations. As ZnO is widely used in dental clinics and is recognized by the U.S. Food and Drug Administration,12, 13 this result suggests that the cytotoxicity of Ag/ZnO prepared by us possibly be acceptable in dental clinics. We further explored the synergistic antibacterial mechanism of Ag/ZnO nanocomposites combined with LED curing light. It was reported that the release of metal ions from nanomaterials plays a key role in killing bacteria.55, 56 Our results in Figure 6 suggest that the content of Ag+ and Zn2+ released from Ag/ZnO under LED 26


Page 27 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


irradiation increased compared to that without irradiation; however, these ion possibly are not responsible for the synergistic antibacterial activity. ROS generated by nanomaterials under light illumination is another important factor that causes the bacteria death.50, 51, 57 It was reported that the deposition of Ag on ZnO enhanced photocatalytic and antibacterial activities, and these enhancements were found mainly due to the obvious increase in ROS.45 In our study, the generation of ·OH and ·O2− were obviously increased after irradiating Ag/ZnO by LED. However, ZnO nanomaterials did not produce measurable ROS in same situation (Figure 7A and Figure 7B). We next confirmed that these ROS were responsible for the enhanced antibacterial activity of Ag/ZnO under LED by ROS-scavenger NAC (Figure 7C). For planktonic S. mutans, the death of bacteria after Ag/ZnO and LED treatment was possibly due to direct cell structure destruction (Figure 4) and intracellular oxygen stress (Figure 7D). For S. mutans biofilm, the death of bacteria in biofilm was first observed (Figure 5). With the increase of irradiation time, the death rate increased accordingly, and this tendency could arrive the much deeper biofilm. The total live/dead cell ratios within the biofilms at each depth decreased dramatically with the increase of irradiation time. These results confirmed that the lethality of this synergistic effect could reach very deep in the biofilm. It is reported that EPS in biofilm could reduce drugs access, promote bacterial cell adhesion and increase the mechanical stability of biofilm.9 Thus, effective antibiofilm approaches should both reduce the matrix generation and kill the bacteria embedded within plaque-biofilm. The reduction of insoluble (primarily α1, 3-linked glucans) and 27



soluble (mostly α1, 6-linked glucans) EPS was clearly observed after treatment S. mutans biofilm with Ag/ZnO and LED light irradiation in our data (Figure 8). EPS is synthesized by S. mutans mainly through enzymes, such as glucosyltransferases (GTF) and fructosyltransferases (FTF).41 Among them, GTFB (encoded by gtfB) and FTF (encoded by ftf) catalyze the synthesis of insoluble glucan and fructan respectively, and GTFC (encoded by gtfC) is responsible for the synthesis of a mixture of insoluble and soluble glucan.38,

58

Results of qRT-PCR confirmed that the reduction of EPS by

Ag/ZnO combined with LED was possibly due to the significant suppression of aforementioned enzymes-related genes expressions (Figure 9). In addition, vicR gene encodes a VicR response regulator, which influences the ComCDE system and gene expression of gtfBCD.38, 59 The genes of comD and comE encode the production of competence-stimulating peptides, which are parts of the quorum-sensing cascade of S. mutans.38 Significant down-regulation of these genes by Ag/ZnO combined with LED suppressed regulation of genetic competence and intra-species cell-cell communication, which consequently led to declines of bacteria persistence and disruption of biofilm formation and integrity.38 From Figure 9 it was also found that after short time (5 min) treatment by Ag/ZnO under no LED irradiation the expressions of biofilm-related genes were up-regulated. It was reported that S. mutans used stress-response pathways to respond environmental changes and modulated virulence to ensures its persistence in oral cavity.60, 61 Up-regulated gene expression possibly indicated the adaptation of S. mutans to the short time treatment of Ag/ZnO under no irradiation. We further measured the expressions of biofilm-related genes in S. mutans after 4 h and 8 h 28


Page 28 of 36

Page 29 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


treatment by Ag/ZnO under no LED irradiation (Figure S4). That 4 h treatment significantly down-regulated the expressions of gtfB and gtfC, and 8 h treatment downregulated all the genes. Considering this Ag/ZnO possibly be used in dental restorative materials, which may exposure to bacteria for a long time, Ag/ZnO could decline EPS synthesis and biofilms formation even no subsequent light exposure after short-time LED irradiation. The next step is to blend Ag/ZnO nanocomposites into restorative materials, such as resin composites or adhesives and investigate inhibitions of biofilm formation and mature biofilm by modified restorative materials under LED illumination. Further, the combination should to be used in a mouse’s tooth model. CONCLUSIONS In summary, we developed a feasible and easy therapeutic strategy based on conjugating Ag/ZnO nanocomposites with LED curing light for the inhibition of planktonic and biofilm phases of S. mutans over a very short irradiation time. Under LED irradiation, Ag/ZnO could efficiently generate ·OH and ·O2−, which disrupted the cell structure, induced intracellular ROS, and killed the planktonic S. mutans. Furthermore, the combination of Ag/ZnO with LED irradiation could reduce the EPS matrix formation meanwhile kill bacteria embedded in the deep biofilm, as well as down-regulate biofilm-related gene expressions. Therefore, this combination has potential application in dental clinics to realize the dental plaque biofilm inhibition and dental restoration simultaneously. 29



ASSOCIATED CONTENT Supporting Information Details of materials and methods of time-killing curve and in vitro cytotoxicity; results of EPS content in biofilm without LED irradiation, time-killing curve without LED irradiation, in vitro cytotoxicity and expression of biofilm-related genes under no LED irradiation. AUTHOR INFORMATION Corresponding Author *E-mail: [email protected]. Tel: +86-18062036269 ORCID: 0000-0002-5918-1489 Author Contributions The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript. Notes There are no conflicts to declare. ACKNOWLEDGEMENTS This work was supported by the National Natural Science Foundation of China (21371139) 30


Page 30 of 36

Page 31 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


RERENCES (1) Zhang, X.; Yang, S.; Liao, Z.; Xu, L.; Li, C.; Zeng, H.; Song, J.; Zhang, L. Prevalence and care index of early childhood caries in mainland China: evidence from epidemiological surveys during 1987-2013. Sci. Rep. 2016, 6, 18897, DOI: 10.1038/srep18897. (2) Bowen, W. H.; Koo, H. Biology of Streptococcus mutans-derived glucosyltransferases: role in extracellular matrix formation of cariogenic biofilms. Caries Res. 2011, 45, 69-86, DOI: 10.1159/000324598. (3) Vadeboncoeur, C.; Pelletier, M. The phosphoenolpyruvate:sugar phosphotransferase system of oral streptococci and its role in the control of sugar metabolism. Fems Microbiol. Rev. 1997, 19, 187-207, DOI: 10.1016/S0168-6445(96)00029-0. (4) Dashper, S. G.; Reynolds, E. C. Lactic acid excretion by Streptococcus mutans. Microbiology. 1996, 142, 33-39, DOI: 10.1099/13500872-142-1-33. (5) Nakamura, K.; Shirato, M.; Kanno, T.; Ortengren, U.; Lingstrom, P.; Niwano, Y. Antimicrobial activity of hydroxyl radicals generated by hydrogen peroxide photolysis against Streptococcus mutans biofilm. Int. J. Antimicrob. Ag. 2016, 48, 373-380, DOI: 10.1016/j.ijantimicag.2016.06.007. (6) Papas, A. S.; Vollmer, W. M.; Gullion, C. M.; Bader, J.; Laws, R.; Fellows, J.; Hollis, J. F.; Maupome, G.; Singh, M. L.; Snyder, J.; Blanchard, P.; Grp, P. C. Efficacy of chlorhexidine varnish for the prevention of adult caries: a randomized trial. J. Dent. Res. 2012, 91, 150-155, DOI: 10.1177/0022034511424154. (7) Besinis, A.; De, P. T.; Handy, R. D. The antibacterial effects of silver, titanium dioxide and silica dioxide nanoparticles compared to the dental disinfectant chlorhexidine on Streptococcus mutans using a suite of bioassays. Nanotoxicology. 2014, 8, 1-16, DOI: 10.3109/17435390.2012.742935. (8) Takahashi, H.; Nadres, E. T.; Kuroda, K. Cationic amphiphilic polymers with antimicrobial activity for oral care applications: eradication of S. mutans biofilm. Biomacromolecules. 2017, 18, 257-265, DOI: 10.1021/acs.biomac.6b01598. (9) Flemming, H. C.; Neu, T. R.; Wozniak, D. J. The EPS matrix: the "house of biofilm cells". J. Bacteriol. 2007, 189, 7945-7947, DOI: 10.1128/jb.00858-07. (10) Morita, Y.; Tomida, J.; Kawamura, Y. Responses of Pseudomonas aeruginosa to antimicrobials. Front. Microbiol. 2014, 4, 422, DOI: 10.3389/fmicb.2013.00422. (11) Zhou, Z.; Hu, F.; Hu, S.; Kong, M.; Feng, C.; Liu, Y.; Cheng, X.; Ji, Q.; Chen, X. pH-Activated nanoparticles with targeting for the treatment of oral plaque biofilm. J. Mater. Chem. B. 2018, 6, 586592, DOI: 10.1039/c7tb02682j. (12) Javidi, M.; Zarei, M.; Naghavi, N.; Mortazavi, M.; Nejat, A. H. Zinc oxide nano-particles as sealer in endodontics and its sealing ability. Contemp. Clin. Dent. 2014, 5, 20-24, DOI: 10.4103/0976237X.128656. (13) Jin, T.; Sun, D.; Su, J. Y.; Zhang, H.; Sue, H. J. Antimicrobial efficacy of zinc oxide quantum dots against Listeria monocytogenes, Salmonella Enteritidis, and Escherichia coli O157:H7. J. Food Sci. 2009, 74, M46-52, DOI: 10.1111/j.1750-3841.2008.01013.x. (14) Padmavathy, N.; Vijayaraghavan, R. Enhanced bioactivity of ZnO nanoparticles-an antimicrobial study. Sci. Technol. Adv. Mat. 2008, 9, 035004, DOI: 10.1088/1468-6996/9/3/035004. 31



(15) Raghupathi, K. R.; Koodali, R. T.; Manna, A. C. Size-dependent bacterial growth inhibition and mechanism of antibacterial activity of zinc oxide nanoparticles. Langmuir. 2011, 27, 4020-4028, DOI: 10.1021/la104825u. (16) Aydin Sevinc, B.; Hanley, L. Antibacterial activity of dental composites containing zinc oxide nanoparticles. J. Biomed. Mater. Res. B. 2010, 94, 22-31, DOI: 10.1002/jbm.b.31620. (17) Eshed, M.; Lellouche, J.; Matalon, S.; Gedanken, A.; Banin, E. Sonochemical coatings of ZnO and CuO nanoparticles inhibit Streptococcus mutans biofilm formation on teeth model. Langmuir. 2012, 28, 12288-12295, DOI: 10.1021/la301432a. (18) Pokrowiecki, R.; Zareba, T.; Szaraniec, B.; Palka, K.; Mielczarek, A.; Menaszek, E.; Tyski, S. In vitro studies of nanosilver-doped titanium implants for oral and maxillofacial surgery. Int. J. Nanomed. 2017, 12, 4285-4297, DOI: 10.2147/IJN.S131163. (19) Cochis, A.; Ferraris, S.; Sorrentino, R.; Azzimonti, B.; Novara, C.; Geobaldo, F.; Truffa Giachet, F.; Vineis, C.; Varesano, A.; Sayed Abdelgeliel, A.; Spriano, S.; Rimondini, L. Silver-doped keratin nanofibers preserve a titanium surface from biofilm contamination and favor soft-tissue healing. J. Mater. Chem. B. 2017, 5, 8366-8377, DOI: 10.1039/c7tb01965c. (20) Zhu, J.; Liang, R.; Sun, C.; Xie, L.; Wang, J.; Leng, D.; Wu, D.; Liu, W. Effects of nanosilver and nanozinc incorporated mesoporous calcium-silicate nanoparticles on the mechanical properties of dentin. PLoS One. 2017, 12, e0182583, DOI: 10.1371/journal.pone.0182583. (21) Zhang, Y.; Gao, X.; Zhi, L.; Liu, X.; Jiang, W.; Sun, Y.; Yang, J. The synergetic antibacterial activity of Ag islands on ZnO (Ag/ZnO) heterostructure nanoparticles and its mode of action. J. Inorg. Biochem. 2014, 130, 74-83, DOI: 10.1016/j.jinorgbio.2013.10.004. (22) Gupta, J.; Mohapatra, J.; Bahadur, D. Visible light driven mesoporous Ag-embedded ZnO nanocomposites: reactive oxygen species enhanced photocatalysis, bacterial inhibition and photodynamic therapy. Dalton Trans. 2017, 46, 685-696, DOI: 10.1039/c6dt03713e. (23) Wang, S.; Wu, J.; Yang, H.; Liu, X.; Huang, Q.; Lu, Z. Antibacterial activity and mechanism of Ag/ZnO nanocomposite against anaerobic oral pathogen Streptococcus mutans. J. Mater. Sci.: Mater. Med. 2017, 28, 23-30, DOI: 10.1007/s10856-016-5837-8. (24) Lu, Z.; Gao, J.; He, Q.; Wu, J.; Liang, D.; Yang, H.; Chen, R. Enhanced antibacterial and wound healing activities of microporous chitosan-Ag/ZnO composite dressing. Carbohydr Polym. 2017, 156, 460-469, DOI: 10.1016/j.carbpol.2016.09.051. (25) Baur, V.; Ilie, N. Repair of dental resin-based composites. Clin. Oral Invest. 2013, 17, 601-608, DOI: 10.1007/s00784-012-0722-4. (26) Manojlovic, D.; Radisic, M.; Vasiljevic, T.; Zivkovic, S.; Lausevic, M.; Miletic, V. Monomer elution from nanohybrid and ormocer-based composites cured with different light sources. Dent. Mater. 2011, 27, 371-378, DOI: 10.1016/j.dental.2010.11.017. (27) Stahl, F.; Ashworth, S. H.; Jandt, K. D.; Mills, R. W. Light-emitting diode (LED) polymerisation of dental composites: flexural properties and polymerisation potential. Biomaterials. 2000, 21, 1379-1385, DOI: https://doi.org/10.1016/S0142-9612(00)00029-6. (28) Ilday, N. O.; Bayindir, Y. Z.; Bayindir, F.; Gurpinar, A. The effect of light curing units, curing time, and veneering materials on resin cement microhardness. Journal of Dental Sciences. 2013, 8, 141-146, DOI: https://doi.org/10.1016/j.jds.2012.09.014. (29) Knezevic, A.; Tarle, Z.; Meniga, A.; Sutalo, J.; Pichler, G.; Ristic, M. Degree of conversion and temperature rise during polymerization of composite resin samples with blue diodes. J. Oral Rehabil. 2001, 28, 586-591, DOI: 10.1046/j.1365-2842.2001.00709.x. 32


Page 32 of 36

Page 33 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(30) Silva, P. C.; De, F. Z. L. R.; Moriyama, L. T.; De, T. P. N. S.; Bagnato, V. S. Temperature analysis during bonding of brackets using LED or halogen light base units. Photomed. Laser Surg. 2005, 23, 4146, DOI: 10.1089/pho.2005.23.41. (31) Lu, Z.; Rong, K.; Li, J.; Yang, H.; Chen, R. Size-dependent antibacterial activities of silver nanoparticles against oral anaerobic pathogenic bacteria. J. Mater. Sci.: Mater. Med. 2013, 24, 14651471, DOI: 10.1007/s10856-013-4894-5. (32) Cohen-Berneron, J.; Steinberg, D.; Featherstone, J. D.; Feuerstein, O. Sustained effects of blue light on Streptococcus mutans in regrown biofilm. Laser. Med. Sci. 2016, 31, 445-452, DOI: 10.1007/s10103016-1873-3. (33) Wu, H.; Lin, J.; Liu, P.; Huang, Z.; Zhao, P.; Jin, H.; Ma, J.; Wen, L.; Gu, N. Reactive oxygen species acts as executor in radiation enhancement and autophagy inducing by AgNPs. Biomaterials. 2016, 101, 1-9, DOI: 10.1016/j.biomaterials.2016.05.031. (34) Saison, T.; Gras, P.; Chemin, N.; Chaneac, C.; Durupthy, O.; Brezova, V.; Colbeau-Justin, C.; Jolivet, J. P. New insights into Bi2WO6 properties as a visible-light photocatalyst. J. Phys. Chem. C. 2013, 117, 22656-22666, DOI: 10.1021/jp4048192. (35) Applerot, G.; Lellouche, J.; Lipovsky, A.; Nitzan, Y.; Lubart, R.; Gedanken, A.; Banin, E. Understanding the antibacterial mechanism of CuO nanoparticles: revealing the route of induced oxidative stress. Small. 2012, 8, 3326-3337, DOI: 10.1002/smll.201200772. (36) Karunakaran, C.; Rajeswari, V.; Gomathisankar, P. Enhanced photocatalytic and antibacterial activities of sol-gel synthesized ZnO and Ag-ZnO. Mater. Sci. Semicond. Process. 2011, 14, 133-138, DOI: 10.1016/j.mssp.2011.01.017. (37) Singh, A.; Dutta, D. P.; Ballal, A.; Tyagi, A. K.; Fulekar, M. H. Visible light driven photocatalysis and antibacterial activity of AgVO3 and Ag/AgVO3 nanowires. Mater. Res. Bull. 2014, 51, 447-454, DOI: 10.1016/j.materresbull.2014.01.001. (38) Hasan, S.; Singh, K.; Danisuddin, M.; Verma, P. K.; Khan, A. U. Inhibition of major virulence pathways of Streptococcus mutans by quercitrin and deoxynojirimycin: a synergistic approach of infection control. PLoS One. 2014, 9, e91736, DOI: 10.1371/journal.pone.0091736. (39) Livak, K. J.; Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001, 25, 402-408, DOI: 10.1006/meth.2001.1262. (40) Takenaka, S.; Oda, M.; Domon, H.; Ohsumi, T.; Suzuki, Y.; Ohshima, H.; Yamamoto, H.; Terao, Y.; Noiri, Y. Vizantin inhibits bacterial adhesion without affecting bacterial growth and causes Streptococcus mutans biofilm to detach by altering its internal architecture. Biochem. Biophys Res. Commun. 2016, 480, 173-179, DOI: 10.1016/j.bbrc.2016.10.021. (41) Tam, A.; Shemesh, M.; Wormser, U.; Sintov, A.; Steinberg, D. Effect of different iodine formulations on the expression and activity of Streptococcus mutans glucosyltransferase and fructosyltransferase in biofilm and planktonic environments. J. Antimicrob. Chemother. 2006, 57, 865871, DOI: 10.1093/jac/dkl085. (42) Xu, C.; He, Y.; Li, Z.; Ahmad Nor, Y.; Ye, Q. Nanoengineered hollow mesoporous silica nanoparticles for the delivery of antimicrobial proteins into biofilms. J. Mater. Chem. B. 2018, 6, 18991902, DOI: 10.1039/c7tb03201c. (43) Guzman, M.; Dille, J.; Godet, S. Synthesis and antibacterial activity of silver nanoparticles against gram-positive

and

gram-negative

bacteria.

Nanomedicine.

2012,

8,

37-45,

DOI:

10.1016/j.nano.2011.05.007. (44) Perez-Diaz, M. A.; Boegli, L.; James, G.; Velasquillo, C.; Sanchez-Sanchez, R.; Martinez-Martinez, 33



R. E.; Martinez-Castanon, G. A.; Martinez-Gutierrez, F. Silver nanoparticles with antimicrobial activities against Streptococcus mutans and their cytotoxic effect. Mater. Sci. Eng., C. 2015, 55, 360-366, DOI: 10.1016/j.msec.2015.05.036. (45) Agnihotri, S.; Bajaj, G.; Mukherji, S.; Mukherji, S. Arginine-assisted immobilization of silver nanoparticles on ZnO nanorods: an enhanced and reusable antibacterial substrate without human cell cytotoxicity. Nanoscale. 2015, 7, 7415-7429, DOI: 10.1039/c4nr06913g. (46) Feng, X.; Guo, H.; Patel, K.; Zhou, H.; Lou, X. High performance, recoverable Fe3O4-ZnO nanoparticles for enhanced photocatalytic degradation of phenol. Chem. Eng. J. 2014, 244, 327-334, DOI: 10.1016/j.cej.2014.01.075. (47) Zou, X.; Dong, Y.; Li, S.; Ke, J.; Cui, Y. Facile anion exchange to construct uniform AgX (X = Cl, Br, I)/Ag2CrO4 NR hybrids for efficient visible light driven photocatalytic activity. Sol. Energy. 2018, 169, 392-400, DOI: 10.1016/j.solener.2018.05.017. (48) Adhikari, S.; Banerjee, A.; Eswar, N. K.; Sarkar, D.; Madras, G. Photocatalytic inactivation of E. Coli by ZnO-Ag nanoparticles under solar radiation. RSC Adv. 2015, 5, 51067-51077, DOI: 10.1039/c5ra06406f. (49) Andrade, G. R. S.; Nascimento, C. C.; Lima, Z. M.; Teixeira-Neto, E.; Costa, L. P.; Gimenez, I. F. Star-shaped ZnO/Ag hybrid nanostructures for enhanced photocatalysis and antibacterial activity. Appl. Surf. Sci. 2017, 399, 573-582, DOI: 10.1016/j.apsusc.2016.11.202. (50) Mangayayam, M.; Kiwi, J.; Giannakis, S.; Pulgarin, C.; Zivkovic, I.; Magrez, A.; Rtimi, S. FeOx magnetization enhancing E-coli inactivation by orders of magnitude on Ag-TiO2 nanotubes under sunlight. Appl. Catal., B. 2017, 202, 438-445, DOI: 10.1016/j.apcatb.2016.09.064. (51) Ng, T. W.; Zhang, L.; Liu, J.; Huang, G.; Wang, W.; Wong, P. K. Visible-light-driven photocatalytic inactivation of Escherichia coli by magnetic Fe2O3-AgBr. Water Res. 2016, 90, 111-118, DOI: 10.1016/j.watres.2015.12.022. (52) Li, Y.; Cheng, Y. F. Photocatalytic anti-bioadhesion and bacterial deactivation on nanostructured iron oxide films. J. Mater. Chem. B. 2018, 6, 1458-1469, DOI: 10.1039/c7tb03242k. (53) Lipovsky, A.; Nitzan, Y.; Gedanken, A.; Lubart, R. Antifungal activity of ZnO nanoparticles-the role of ROS mediated cell injury. Nanotechnology. 2011, 22, 105101, DOI: 10.1088/09574484/22/10/105101. (54) Sreenivasan, P. K.; Gittins, E. Effects of low dose chlorhexidine mouthrinses on oral bacteria and salivary microflora including those producing hydrogen sulfide. Oral Microbiol. Immunol. 2004, 19, 309-313, DOI: 10.1111/j.1399-302x.2004.00160.x. (55) Eshed, M.; Lellouche, J.; Gedanken, A.; Banin, E. A Zn-doped CuO nanocomposite shows enhanced antibiofilm and antibacterial activities against Streptococcus mutans compared to nanosized CuO. Adv. Funct. Mater. 2014, 24, 1382-1390, DOI: 10.1002/adfm.201302425. (56) Wang, X. L.; Liu, S. X.; Li, M.; Yu, P.; Chu, X.; Li, L.; Tan, G. X.; Wang, Y. J.; Chen, X. F.; Zhang, Y.; Ning, C. Y. The synergistic antibacterial activity and mechanism of multicomponent metal ionscontaining aqueous solutions against Staphylococcus aureus. J. Inorg. Biochem. 2016, 163, 214-220, DOI: 10.1016/j.jinorgbio.2016.07.019. (57) Tong, T.; Shereef, A.; Wu, J.; Binh, C. T.; Kelly, J. J.; Gaillard, J. F.; Gray, K. A. Effects of material morphology on the phototoxicity of nano-TiO2 to bacteria. Environ. Sci. Technol. 2013, 47, 12486-12495, DOI: 10.1021/es403079h. (58) Kulshrestha, S.; Khan, S.; Hasan, S.; Khan, M. E.; Misba, L.; Khan, A. U. Calcium fluoride nanoparticles induced suppression of Streptococcus mutans biofilm: an in vitro and in vivo approach. 34


Page 34 of 36

Page 35 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Appl. Microbiol. Biot. 2016, 100, 1901-1914, DOI: 10.1007/s00253-015-7154-4. (59) Stipp, R. N.; Boisvert, H.; Smith, D. J.; Hofling, J. F.; Duncan, M. J.; Mattos-Graner, R. O. CovR and VicRK regulate cell surface biogenesis genes required for biofilm formation in Streptococcus mutans. PLoS One. 2013, 8, e58271, DOI: 10.1371/journal.pone.0058271. (60) Guy Applerot; Anat Lipovsky; Rachel Dror; Nina Perkas; Yeshayahu Nitzan; Rachel Lubart; Gedanken, A. Enhanced antibacterial activity of nanocrystalline ZnO due to increased ROS-mediated cell injury. Adv. Funct. Mater. 2009, 19, 842–852, DOI: 10.1002/adfm.200801081. (61) Sadeghinejad, L.; Cvitkovitch, D. G.; Siqueira, W. L.; Merritt, J.; Santerre, J. P.; Finer, Y. Mechanistic, genomic and proteomic study on the effects of BisGMA-derived biodegradation product on cariogenic bacteria. Dent. Mater. 2017, 33, 175-190, DOI: 10.1016/j.dental.2016.11.007.

35



For Table of Contents Use Only

Rapid antibiofilm effect of Ag/ZnO nanocomposites assisted by dental LED curing light against facultative anaerobic oral pathogen Streptococcus mutans Shilei Wang, Qiaomu Huang, Xiangyu Liu, Zhao Li, Hao Yang, Zhong Lu*

36


Page 36 of 36

ZnO nanocomposites assisted by dental

Recommend Documents