Î±-l-Threose Nucleic Acids as Biocompatible Antisense

Subscriber access provided by UNIV OF SCIENCES PHILADELPHIA

Article

#-L-Threose Nucleic Acids as Biocompatible Antisense Oligonucleotides for Suppressing Gene Expression in Living Cells Ling Sum Liu, Hoi Man Leung, Dick Yan Tam, Tsz Wan Lo, Sze Wing Wong, and Pik Kwan Lo ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.8b01180 • Publication Date (Web): 23 Feb 2018 Downloaded from http://pubs.acs.org on February 23, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 22 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

α-L-Threose Nucleic Acids as Biocompatible Antisense Oligonucleotides for Suppressing Gene Expression in Living Cells Ling Sum Liu, Hoi Man Leung, Dick Yan Tam, Tsz Wan Lo, Sze Wing Wong and Pik Kwan Lo* Department of Chemistry, City University of Hong Kong, Tat Chee Avenue, Kowloon Tong, Hong Kong SAR and Key Laboratory of Biochip Technology, Biotech and Health Care, Shenzhen Research Institute of City University of Hong Kong, Shenzhen 518057, China. KEYWORDS α- L-Threose nucleic acid, antisense, gene inhibition, therapeutics, green fluorescence protein expression

ABSTRACT Due to the chemical simplicity of α- L-Threose nucleic acid (TNA) and its ability to exchange genetic information between itself and RNA, it has been raised significant interests in TNA as RNA ancestor. We herein explore the biological properties and evaluate the potency of sequence-designed TNA polymers to suppress gene expression in living environments. We found that sequence-specific TNA macromolecules exhibit strong affinity and specificity towards the complementary RNA targets, are highly biocompatible and non-toxic in living cell system, and readily enter a number of cell lines without using transfecting agents. Particularly, TNA exhibited much stronger enzymatic resistance toward fetal bovine serum or human serum

ACS Paragon Plus Environment

1

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 22

as compared to traditional antisense oligonucleotide which mean that the intrinsic structure of TNA is thoroughly resistant to biological degradation. Importantly, the efficacy of TNA molecule with GFP target sequence (anti-GFP TNAs) as antisense agents was firstly demonstrated in living cells in which these polymers revealed high antisense activity in terms of the degree of inhibition of GFP gene expression. The GFP gene inhibition studies in HeLa and HEK293 cells characterize sequence-controlled TNA as a functional biomaterials and a valuable alternative to traditional antisense oligonucleotide such as PNAs, MOs and LNAs for a wide range of applications in drug discovery and life science research. Additionally, we also firstly reported the cost-efficient approach to synthesize the

four

TNA

phosphoramidite

monomers

using

2-cyanoethyl

N,N,N',N'-

tetraisopropylphosphoramidite as a key reagent. Furthermore, by increasing the frequency of the de-blocking and coupling reaction together with extending their reaction time in each synthesis cycle, sequence-controlled TNAs can be easily synthesized in a quantitative yield and high purity. 1. INTRODUCTION Recently, oligonucleotide-based antisense approaches to achieve down-regulation of specific genes have received much attention because of their promising therapeutic properties on treating various infectious and genetic diseases.1,2 Oligonucleotides targeting specific mRNAs could simply knockdown or knockout their gene expressions by base-pairing in a sequence-specific manner. The use of RNAi has been shown to be a powerful gene silencing mechanism based on double-stranded small interfering RNAs (siRNAs).3 However, the severe enzymatic degradations of siRNA in living system together with its poor intracellular uptake resulted in a limited applications for their clinical uses.4–6 Significant progresses on the development of a series of chemically modified nucleic acid analogues and mimics with improved biostability, strong target affinity and low toxicity have been explored.7 Among antisense oligonucleotides, peptide nucleic acids (PNAs), phosphorodiamidate morpholino oligomers (MOs), and locked nucleic acids (LNAs) have been demonstrated as promising macromolecules to suppress the gene expression by steric block mechanism.8 On the other side, the antisense capability of uncharged PNAs is greatly restricted by their poor cellular uptake, poor water-solubility and tendency to self-


2

Page 3 of 22 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


aggregation in water.

9,10

In contrast, MOs show high solubility in aqueous media

notwithstanding their lack of charge, by virtue of their strong polarity, but they suffer from poor binding affinity to natural nucleic acids and mismatch discrimination when compared to PNAs.11–13 Nevertheless, LNAs exhibit a stronger binding affinity towards RNA than most of the 2’-modified antisense oligonucleotides, they show serious toxicological problems in systemic treatment.14 Thus, exploring an alternative biopolymer which should be highly biocompatible in living system, non-toxic, exhibit strong affinity and specificity towards the targets, and readily enter cells without affecting cell functions is highly significant and emerging, but still remind a challenge. Eschenmoser and his co-workers discovered that α-L-Threose nucleic acid (TNA) is capable of forming stable antiparallel Watson–Crick duplex structures with complementary strands of itself, RNA and DNA.15 In contrast with RNA and DNA, TNA has a backbone periodicity of unnatural four-carbon sugar of α-L-threose with phosphodiester linkages connecting at the 2’ and 3’ vicinal positions of the sugar ring.16 Due to the chemical simplicity of threose sugar relative to ribose sugar and its ability to exchange genetic information between TNA and RNA, it has been raised significant interests in TNA as RNA ancestor.17 So far, great efforts have been made on the development of engineered polymerases which facilitate TNA synthesis and transcribe genetic information back and forth between DNA and TNA.18,19 The tetrose-based oligonucleotides has also been used as a template for the nonenzymatic oligomerization of complementary activated ribonucleotides.20,21 By in vitro selection, functional TNA molecules have been isolated and shows their ability to fold into complex structures with specific ligand-binding properties.22 In addition, TNA can act as an aptamer and a catalyst for molecular medicine and synthetic biology.23 These findings make TNA an efficient alternative to traditional antisense oligonucleotide and motivate us to investigate TNA as a promising candidate for RNA-based therapeutic applications.24 Herein we designed TNA molecule with GFP target sequence of GAGCTGCACGCTGCCGTC and synthesized it by solid-phase synthesis method on automated DNA synthesizer in an almost quantitative yield, with the help of a well-modified synthetic protocol. The biological stability, cellular uptake efficiency and cytotoxicity of this sequence-controlled TNA molecule in HeLa and HEK293 cell lines were examined. Their inhibition extent of GFP expression in both cell


3


Page 4 of 22

lines were quantitatively evaluated as a function of concentrations. Our results showed that antiGFP TNA shows high specificity towards its complementary strands and exhibits stronger binding affinity to RNA than DNA. It is highly resistant to enzymatic degradation and exhibits low cytotoxicity and robust cellular uptake in a large variety of cell lines. Remarkably, this is the first example showing TNA targeting GFP is effective in the inhibition of gene expression in mammalian cells and its antisense ability is comparable to other existing antisense oligonucleotides. 2. EXPERIMENTAL SECTION Materials and Reagents. L-Ascorbic acid, calcium carbonate, anhydrous oxalic acid, paratoluenesulfonic acid monohydrate, benzoyl chloride, 4-dimethylaminopyridine, imidazole, tertbutyldiphenylchlorosilane, diphenylcarbamic

adenine,

chloride,

thymine,

N4-benzoylcytosine,

N2,9-diacetylguanine,

N,O-bis(trimethylsilyl)acetamide,

trimethylsilyl

trifluoromethanesulfonate, magnesium sulphate, tetrabutylammonium fluoride (1.0 M in THF), 4,4’-dimethoxytrityl chloride, 3-hydroxypropanenitrile, triethylamine, 2,4,6-trimethylpyridine and silver triflate were used as purchased from J&K (China). Activated carbon Darco G-60, diisobutylaluminum hydride solution (1.0 M in toluene), acetic anhydride, sodium bicarbonate, sodium hydroxide, ammonium chloride, bis(diisopropylamino)chlorophosphine, acetic acid, urea, boric acid, ethylenediaminetetraacetic acid disodium salt dehydrate, formamide, magnesium

chloride

hexahydrate,

StainsAll®,

tris(hydroxymethyl)aminomethane,

(3-

aminopropyl)trimethoxysilane, N,N,N’,N’-tetramethylethylenediamine, ammonium persulfate, glycerol, CelLytic M and human serum from human male AB plasma were used as purchased from Sigma-Aldrich. 40 % acrylamide/bis-acrylamide solution (19:1) was purchased from BioRad. 1000Å nucleoside-derivatized LCAA-CPG solid support with loading densities of 25-40 µmol/g, 1-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite and reagents used for automated DNA synthesis were purchased from BioAutomation. Sephadex G-25 (super fine DNA grade) was used as purchased from Amersham Biosciences. Fetal bovine serum (FBS), phosphate buffered saline (PBS), Dulbecco’s Modified Eagle Medium (DMEM), penicillin streptomycin solution, trypsin and organelles trackers/markers were purchased from Invitrogen. 1 X TAMg buffer was composed of 45 mM Tris, 7.6 mM MgCl2, with pH adjusted to 7.8 using glacial acid. 1 X TBE buffer was composed of 90 mM Tris and boric acid, 1.1 mM EDTA, with a pH of ~


4

Page 5 of 22 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


8.2. All reagents were reagent grade quality and used as received from J & K (China), unless otherwise indicated. Anhydrous DCM was distilled over CaH2. All other solvents were technical grade unless noted. Instruments. Gel scanning was performed on a Fujifilm FLA-9000 scanner. Fluorescence measurements were conducted on HORIBA Jobin YvonTM FluoroMax-4 spectrofluorometer. Standard automated oligonucleotide solid-phase synthesis was performed on BioAutomation MerMade MM6 DNA synthesizer. UV/vis measurements were carried out on Agilent Cary 300 UV-Vis spectrophotometer. Gel electrophoresis experiments were carried out on an acrylamide 20 X 20 cm Maxi Vertical electrophoresis apparatus (MV-20DSYS). Confocal fluorescence imaging was performed on Laser Confocal Scanning Microscope (Leica TCS SP5) with magnification of 63X. The laser used for two-photon experiments was an amplified Ti:Sapphire laser system delivering 50 fs, 800 nm pulses at a 5 kHz repetition rate was used to illuminate a spectrophotometric cuvette, specially designed for low volumes (Hellma 105.202.QS). With a collimated laser beam of cross-section 4 mm. The MTT experiment was conducted in Bio Tek Powerwave XS microplate reader. Column chromatography was performed using 60 Å 40-63 micron silica media (purchased from DAVISIL®) as the solid support. All NMR spectra were recorded on Bruker Avance 300, 400 and 600 MHz spectrometers unless otherwise indicated. 1H NMR and 13C NMR chemical shifts are reported in δ units, parts per million (ppm) relative to the chemical shift of residual solvent.

31

P NMR chemical shifts are reported in δ units, parts per

million (ppm) relative to the 85% phosphoric acid as the internal standard. Deuterated solvents were used as received from J&K. BD FACSCantoTM II flow cytometer was used for fluorescence-activated cell sorting (FACS) studies. Circular dichroism The CD spectra were recorded on a Biologic Science Instrument MOS-450 AFAF-CD Circular Dichroism-Stopped-Flow Spectrophotometer in a 10 mm quartz cuvette using a step resolution of 0.5 nm, a scan speed of 2 nm s-1, a sensitivity of 1 nm, and a response time of 1 s. Samples were prepared in 10 mM concentration in 100 mM sodium chloride, 10 mM sodium phosphate and 10 mM Na2EDTA (pH 7.0) buffer. Prior to the measurement, the samples were treated by heating-cooling (95 – 20 oC) and standing for one night. Thermal denaturation Samples were dissolved in distilled water and prepared in a 30 mg/L solution. The samples were then analyzed by the Agilent Cary 300 UV-Visible


5


Page 6 of 22

Spectrophotometer. The absorption at 260 nm were recorded when the temperature of samples was decreased from 95 °C to 20 °C. The instrument was set as the spectral bandwidth (SBW) = 1.0 nm; average time = 2.0 s; data interval = 0.2 °C; rate = 0.5 min. The path length (cuvette length) was 1 cm. Fetal bovine serum stability assay ~ 400 µg of the tested polymers in 1 X TAMg buffer were spiked with fetal bovine serum (FBS) to yield a final composition of ~150 ng/µL in 10 % FBS and was incubated at 37 °C from Day 0 to Day 7 or from 0 to 24 h. For denaturing gel analysis, the sample was denatured by heating at 60 °C for 20 min with 95 % formamide. Samples were then characterized by 15 % denaturing PAGE and stained with StainAll. Band intensity was obtained with ImageJ and further plotted with respect to time, and fit well to first order exponential decay. Human serum stability assay 17.9 µM of tested polymers were spiked with human serum to yield a final composition of 0.99 ng/µL DNA in 50 % human serum and was incubated at 37 °C for Day 0 to Day 7 or from 0 to 24 h. For denaturing analysis, at which point the sample was denatured by heating at 60 °C for 20 min with 95 % formamide. Samples were then characterized by 15 % denaturing PAGE and stained with StainAll. Band intensity was obtained with ImageJ and further plotted with respect to time, and fit well to first order exponential decay. To determine the mean half-life, bands at 0 time point were identified and used as baseline to remove the background intensity. The decay rate (λ) and half-life (t1/2) were derived as follows. ߇ = ߇௢ ݁ ିఒ௧ ଵ

߬= , ఒ ‫ݐ‬ଵ/ଶ = ߬In2 where τ is time constant, I0 is the initial band intensity and I is the band intensity at time t. Confocal fluorescence imaging Cultured cells were plated on confocal imaging plates as a small drop so as to yield a final density of ~ 4 X 104 cells/cm2. After 30 min incubation, 750 µL DMEM media and polymer samples (110 ng/µL) was added to the plate slowly. After 12 h incubation, the cells were rinsed with media and buffer before further measurements. Confocal cell imaging was performed with a Laser Confocal Scanning Microscope (Leica TCS SP5). The


6

Page 7 of 22 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


excitation wavelength for Cy3 fluorophore is 543 nm and the emission collection range is from 550 to 600 nm. The excitation wavelength for Cy5 fluorophore is 643 nm and the emission collection range is from 650 to 700 nm. MTT assay 1 × 104 cells were seeded in 96 wells plate and cultured overnight in 37 oC incubator with 5% CO2, and then incubated with corresponding samples for 24 h.

Cells were then

incubated with fresh medium containing 0.5 mg/mL MTT for 2 h at 37 °C for the cytotoxicity assay. After incubation, the medium was removed and the solution of DMSO and ethanol (1:1) was added. The absorbance at 570 nm was measured using a microplate reader. The absorbance of each sample has been normalized with its control. Flow Cytometry 1 × 105 cells were seeded on 6-well plates and cultured overnight, and then incubated with corresponding samples for 12 h. After washing with PBS for few times, cells were analyzed by flow cytometer. The fluorescence signal was excited at wavelength of 488 nm and collected from 543 to 627 nm. In vitro GFP Protein Expression GFP plasmid (pAAV-400) was co-transfected with GFP antisense TNA polymers to HeLa cells or HEK293 cells. Briefly, the pAAV-400 plasmid (1µg) and the TNA polymers (0.5, 1, 2 and 4 µg) were co-transfected using Lipofectamine 3000 reagent (0.01 mg/mL, Invitrogen, ThermoFisher Scientific) to cells in serum free medium. Cells treated with only pAAV-400 plasmid (1 µg) were used as the control experiments. After 6 h incubation, medium was replaced with fresh DMEM medium containing 10 % FBS. After 48 h, transfected cells were harvested by treating with a cell lysis solution (CellLytic M cell lysis reagent, Sigma-Aldrich) and centrifuged to remove cell debris. The supernatant was analyzed to determine the amount of GFP protein expression using a spectrofluorometer (Fluormax-4, Horiba Scientific) with an excitation and emission wavelength at 488 and 509 nm, respectively. Relative GFP expression level was then calculated as relative percentage using that of pAAV400 transfected cells as 100 %.

3. RESULTS AND DISCUSSION Synthesis of α-L-threose nucleic acid monomer and characterization


7


Page 8 of 22

Four L-threofuranosyl nucloside monomers 8a-d were synthesized according to the Chaput’s approach.25 The general synthetic route is shown in Scheme 1 and S1. The Silyl-Hilbert-Johnson reaction was utilized to form a series of TNA nucleosides by mixing and heating with compound 4, N,O-bis(trimethylsilyl)-acetamide and trimethylsilyltriflate, together with corresponding compound 5, thymine, compound 6 or N4-benzoylcytosine respectively in different solvent systems. The 3’-silyl protecting groups were then removed by 1 M tetrabutylammonium fluoride in THF to give 7a-d in reasonable yields. DMT group was then coupled to the 3’-hydroxy group on 7 under basic conditions followed by deprotection of 2’-hydroxy groups using cold aqueous 1 M sodium hydroxide solution to afford 8a-d. Compounds 8 are the key intermediates in the synthesis of 2’-phosphoramidite TNA monomers 9 which is firstly reported. In previous report, 2-cyanoethyl N,N-diisopropylchlorophosphoramidite in basic condition was used but it costs US$35 to synthesize ~ 1 g of monomers.26 To reduce the synthetic cost, 2-cyanoethyl N,N,N',N'tetraisopropylphosphoramidite was firstly synthesized (Scheme 1b) and used to phosphorylate compounds 8a-d in the presence of 1H-Tetrazole in anhydrous dichloromethane, resulting in the corresponding 2’-phosphoramidites TNA 9a-d. It is of noted that the use of 2-cyanoethyl N,N,N',N'-tetraisopropylphosphoramidite is highly cost-efficient as it was made from low-cost starting materials. This modified synthetic approach costs four times less than that of 2cyanoethyl N,N-diisopropylchlorophosphoramidite method. All of the compounds were fully characterized by 1H,

13

C and/or

31

P NMR spectroscopies. The data obtained was in good

agreement with the proposed structures.


8

Page 9 of 22 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Scheme 1. Synthetic scheme and structures of (a) TNA polymer and its intermediates, (b) 2cyanoethyl N,N,N',N'-tetraisopropylphosphoramidite. TNA polymer synthesis and characterizations With the 2’-phosphoramidite monomers (9a-d) on hand, sequence-controlled TNA polymers were synthesized on a (fluorophore-labeled) controlled pore glass (CPG) support using an automated DNA synthesizer and standard cyanoethylphosphoramidite chemistry (Scheme1). This involves one monomer at a time. Release of the resulting TNA polymers from CPG is accomplished by reacting with ammonia hydroxide under 55 °C overnight. Desalting was performed to reduce the salt content in the final products. As shown in Figure S1, no obvious


9


Page 10 of 22

orange color during the de-blocking step or no trityl signal was observed after coupling of the first TNA monomer on the universal solid support at the 3’-end when typical solid-phase synthesis protocol was used. Although the frequency and time of coupling reaction of the monomers are increased, the feasibility of TNA synthesis was still restricted by the poor accessible DMT protecting groups in the acid medium for efficient de-blocking reaction. To synthesize the well-designed sequences of TNA strands in a quantitative yield and high purity, the synthetic protocol has to be revised accordingly. In each revised synthetic cycle, the frequency of the de-blocking and coupling reactions are increased by 3 and 2 times respectively. Additionally, each de-blocking reaction time is extended from 30 s to 12 min while each coupling reaction time is extended from 60 s to 15 min. By using the modified synthetic protocol, the successful formation of sequence-designed TNA polymers was confirmed by MALDI-TOF studies (Fig S2-8) while their sequences and molecular mass were listed in table 1. This solid-phase synthetic approach does not rely on the use of manpower because all synthetic cycles in the DNA synthesizer are managed automatically by the computer programme. This is a time-saving approach to synthesize a sequence-controlled synthetic polymer when comparing to other polymerization methods.

Theoretical

Found

TNA Polymer

Sequence 5'-3'

Mass

Mass

Cy5-TNA-A

AAAAAAAAAAAAAAAAAAAA-Cy5

6471.8

6461.4043

Cy3-TNA-T

TTTTTTTTTTTTTTTTTTTT-Cy3

6249.19

6252.4146

Inactive TNA-1

GACAACCAGGGCGTGGTGCTT

6115.58

6136.2656

Inactive TNA-2

GTGCCTATGTCTCAGCCTCTT

6024.46

6049.6128

Anti-GFP TNA

GAGCTGCACGCTGCCGTC

5207.02

5220.4565

5714.61

5728.4043

Cy3-labeled anti-GFP TNA GAGCTGCACGCTGCCGTC-Cy3


10

Page 11 of 22 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Cy5-labeled anti-GFP TNA GAGCTGCACGCTGCCGTC-Cy5

5740.65

5867.2734

Table 1: Sequence and found mass of the sequence-designed TNA Oligonucleotides. Cy3 represents cyanine 3 fluorophore. Cy5 represents cyanine 5 fluorophore.

Binding specificity and affinity studies The binding selectivity and specificity of anti-GFP TNA was investigated by native polyacrylamide gel electrophoresis (PAGE) analysis, circular dichroism (CD) studies and thermal denaturation. In native PAGE analysis, mixing of anti-GFP TNA with its sense-GFP RNA (Fig. 1a, lane 1) or sense-GFP DNA (Fig. 1a, lane 2) showed a new band with different mobilities as compared to its single piece (Fig. 1a, lane 3 to 5). However, there is no interaction between anti-GFP TNA and its non-complementary DNA strand or inactive TNA and sense-GFP DNA (Fig. 1b and Fig. S9). The CD spectra show obvious conformational differences between the homoduplexes (DNA:DNA) and heterduplexes (anti-GFP TNA:sense-GFP DNA). Typically, the CD spectrum from homoduplexes is of a standard B-form helix with maximum positive peak at 275 nm and negative bank at 245 nm. We observed that the spectra of anti-GFP TNA:senseGFP DNA shown in Fig. 1c is relatively consistent with an RNA-like A-form helical conformation with maximum positive band near 290 nm, minimum at ~ 260 nm and strong negative peak near 210 nm. By performing simple molecular modeling (HyperChem 7.0) experiment, we found that the AMBER force-field optimized structures of TNA polymers are a better match to a natural RNA than DNA, with a slightly more unwound, ladder-like arrangement between the synthetic TNA polymer and RNA strand (Fig. S10). The most possible explanation is that both RNA and TNA has an oxygen at 2’ position of the sugar moiety. The steric hindrance of the oxygen atom at 2’ position clashing with the oxygen at 3’ position made the canonical B-form helical conformation to be unfavorable.27-28 There is no such conformational change when non-complementary strands were added to the anti-GFP TNA under the same experimental conditions. These results confirmed the high selectivity and specificity of synthetic anti-GFP TNAs. Thermal denaturation studies showed that melting temperature (Tm) values for anti-GFP TNA:sense-GFP DNA helices were ~ 13 °C lower than that for anti-GFP TNA:sense-GFP RNA


11


Page 12 of 22

complex (Fig. 1d, black and red curves). This means that anti-GPF TNA show a stronger binding affinity toward its complementary sense-GFP RNA than that of DNA in which it is an important support for its gene silencing applications. These results suggest a certain degree of structural incompatibility for anti-GFP TNA: sense-GFP DNA complexes.29 Furthermore, the Tm value for TNA was

much higher than that for phosphorothioate oligonucleotide towards their

complementary RNA strand. (Fig. 1d, red and blue curves). The enhanced binding affinity would emphasize TNA to be a promising antisense agents for biomedical applications.30,31

Figure 1 (a) Native PAGE analysis of the specificity of the anti-GFP TNA with its complementary DNA and RNA. (b) Native PAGE analysis of the sense-GFP DNA with its noncomplementary TNAs. (c) CD spectra of anti-GFP TNA with its sense-GFP DNA. (d) Thermal denaturation studies of anti-GFP TNA and anti-GFP phosphorthiolated DNA strand with their complementary DNA/RNA strands.


12

Page 13 of 22 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Biostability studies To evaluate the biological stability of TNA, we began by comparing the stability of three different samples with the same GFP sequences including DNA, TNA and phosphorothioate oligonucleotide in human serum and fetal bovine serum (Table 2 and Fig. S11-12). Samples were incubated with either 50 % human serum in DMEM media or 10 % FBS in 1 X TAMg buffer under different time points at 37 °C. After incubation, the three samples were evaluated by denaturing PAGE analysis. We found that DNA degrades with a half-life of ~ 5-6 h in both human and fetal bovine serums. As compared to DNA, TNA did not degrade or break down after ~ 3 days of incubation in human serum which is highly comparable to phosphorthiolated-DNA. TNA exhibited even much stronger resistance towards FBS as compared to phosphorothioate oligonucleotide. These results are highly reproducible, meaning that the intrinsic structure of anti-GFP TNA is thoroughly resistant to biological degradation. Our results are in good agreement with previously reported observations.32 These findings warrant further analysis of TNA in therapeutic applications as a biological stable RNA analogue. Confocal fluorescence imaging and flow cytometry studies were used to examine the uptake of TNAs in five different cell lines including HeLa, MCF-7, HepG2, HEK293 and NIH-3T3. 0.2 µM Cy5-labeled TNA samples were incubated with cells for 12 h before measurements. Substantial cellular uptake of the single-stranded TNAs or TNA duplexes were achieved as shown in Fig. 2 and S13. Increasing the concentration of Cy5-labeled anti-GFP TNA resulted in increased cellular TNA uptake to ~ 0.8 µM (Fig. 3a-b). It is concluded that either single-stranded TNAs or duplex TNAs can be easily taken up by a variety of cell lines without the use of lipofectamine transfecting agent, confirming their biocompability and cell-permeability. In comparison to neutral-charged PNA and MO compounds, TNAs exhibit slow clearance and better cellular uptake property in various cell lines. MTT and live-dead staining assays were used to evaluate the cell viability as a function of concentration (Fig. 3c and S14). No significant cytotoxicities were induced in both HeLa and HEK293 cell lines under different concentrations of anti-GFP TNAs. It is of noted that more than 95 % of cells are able to survive and in good health even under high concentration conditions. Thus, TNA could overcome the high toxicity problems caused by LNA compounds as an effective antisense oligonucleotide.


13


Page 14 of 22

Table 2 Half-life of the three tested polymers with the same target GFP sequences in human serum and fetal bovine serum.

Figure 2 Confocal fluorescence images of different cell types treated with 0.2 µM singlestranded Cy5-labeled TNA-A for 12 h. Scale bar is 10 µm.


14

Page 15 of 22 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3 Flow cytometry results of (a) HeLa and (b) HEK293 cells treated with single-stranded Cy3-labeled anti-GFP TNA for 12h as a function of concentrations. The resulting Cy3 fluorescence signals were abstracted from the blank samples. (c) Cell viability studies of HeLa and HEK293 cells in the presence of different concentrations of anti-GFP TNAs.

Suppressing GFP gene expression To explore the gene regulation ability of TNA polymers in cell culture system, its inhibition extent of GFP protein expression was investigated in HEK293 and HeLa cells. The anti-GFP TNA was co-transfected with GFP plasmid formulated with Lipofectamine-3000 to cells. Confocal fluorescence microscopy was used to investigate the inhibition degree of GFP gene expression in HeLa cells treated with different samples. As compared to the untreated HeLa cells, obvious green fluorescence signals were obtained in the GFP vector-treated cell samples (Fig. 4a-b). In contrast, the green fluorescence signals were almost completely suppressed in HeLa cells after treating with pAAV-400 plasmid in the presence of anti-GFP TNAs (Fig. 4c). The extent of GFP gene inhibition was also comparatively examined and quantitatively analysed


15


Page 16 of 22

by measuring intracellular GFP fluorescence intensity after cell lysis. To make it more accurate, all data was normalized by the cellular protein level which was resolved by the Micro-BCA protein assay.31 It found that anti-GFP TNA revealed its inhibition of GFP protein expression in pAAV-400 plasmid treated-HeLa and HEK293 cells shown in Fig. 4d. It is of noted that increasing concentration of anti-GFP TNAs enhances the inhibition extent of GFP expression in both cell lines. Nearly 57.0 ± 0.5 % and 49 ± 1 % of GFP inhibition could be obtained at a dose of 4 µg/mL in HEK293 and HeLa cells respectively. The sequential addition of the transfected GFP plasmid and the anti-GFP TNAs also exhibited a comparable gene suppressing effect with the results obtained in the co-transfected method (Figure 4e). In our design, we expect this antiGFP TNA is not able to trigger the DICER cleavage and induce RNase H-mediated target RNA downregulation for gene silencing applications due to the absence of its free 2’-oxygen which is typically required for the activity of RNase H. Based on the above results, it is highly suggested anti-GFP TNA targeting to the GFP RNA translation start site or sterically preventing the binding of RNA binding protein complexes in order to suppress RNA translation to produce less amount of GFP protein by steric blocking mechanism. This TNA does not need to make use of cellular enzymes for their gene silencing activity, they can be further subjected to spacious chemical modifications which improve their drug-like characteristic.


16

Page 17 of 22 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. Confocal fluorescence imaging of GFP protein expression in HeLa cells (a) before and (b) after treating with transfected pAAV-400 plasmid, and (c) after treating with transfected pAAV-400 plasmid in the presence of anti-GFP TNAs. Scale bar is 10 µm. (d) The extent of GFP protein expression in HEK293 and HeLa cells was quantitatively analysed by measuring intracellular fluorescence intensity after treating with transfected pAAV-400 plasmid in the presence of different doses of anti-GFP TNAs for 24 h and then followed by cell lysis. (e) The extent of GFP protein expression in HEK293 cells was quantitatively analyzed by measuring intracellular fluorescence intensity after treating with 4 µg/mL of anti-GFP TNAs in two different methods (co-transfected and sequential addition) and then followed by cell lysis.

4. CONCLUSIONS In conclusion, we firstly investigate the biological properties and evaluate the potency of TNA polymers consisting of GFP target sequence in cellular environments. This anti-GFP TNA combines high specificity characteristic and strong binding affinity towards its complementary RNA strand with good biological stability and cellular uptake efficiency as well as very low cytotoxicity. Particularly, anti-GFP TNA exhibited much stronger enzymatic resistance toward fetal bovine serum or human serum as compared to traditional antisense oligonucleotide which mean that the intrinsic structure of TNA is thoroughly resistant to biological degradation. The efficacy of anti-GFP TNAs as antisense agents was firstly demonstrated in living cells in which these polymers revealed high antisense activity in terms of suppressing GFP gene expression. The gene inhibition studies of GFP in HeLa and HEK293 cells characterize sequence-designed TNA as a useful tool and a valuable alternative to traditional antisense oligonucleotide such as PNAs, MOs and LNAs for RNA-based therapeutic applications. Additionally, it is important to note that the four TNA phosphoramidite monomers can be cost-efficiently synthesized using firstly reported 2-cyanoethyl N,N,N',N'-tetraisopropylphosphoramidite. Furthermore, sequence-controlled TNAs can also be easily synthesized in a quantitative yield and high purify by increasing the frequency of the de-blocking and coupling reaction and extending their reaction time in each synthesis cycle. Based on the antisense potency of anti-GFP TNAs and their superiority comparing with traditional antisense oligonucleotide, we conclude that TNA with well-designed sequences become functional biomaterials for a wide range of applications in drug discovery and life science research.


17


Page 18 of 22

Conflict of Interest: The authors declare no competing financial interest.

ASSOCIATED CONTENT Supporting Information. Detailed synthetic procedures of TNA monomers and their NMR spectra, MALDI-TOF spectrum of TNA polymers, 3D molecular models, FBS and human serum digestion data, confocal fluorescence imaging results and bright-field images. This material is available free of charge via the Internet at http://pubs.acs.org.

AUTHOR INFORMATION Corresponding Authors Pik Kwan Lo [email protected] ACKNOWLEDGMENT This work was supported by Health and Medical Fund (HMRF 02131376) and City University of Hong Kong (CityU 7004911, 9680104 and 7004655). We thank Mr Cia Hin Lau from Dr. Chung Tin’s group providing us the pAAV-GFP vectors.

REFERENCES (1)

Sharma, V. K.; Rungta, P.; Prasad, A. K. Nucleic Acid Therapeutics: Basic Concepts and Recent Developments. RSC Adv. 2014, 4 (32), 16618.

(2)

Whitesell, L.; Geselowitz, D.; Chavany, C.; Fahmy, B.; Walbridge, S.; Alger, J. R.; Neckers, L. M. Stability, Clearance, and Disposition of Intraventricularly Administered


18

Page 19 of 22 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Oligodeoxynucleotides: Implications for Therapeutic Application within the Central Nervous System. Proc. Natl. Acad. Sci. U. S. A. 1993, 90 (10), 4665–4669. (3)

Davidson, B. L.; McCray, P. B. Current Prospects for RNA Interference-Based Therapies. Nat. Rev. Genet. 2011, 12 (5), 329–340.

(4)

Whitehead, K. A.; Langer, R.; Anderson, D. G. Knocking down Barriers: Advances in siRNA Delivery. Nat. Rev. Drug Discov. 2009, 8 (2), 129–138.

(5)

Nguyen, J.; Szoka, F. C. Nucleic Acid Delivery: The Missing Pieces of the Puzzle? Acc. Chem. Res. 2012, 45 (7), 1153–1162.

(6)

Soutschek, J.; Akinc, A.; Bramlage, B.; Charisse, K.; Constien, R.; Donoghue, M.; Elbashir, S.; Geick, A.; Hadwiger, P.; Harborth, J.; John, M.; Kesavan, V.; Lavine, G.; Pandey, R. K.; Racie, T.; Rajeev, K. G.; Röhl, I.; Toudjarska, I.; Wang, G.; Wuschko, S.; Bumcrot, D.; Koteliansky, V.; Limmer, S.; Manoharan, M.; Vornlocher, H.-P. Therapeutic Silencing of an Endogenous Gene by Systemic Administration of Modified siRNAs. Nature 2004, 432 (7014), 173–178.

(7)

Morihiro, K.; Kasahara, Y.; Obika, S. Biological Applications of Xeno Nucleic Acids. Mol. BioSyst. 2017, 13 (2), 235–245.

(8)

Evers, M. M.; Toonen, L. J. A.; van Roon-Mom, W. M. C. Antisense Oligonucleotides in Therapy for Neurodegenerative Disorders. Adv. Drug Deliv. Rev. 2015, 87, 90–103.

(9)

Koppelhus, U.; Awasthi, S. K.; Zachar, V.; Holst, H. U.; Ebbesen, P.; Nielsen, P. E. CellDependent Differential Cellular Uptake of PNA, Peptides, and PNA-Peptide Conjugates. Antisense Nucleic Acid Drug Dev. 2002, 12 (2), 51–63.

(10)

Hyrup, B.; Nielsen, P. E. Peptide Nucleic Acids (PNA): Synthesis, Properties and Potential Applications. Bioorg. Med. Chem. 1996, 4 (1), 5–23.


19


(11)

Page 20 of 22

Stein, D.; Foster, E.; Huang, S.-B.; Weller, D.; Summerton, J. A Specificity Comparison of Four Antisense Types: Morpholino, 2′-O-Methyl RNA, DNA, and Phosphorothioate DNA. Antisense Nucleic Acid Drug Dev. 1997, 7 (3), 151–157.

(12)

Summerton, J.; Stein, D.; Huang, S. B.; Matthews, P.; Weller, D.; Partridge, M. Morpholino and Phosphorothioate Antisense Oligomers Compared in Cell-Free and InCell Systems. Antisense Nucleic Acid Drug Dev. 1997, 7 (2), 63–70.

(13)

Summerton, J.; Weller, D. Morpholino Antisense Oligomers: Design, Preparation, and Properties. Antisense Nucleic Acid Drug Dev. 1997, 7 (3), 187–195.

(14)

Swayze, E. E.; Siwkowski, A. M.; Wancewicz, E. V.; Migawa, M. T.; Wyrzykiewicz, T. K.; Hung, G.; Monia, B. P.; Bennett, and C. F. Antisense Oligonucleotides Containing Locked Nucleic Acid Improve Potency but Cause Significant Hepatotoxicity in Animals. Nucleic Acids Res. 2007, 35 (2), 687–700.

(15)

Schoning K, Scholz P, Guntha S, Wu X, Krishnamurthy R, E. A. Chemical Etiology of Nucleic Acid Structure: The α -Threofuranosyl-(3’—> 2’) Oligonucleotide System. Science 2000, 290 (5495), 1347–1351.

(16)

Eschenmoser, A. Chemical Etiology of Nucleic Acid Structure. 1999, 284 (5423), 2118– 2125.

(17)

Yang, Y.-W.; Zhang, S.; McCullum, E. O.; Chaput, J. C. Experimental Evidence That GNA and TNA Were Not Sequential Polymers in the Prebiotic Evolution of RNA. J. Mol. Evol. 2007, 65 (3), 289–295.

(18)

Chim, N.; Shi, C.; Sau, S. P.; Nikoomanzar, A.; Chaput, J. C. Structural Basis for TNA Synthesis by an Engineered TNA Polymerase. Nat. Commun. 2017, 8 (1), 1810.

(19)

Dunn, M. R.; Otto, C.; Fenton, K. E.; Chaput, J. C. Improving Polymerase Activity with


20

Page 21 of 22 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Unnatural Substrates by Sampling Mutations in Homologous Protein Architectures. ACS Chem. Biol. 2016, 11 (5), 1210–1219. (20)

Heuberger, B. O.; Switzer, C. Nonenzymatic Oligomerization of RNA by TNA Templates. Org. Lett. 2006, 8 (25), 5809–5811.

(21)

Blain, J. C.; Ricardo, A.; Szostak, J. W. Synthesis and Nonenzymatic Template-Directed Polymerization of 2′-Amino-2′-Deoxythreose Nucleotides. J. Am. Chem. Soc. 2014, 136 (5), 2033–2039.

(22)

Yu, H.; Zhang, S.; Chaput, J. C. Darwinian Evolution of an Alternative Genetic System Provides Support for TNA as an RNA Progenitor. Nat. Chem. 2012, 4 (3), 183–187.

(23)

Chaput, J. C.; Yu, H.; Zhang, S. The Emerging World of Synthetic Genetics. Chem. Biol. 2012, 19 (11), 1360–1371.

(24)

Dunn, M. R.; Jimenez, R. M.; Chaput, J. C. Analysis of Aptamer Discovery and Technology. Nat. Rev. Chem. 2017, 1 (10), 76.

(25)

Sau, S. P.; Fahmi, N. E.; Liao, J.-Y.; Bala, S.; Chaput, J. C. A Scalable Synthesis of α- L Threose Nucleic Acid Monomers. J. Org. Chem. 2016, 81 (6), 2302–2307.

(26)

Zhang, S.; Chaput, J. C. Synthesis of Threose Nucleic Acid (TNA) Phosphoramidite Monomers and Oligonucleotide Polymers. In Current Protocols in Nucleic Acid Chemistry; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2012; p 4.51.1-4.51.26.

(27)

Anosova, I.; Kowal, E. A.; Sisco, N. J.; Sau, S.; Liao, J.-Y.; Bala, S.; Rozners, E.; Egli, M.; Chaput, J. C.; Van Horn, W. D. Structural Insights into Conformation Differences between DNA/TNA and RNA/TNA Chimeric Duplexes. ChemBioChem 2016, 17 (18), 1705–1708.

(28)

Ebert, M.-O.; Mang, C.; Krishnamurthy, R.; Eschenmoser, A.; Jaun, B. The Structure of a


21


Page 22 of 22

TNA−TNA Complex in Solution: NMR Study of the Octamer Duplex Derived from α-( L )-Threofuranosyl-(3′-2′)-CGAATTCG. J. Am. Chem. Soc. 2008, 130 (45), 15105–15115. (29)

Pallan, P. S.; Wilds, C. J.; Wawrzak, Z.; Krishnamurthy, R.; Eschenmoser, A.; Egli, M. Why Does TNA Cross-Pair More Strongly with RNA Than with DNA? An Answer from X-Ray Analysis. Angew. Chemie - Int. Ed. 2003, 42 (47), 5893–5895.

(30)

Kim, S. H.; Mok, H.; Jeong, J. H.; Kim, S. W.; Park, T. G. Comparative Evaluation of Target-Specific GFP Gene Silencing Efficiencies for Antisense ODN, Synthetic siRNA, and siRNA Plasmid Complexed with PEI-PEG-FOL Conjugate. Bioconjug. Chem. 2006, 17 (1), 241–244.

(31)

Mok, H.; Ji, W. P.; Tae, G. P. Antisense Oligodeoxynucleotide-Conjugated Hyaluronic Acid/protamine Nanocomplexes for Intracellular Gene Inhibition. Bioconjug. Chem. 2007, 18 (5), 1483–1489.

(32)

Culbertson, M. C.; Temburnikar, K. W.; Sau, S. P.; Liao, J. Y.; Bala, S.; Chaput, J. C. Evaluating TNA Stability under Simulated Physiological Conditions. Bioorganic Med. Chem. Lett. 2016, 26 (10), 2418–2421.

TOC


22

Î±-l-Threose Nucleic Acids as Biocompatible Antisense

Recommend Documents